crispr cas9 expression vector pspcas9 bb 2a gfp (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
crispr cas9 expression vector pspcas9 bb 2a gfp
Crispr Cas9 Expression Vector Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pmc13617562-29-14-19
Average 96 stars, based on 4114 article reviews
Crispr Cas9 Expression Vector Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pmc13617562-29-14-19
Average 96 stars, based on 4114 article reviews
crispr cas9 expression vector pspcas9 bb 2a gfp - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Injection:Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes. Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Sequencing:Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes. Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Expressing:Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: An efficient low cost means of biophysical gene transfection in primary cells. Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes. Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Article Title: In vivo proteomic labeling reveals diverse proteomes for therapeutic targets. Article Snippet: Article In vivo proteomic labeling reveals diverse proteomes for therapeutic targets Article Title: An efficient low cost means of biophysical gene transfection in primary cells Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics. Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a CRISPR:Article Title: An efficient low cost means of biophysical gene transfection in primary cells. Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Article Title: An efficient low cost means of biophysical gene transfection in primary cells Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Clone Assay:Article Title: An efficient low cost means of biophysical gene transfection in primary cells. Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: An efficient low cost means of biophysical gene transfection in primary cells Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics. Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Transfection:Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Plasmid Preparation:Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Article Title: In vivo proteomic labeling reveals diverse proteomes for therapeutic targets. Article Snippet: Article In vivo proteomic labeling reveals diverse proteomes for therapeutic targets Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics. Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a other:Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology Article Snippet: Libraries were then purified, quantified by Qubit, assessed for fragment size, and multiplexed for Illumina sequencing. |