grna cas9 expression vector made in (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
grna cas9 expression vector made in
Grna Cas9 Expression Vector Made In, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4076 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__27__714694-254-9-21
Average 96 stars, based on 4076 article reviews
Grna Cas9 Expression Vector Made In, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4076 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__27__714694-254-9-21
Average 96 stars, based on 4076 article reviews
grna cas9 expression vector made in - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Injection:Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes. Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Sequencing:Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes. Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Expressing:Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: An efficient low cost means of biophysical gene transfection in primary cells. Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes. Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Article Title: Identification of stress specific autophagy regulators from tandem CRISPR screens Article Snippet: sgRNA pairs targeting genes of interest were selected from the transEDIT-dual CRISPR Whole Genome Arrayed Library (Transomic Technologies, Huntsville, AL). .. They were used in conjunction with a Article Title: An efficient low cost means of biophysical gene transfection in primary cells Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics. Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a CRISPR:Article Title: An efficient low cost means of biophysical gene transfection in primary cells. Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Article Title: An efficient low cost means of biophysical gene transfection in primary cells Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Clone Assay:Article Title: An efficient low cost means of biophysical gene transfection in primary cells. Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: An efficient low cost means of biophysical gene transfection in primary cells Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics. Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Transfection:Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Plasmid Preparation:Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment. Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes. Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics. Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Synthesized:Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a |
