Review



cas9 coding dna plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc cas9 coding dna plasmid
    Cas9 Coding Dna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 3003 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__64898__2026__02__03__703491-298-12-17
    Average 96 stars, based on 3003 article reviews
    cas9 coding dna plasmid - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: IRF5 Promotes Influenza Virus-Induced Inflammatory Responses in Human Induced Pluripotent Stem Cell-Derived Myeloid Cells and Murine Models
    Article Snippet: .. Briefly, Kolf2 iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector; Lonza) with Cas9 coding plasmid (hCas9; Addgene 41815), single guide RNA (sgRNA) plasmid (CRISPR guides, left CRISPR_IRF5, CCAAGT GGAAGGCCAACCTGCGC, and right CRISPR_IRF5, GACTTCCGCCTCATCTACGACGG), and donor plasmid containing 5= and 3= homology arms for IRF5 targeting and the pL1-EF1 Puro-L2 cassette. ..

    Article Title: BEAR reveals that increased fidelity variants can successfully reduce the mismatch tolerance of adenine but not cytosine base editors
    Article Snippet: .. The Cas9 coding plasmid used was pX330-Flag-wtSpCas9 (Addgene #92353). .. The dCas9 coding plasmid used was pX330-Flag-dSpCas9 (Addgene #92113).

    Article Title: Exploiting induced pluripotent stem cell-derived macrophages to unravel host factors influencing Chlamydia trachomatis pathogenesis.
    Article Snippet: .. Human iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector, LONZA) with Cas9 coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid. ..

    Article Title: IRF5 Promotes Influenza Virus-Induced Inflammatory Responses in Human Induced Pluripotent Stem Cell-Derived Myeloid Cells and Murine Models
    Article Snippet: .. Briefly, Kolf2 iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector; Lonza) with Cas9 coding plasmid (hCas9; Addgene 41815), single guide RNA (sgRNA) plasmid (CRISPR guides, left CRISPR_IRF5, CCAAGTGGAAGGCCAACCTGCGC, and right CRISPR_IRF5, GACTTCCGCCTCATCTACGACGG), and donor plasmid containing 5′ and 3′ homology arms for IRF5 targeting and the pL1-EF1αPuro-L2 cassette. ..

    Article Title: Loss of IL-10 signaling in macrophages limits bacterial killing driven by prostaglandin E2
    Article Snippet: .. Human iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector; Lonza) with Cas9 coding plasmid (hCas9, 41815; Addgene), single guide RNA plasmid, and donor plasmid. ..

    Article Title: Exploiting induced pluripotent stem cell-derived macrophages to unravel host factors influencing Chlamydia trachomatis pathogenesis
    Article Snippet: .. Human iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector, LONZA) with Cas9 coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid. ..

    Article Title: Tyr 192 Regulates Lymphocyte-Specific Tyrosine Kinase Activity in T Cells.
    Article Snippet: .. Two subcloned Jurkat TAg cell lines were cotransfected with Cas9 coding plasmid (pX330-U6-chimeric-BB-CBh-hSpCas9, Addgene) with guide sequences designed to target the Lck at the codon for Tyr192, pEGFP-N1 plasmid (Clontech), and ssDNA repair sequences (Lck Y192F, Lck Y192E, or Lck Y505F). ..

    Article Title: Cereblon influences the timing of muscle differentiation in Ciona tadpoles.
    Article Snippet: .. The Cas9 coding plasmid was a gift from Lionel Christiaen (Addgene 59987). ..

    CRISPR:

    Article Title: IRF5 Promotes Influenza Virus-Induced Inflammatory Responses in Human Induced Pluripotent Stem Cell-Derived Myeloid Cells and Murine Models
    Article Snippet: .. Briefly, Kolf2 iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector; Lonza) with Cas9 coding plasmid (hCas9; Addgene 41815), single guide RNA (sgRNA) plasmid (CRISPR guides, left CRISPR_IRF5, CCAAGT GGAAGGCCAACCTGCGC, and right CRISPR_IRF5, GACTTCCGCCTCATCTACGACGG), and donor plasmid containing 5= and 3= homology arms for IRF5 targeting and the pL1-EF1 Puro-L2 cassette. ..

    Article Title: IRF5 Promotes Influenza Virus-Induced Inflammatory Responses in Human Induced Pluripotent Stem Cell-Derived Myeloid Cells and Murine Models
    Article Snippet: .. Briefly, Kolf2 iPSCs were dissociated to single cells and nucleofected (Amaxa2b nucleofector; Lonza) with Cas9 coding plasmid (hCas9; Addgene 41815), single guide RNA (sgRNA) plasmid (CRISPR guides, left CRISPR_IRF5, CCAAGTGGAAGGCCAACCTGCGC, and right CRISPR_IRF5, GACTTCCGCCTCATCTACGACGG), and donor plasmid containing 5′ and 3′ homology arms for IRF5 targeting and the pL1-EF1αPuro-L2 cassette. ..



    Similar Products

    96
    Addgene inc cas9 coding dna plasmid
    Cas9 Coding Dna Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__64898__2026__02__03__703491-298-12-17
    Average 96 stars, based on 1 article reviews
    cas9 coding dna plasmid - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    Addgene inc spcas9 coding region
    (A) Table of the Cas9 orthologs utilized in this work, showing their size (amino acid) and PAM sequence (5’). (B) Schematic size comparisons of the panel of Cas9 orthologs tested with <t>SpCas9</t> and other compact CRISPR systems commonly used for in vivo genome editing. (C) Schematic outlining the experimental steps to evaluate Cas9 ortholog editing efficiency by tdTomato knock-out (KO), quantified by flow cytometry analysis. PiggyBac constructs encode for: ortholog-specific hU6-sgRNA cassettes and puromycin selection gene; doxycycline-inducible Cas9 orthologs and hygromycin selection gene. (D–E) Comparison of SpCas9 cleavage efficiency with Cco, Cme2, Gsp, Msc, Nsp, Sdo and Tmo Cas9 orthologs using three ortholog-specific spacer sequences targeting the tdTomato gene in mESC (D) and HEK293T cells (E). Editing efficiencies at individual target sites are shown in the left panels, while mean editing efficiencies for each Cas9 ortholog across the three sites are presented in the right panels. (F) Heatmaps showing editing efficiencies of Cme2 (left) and Msc (right) using twelve distinct sgRNAs, quantified by flow cytometry. Asterisks indicate P-values from unpaired t -test comparing three independent biological replicates to the respective controls. *P < 0.05. Error bars ± SD.
    Spcas9 Coding Region, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/SP-Cas9+(Plasmid+%2362731)/bio_rxiv__64898__2026__01__12__698990-197-0-10
    Average 96 stars, based on 1 article reviews
    spcas9 coding region - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    91
    Addgene inc vector carrying ace2 coding sequences
    (A) Table of the Cas9 orthologs utilized in this work, showing their size (amino acid) and PAM sequence (5’). (B) Schematic size comparisons of the panel of Cas9 orthologs tested with <t>SpCas9</t> and other compact CRISPR systems commonly used for in vivo genome editing. (C) Schematic outlining the experimental steps to evaluate Cas9 ortholog editing efficiency by tdTomato knock-out (KO), quantified by flow cytometry analysis. PiggyBac constructs encode for: ortholog-specific hU6-sgRNA cassettes and puromycin selection gene; doxycycline-inducible Cas9 orthologs and hygromycin selection gene. (D–E) Comparison of SpCas9 cleavage efficiency with Cco, Cme2, Gsp, Msc, Nsp, Sdo and Tmo Cas9 orthologs using three ortholog-specific spacer sequences targeting the tdTomato gene in mESC (D) and HEK293T cells (E). Editing efficiencies at individual target sites are shown in the left panels, while mean editing efficiencies for each Cas9 ortholog across the three sites are presented in the right panels. (F) Heatmaps showing editing efficiencies of Cme2 (left) and Msc (right) using twelve distinct sgRNAs, quantified by flow cytometry. Asterisks indicate P-values from unpaired t -test comparing three independent biological replicates to the respective controls. *P < 0.05. Error bars ± SD.
    Vector Carrying Ace2 Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/ACE2+g1+%2B+Cas9+(Plasmid+%23153011)/pm40133950-166-13-23
    Average 91 stars, based on 1 article reviews
    vector carrying ace2 coding sequences - by Bioz Stars, 2026-10
    91/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid coding cas9 ng
    a , Overview of the <t>CRISPR-Cas9</t> editing strategy to seamlessly integrate DNA cassettes as fusions to human protein-coding genes and ways in which the results have been evaluated. b , Schematic of knock-in vectors and overview of gene editing. The system comprises of three plasmids: plasmid 1, a “donor vector” that encodes an antibiotic resistance gene as a selection marker fused to P2A self-cleaving peptide (purple), plasmid 2, a “donor cleaving vector” that carries the Scramble-gRNA (Sc-gRNA) (orange) and Cas9 variant SpCas9-NG (black), and plasmid 3, a “locus-specific vector” that encodes a library of gRNAs targeting 5’ and 3’ ends of protein-coding sequences of 18,804 human genes that defines the genomic target to be modified by SpCas9-NG (brown).
    Plasmid Coding Cas9 Ng, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/pX330-SpCas9-NG+(Plasmid+%23117919)/bio_rxiv__2025__03__04__641506-159-1-8
    Average 93 stars, based on 1 article reviews
    plasmid coding cas9 ng - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    96
    Addgene inc spcas9 coding sequences
    Fig. 2 The modified 3TC scaffold boosts <t>SpCas9</t> gRNA expression levels compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Dunnett’s multiple comparisons test was performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2 × 4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001
    Spcas9 Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/SP-Cas9+(Plasmid+%2362731)/pm39939860-134-6-17
    Average 96 stars, based on 1 article reviews
    spcas9 coding sequences - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    93
    Addgene inc cas9 coding sequence
    Fig. 2 The modified 3TC scaffold boosts <t>SpCas9</t> gRNA expression levels compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Dunnett’s multiple comparisons test was performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2 × 4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001
    Cas9 Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/pUF-Cas9-pre-sgRNA+(Plasmid+%23137845)/pmc11779973-250-2-7
    Average 93 stars, based on 1 article reviews
    cas9 coding sequence - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc vitro crispr ‒ cas9 library screen crispr cas9 long non coding rna lncrna activation screens
    Fig. 2 The modified 3TC scaffold boosts <t>SpCas9</t> gRNA expression levels compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Dunnett’s multiple comparisons test was performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2 × 4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001
    Vitro Crispr ‒ Cas9 Library Screen Crispr Cas9 Long Non Coding Rna Lncrna Activation Screens, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+coding+plasmid/Human+CRISPR+lncRNA+Activation+Pooled+Library+(SAM+-+3+plasmid+system)+(Pooled+Library+%231000000106)/ppr0958996-65-1-25
    Average 93 stars, based on 1 article reviews
    vitro crispr ‒ cas9 library screen crispr cas9 long non coding rna lncrna activation screens - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    Image Search Results


    (A) Table of the Cas9 orthologs utilized in this work, showing their size (amino acid) and PAM sequence (5’). (B) Schematic size comparisons of the panel of Cas9 orthologs tested with SpCas9 and other compact CRISPR systems commonly used for in vivo genome editing. (C) Schematic outlining the experimental steps to evaluate Cas9 ortholog editing efficiency by tdTomato knock-out (KO), quantified by flow cytometry analysis. PiggyBac constructs encode for: ortholog-specific hU6-sgRNA cassettes and puromycin selection gene; doxycycline-inducible Cas9 orthologs and hygromycin selection gene. (D–E) Comparison of SpCas9 cleavage efficiency with Cco, Cme2, Gsp, Msc, Nsp, Sdo and Tmo Cas9 orthologs using three ortholog-specific spacer sequences targeting the tdTomato gene in mESC (D) and HEK293T cells (E). Editing efficiencies at individual target sites are shown in the left panels, while mean editing efficiencies for each Cas9 ortholog across the three sites are presented in the right panels. (F) Heatmaps showing editing efficiencies of Cme2 (left) and Msc (right) using twelve distinct sgRNAs, quantified by flow cytometry. Asterisks indicate P-values from unpaired t -test comparing three independent biological replicates to the respective controls. *P < 0.05. Error bars ± SD.

    Journal: bioRxiv

    Article Title: Iterative engineering of a compact Cas9 ortholog for in vivo gene editing via single AAV delivery

    doi: 10.64898/2026.01.12.698990

    Figure Lengend Snippet: (A) Table of the Cas9 orthologs utilized in this work, showing their size (amino acid) and PAM sequence (5’). (B) Schematic size comparisons of the panel of Cas9 orthologs tested with SpCas9 and other compact CRISPR systems commonly used for in vivo genome editing. (C) Schematic outlining the experimental steps to evaluate Cas9 ortholog editing efficiency by tdTomato knock-out (KO), quantified by flow cytometry analysis. PiggyBac constructs encode for: ortholog-specific hU6-sgRNA cassettes and puromycin selection gene; doxycycline-inducible Cas9 orthologs and hygromycin selection gene. (D–E) Comparison of SpCas9 cleavage efficiency with Cco, Cme2, Gsp, Msc, Nsp, Sdo and Tmo Cas9 orthologs using three ortholog-specific spacer sequences targeting the tdTomato gene in mESC (D) and HEK293T cells (E). Editing efficiencies at individual target sites are shown in the left panels, while mean editing efficiencies for each Cas9 ortholog across the three sites are presented in the right panels. (F) Heatmaps showing editing efficiencies of Cme2 (left) and Msc (right) using twelve distinct sgRNAs, quantified by flow cytometry. Asterisks indicate P-values from unpaired t -test comparing three independent biological replicates to the respective controls. *P < 0.05. Error bars ± SD.

    Article Snippet: SpCas9 coding region and sgRNA cassette were amplified from pX330-gRNA (Addgene #158973).

    Techniques: Sequencing, CRISPR, In Vivo, Knock-Out, Flow Cytometry, Construct, Selection, Comparison

    a , Overview of the CRISPR-Cas9 editing strategy to seamlessly integrate DNA cassettes as fusions to human protein-coding genes and ways in which the results have been evaluated. b , Schematic of knock-in vectors and overview of gene editing. The system comprises of three plasmids: plasmid 1, a “donor vector” that encodes an antibiotic resistance gene as a selection marker fused to P2A self-cleaving peptide (purple), plasmid 2, a “donor cleaving vector” that carries the Scramble-gRNA (Sc-gRNA) (orange) and Cas9 variant SpCas9-NG (black), and plasmid 3, a “locus-specific vector” that encodes a library of gRNAs targeting 5’ and 3’ ends of protein-coding sequences of 18,804 human genes that defines the genomic target to be modified by SpCas9-NG (brown).

    Journal: bioRxiv

    Article Title: A strategy for genome-wide seamless tagging of human protein-coding genes

    doi: 10.1101/2025.03.04.641506

    Figure Lengend Snippet: a , Overview of the CRISPR-Cas9 editing strategy to seamlessly integrate DNA cassettes as fusions to human protein-coding genes and ways in which the results have been evaluated. b , Schematic of knock-in vectors and overview of gene editing. The system comprises of three plasmids: plasmid 1, a “donor vector” that encodes an antibiotic resistance gene as a selection marker fused to P2A self-cleaving peptide (purple), plasmid 2, a “donor cleaving vector” that carries the Scramble-gRNA (Sc-gRNA) (orange) and Cas9 variant SpCas9-NG (black), and plasmid 3, a “locus-specific vector” that encodes a library of gRNAs targeting 5’ and 3’ ends of protein-coding sequences of 18,804 human genes that defines the genomic target to be modified by SpCas9-NG (brown).

    Article Snippet: The plasmid coding Cas9-NG (34) was purchased from Addgene (PX330-SpCAS9-NG).

    Techniques: CRISPR, Knock-In, Plasmid Preparation, Selection, Marker, Variant Assay, Modification

    a , Design of donor-cleaving plasmid. The U6 promoter-based expression cassette followed by the Sc-gRNA (orange), gRNA scaffold (blue) and termination signal sequence (red). b , Design of gRNA-CRISPR-library plasmid. The U6 promoter-based expression cassette followed by the library gRNAs targeting 18,804 human genes including their splice variants (cyan), gRNA scaffold (blue), capture sequence (pink) and termination signal sequence (red). c , Efficiency of NHEJ-based strategies using two different gRNA cleaving vectors. The efficiency of CRISPR/Cas9-induced NHEJ-mediated DNA integration was tested by targeting five human protein-coding genes to insert four types of minicircle (MC) donor vectors targeted by distinct guide RNAs directed against different PAM sequences, TGG, AGG, or CGG (MC-Sc-gRNA-TGG, MC-Sc-gRNA-AGG, MC-VKG1-gRNA-TGG and MC-VKG1-gRNA-CGG).

    Journal: bioRxiv

    Article Title: A strategy for genome-wide seamless tagging of human protein-coding genes

    doi: 10.1101/2025.03.04.641506

    Figure Lengend Snippet: a , Design of donor-cleaving plasmid. The U6 promoter-based expression cassette followed by the Sc-gRNA (orange), gRNA scaffold (blue) and termination signal sequence (red). b , Design of gRNA-CRISPR-library plasmid. The U6 promoter-based expression cassette followed by the library gRNAs targeting 18,804 human genes including their splice variants (cyan), gRNA scaffold (blue), capture sequence (pink) and termination signal sequence (red). c , Efficiency of NHEJ-based strategies using two different gRNA cleaving vectors. The efficiency of CRISPR/Cas9-induced NHEJ-mediated DNA integration was tested by targeting five human protein-coding genes to insert four types of minicircle (MC) donor vectors targeted by distinct guide RNAs directed against different PAM sequences, TGG, AGG, or CGG (MC-Sc-gRNA-TGG, MC-Sc-gRNA-AGG, MC-VKG1-gRNA-TGG and MC-VKG1-gRNA-CGG).

    Article Snippet: The plasmid coding Cas9-NG (34) was purchased from Addgene (PX330-SpCAS9-NG).

    Techniques: Plasmid Preparation, Expressing, Sequencing, CRISPR

    We designed a genome-wide resource of two gRNA libraries consisting of gRNA that 1, target PAMs resulting in the only in-frame double strand breaks; 2, minimal off-target Cas9 cleavage; 3, maximal on-target Cas9 cleavage, 4, avoidance of homopolymer stretches (e.g., AAAA, GGGG) and 5, GC content between 20 to 80%. Following the above criteria, our libraries consist of a minimum of 1 and maximum of 8 gRNAs per splice variant of human genes.

    Journal: bioRxiv

    Article Title: A strategy for genome-wide seamless tagging of human protein-coding genes

    doi: 10.1101/2025.03.04.641506

    Figure Lengend Snippet: We designed a genome-wide resource of two gRNA libraries consisting of gRNA that 1, target PAMs resulting in the only in-frame double strand breaks; 2, minimal off-target Cas9 cleavage; 3, maximal on-target Cas9 cleavage, 4, avoidance of homopolymer stretches (e.g., AAAA, GGGG) and 5, GC content between 20 to 80%. Following the above criteria, our libraries consist of a minimum of 1 and maximum of 8 gRNAs per splice variant of human genes.

    Article Snippet: The plasmid coding Cas9-NG (34) was purchased from Addgene (PX330-SpCAS9-NG).

    Techniques: Genome Wide, Variant Assay

    a , Visualization of mixed pools of cells in which endogenous proteins are fused to mClover3 using our CRISPR/Cas9-NHEJ-based strategy. Cells vary in fluorescence intensity and patterns of expression suggesting tagging of many proteins with varying abundances and different subcellular localizations. Scale bar is 50µm. b , NGS results indicate that ∼80 % of the human genes were tagged 5’ or 3’ to protein-coding sequences in the genome of HEK293T cells. c , The graph shows the distribution of abundance for all proteins expressed in HEK293T versus successfully or unsuccessfully detected targets; boxes represent 25th, 50th, and75th percentiles, and whiskers represent 1.5 times the interquartile range. Median is indicated by a white line. Outliers are not shown. Statistical significance p-value is 5.5 × 10 -28 and is calculated by Student’s t-test. Data indicates that low protein abundance posed a significant challenge to successful tagging, as the proteins that were not successfully tagged displayed low or no expression levels in HEK 293T cells. d , NGS results indicate that 89.7% of the essential genes were tagged 5’ or 3’ to protein-coding sequences in the genome. e , the distribution of abundance of essential proteins expressed in HEK 293T versus successfully or unsuccessfully tagged genes; boxes represent 25th, 50th, and 75th percentiles, and whiskers represent 1.5 times the interquartile range. Median is indicated by a white line. Statistical significance p-value is 1.02 × 10 -2 and is calculated by Student’s t-test. Data indicates that low protein abundance posed a challenge to successful tagging of essential genes, as the proteins that were not successfully tagged displayed low expression levels in HEK 293T cells. f , comparison of annotated protein localizations between PRISM and the Human Protein Atlas (HPA) datasets (37). The diagram features colored bands that correspond to groups of proteins with similar localization annotations between our data set and HPA. The width of each band is proportional to the number of proteins in the group. g , imaging analysis of individual successful targets. mClover3 fluorescence intensity and subcellular localization vary widely for each gene.

    Journal: bioRxiv

    Article Title: A strategy for genome-wide seamless tagging of human protein-coding genes

    doi: 10.1101/2025.03.04.641506

    Figure Lengend Snippet: a , Visualization of mixed pools of cells in which endogenous proteins are fused to mClover3 using our CRISPR/Cas9-NHEJ-based strategy. Cells vary in fluorescence intensity and patterns of expression suggesting tagging of many proteins with varying abundances and different subcellular localizations. Scale bar is 50µm. b , NGS results indicate that ∼80 % of the human genes were tagged 5’ or 3’ to protein-coding sequences in the genome of HEK293T cells. c , The graph shows the distribution of abundance for all proteins expressed in HEK293T versus successfully or unsuccessfully detected targets; boxes represent 25th, 50th, and75th percentiles, and whiskers represent 1.5 times the interquartile range. Median is indicated by a white line. Outliers are not shown. Statistical significance p-value is 5.5 × 10 -28 and is calculated by Student’s t-test. Data indicates that low protein abundance posed a significant challenge to successful tagging, as the proteins that were not successfully tagged displayed low or no expression levels in HEK 293T cells. d , NGS results indicate that 89.7% of the essential genes were tagged 5’ or 3’ to protein-coding sequences in the genome. e , the distribution of abundance of essential proteins expressed in HEK 293T versus successfully or unsuccessfully tagged genes; boxes represent 25th, 50th, and 75th percentiles, and whiskers represent 1.5 times the interquartile range. Median is indicated by a white line. Statistical significance p-value is 1.02 × 10 -2 and is calculated by Student’s t-test. Data indicates that low protein abundance posed a challenge to successful tagging of essential genes, as the proteins that were not successfully tagged displayed low expression levels in HEK 293T cells. f , comparison of annotated protein localizations between PRISM and the Human Protein Atlas (HPA) datasets (37). The diagram features colored bands that correspond to groups of proteins with similar localization annotations between our data set and HPA. The width of each band is proportional to the number of proteins in the group. g , imaging analysis of individual successful targets. mClover3 fluorescence intensity and subcellular localization vary widely for each gene.

    Article Snippet: The plasmid coding Cas9-NG (34) was purchased from Addgene (PX330-SpCAS9-NG).

    Techniques: CRISPR, Fluorescence, Expressing, Comparison, Imaging

    V isualization of each single cell in which endogenous proteins are fused to mClover3 using our CRISPR/Cas9-NHEJ-based strategy. We observed variations in fluorescence intensity and patterns of expression, suggesting successful tagging of multiple proteins with varying abundances and different subcellular localizations. Since single cells were collected randomly, some proteins may appear more than once. However, if they were collected from the same plate, they were discarded from the analysis, assuming that they could come from the same original tagged cells. Conversely, if they were collected from different plates, they were kept in the analysis since they could be another confirmation of robust tagging, as they show the same localization and fluorescent intensity.

    Journal: bioRxiv

    Article Title: A strategy for genome-wide seamless tagging of human protein-coding genes

    doi: 10.1101/2025.03.04.641506

    Figure Lengend Snippet: V isualization of each single cell in which endogenous proteins are fused to mClover3 using our CRISPR/Cas9-NHEJ-based strategy. We observed variations in fluorescence intensity and patterns of expression, suggesting successful tagging of multiple proteins with varying abundances and different subcellular localizations. Since single cells were collected randomly, some proteins may appear more than once. However, if they were collected from the same plate, they were discarded from the analysis, assuming that they could come from the same original tagged cells. Conversely, if they were collected from different plates, they were kept in the analysis since they could be another confirmation of robust tagging, as they show the same localization and fluorescent intensity.

    Article Snippet: The plasmid coding Cas9-NG (34) was purchased from Addgene (PX330-SpCAS9-NG).

    Techniques: CRISPR, Fluorescence, Expressing

    Fig. 2 The modified 3TC scaffold boosts SpCas9 gRNA expression levels compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Dunnett’s multiple comparisons test was performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2 × 4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001

    Journal: BMC genomics

    Article Title: Optimal SpCas9- and SaCas9-mediated gene editing by enhancing gRNA transcript levels through scaffold poly-T tract reduction.

    doi: 10.1186/s12864-025-11317-2

    Figure Lengend Snippet: Fig. 2 The modified 3TC scaffold boosts SpCas9 gRNA expression levels compared to the original 4T scaffold. (A) DNA sequence of the 4T and modified 3TC scaffolds. (B) Relative quantification (RQ) of mDmd gRNA delivered by nucleofection of PX459.V2 (4T) to C2C12 cells, by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Dunnett’s multiple comparisons test was performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001. (C, D, E) Comparison of the relative quantities of mDmd Sp gRNA, delivered by PX459.V2, pdg459.V2 (2 × 4T) and PX459.V3 (3TC), measured by qRT-PCR. Mean Log2RQ ± 95% CI; n = 3. One-way ANOVA with Tukey’s multiple comparisons test performed on ΔΔCT values, **p ≤ 0.01, ***p ≤ 0.001

    Article Snippet: SaCas9Puro.V2 was generated by replacing the SpCas9 coding sequences of PX459.V2 with SaCas9 coding sequences from PX601 (Addgene #61591).

    Techniques: Modification, Expressing, Sequencing, Quantitative Proteomics, Quantitative RT-PCR, Comparison

    Fig. 5 Editing efficiencies of high-fidelity SpCas9s with the 3TC scaffold. Comparison of PX459.V2 SpCas9-HF1 (4T), PX459.V3 SpCas9-HF1 (3TC), PX459.V2 eSpCas9(1.1) (4T) and PX459.V3 eSpCas9(1.1) (3TC) plasmids de livered by lipofection at a (A) high and (B) low plasmid dose without puro mycin selection in HEK239T cells, assessed by deep amplicon sequencing. Mean ± SEM; n = 3. Two-way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. (C) Editing efficiencies of hDMD-B in the G19 gRNA configuration with WT and high-fidelity Sp-Cas9 plasmids delivered by nucleofection with puromycin selection in HEK293Ts. Two- way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, ***p ≤ 0.001

    Journal: BMC genomics

    Article Title: Optimal SpCas9- and SaCas9-mediated gene editing by enhancing gRNA transcript levels through scaffold poly-T tract reduction.

    doi: 10.1186/s12864-025-11317-2

    Figure Lengend Snippet: Fig. 5 Editing efficiencies of high-fidelity SpCas9s with the 3TC scaffold. Comparison of PX459.V2 SpCas9-HF1 (4T), PX459.V3 SpCas9-HF1 (3TC), PX459.V2 eSpCas9(1.1) (4T) and PX459.V3 eSpCas9(1.1) (3TC) plasmids de livered by lipofection at a (A) high and (B) low plasmid dose without puro mycin selection in HEK239T cells, assessed by deep amplicon sequencing. Mean ± SEM; n = 3. Two-way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. (C) Editing efficiencies of hDMD-B in the G19 gRNA configuration with WT and high-fidelity Sp-Cas9 plasmids delivered by nucleofection with puromycin selection in HEK293Ts. Two- way ANOVA with Šídák’s multiple comparisons test; *p ≤ 0.05, ***p ≤ 0.001

    Article Snippet: SaCas9Puro.V2 was generated by replacing the SpCas9 coding sequences of PX459.V2 with SaCas9 coding sequences from PX601 (Addgene #61591).

    Techniques: Comparison, Plasmid Preparation, Selection, Amplification, Sequencing