Review



caption a7 vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc caption a7 vector
    Caption A7 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2723 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+vector/pcDNA3%2E1(%2B)+Laccase2+MCS+Exon+Vector+(Plasmid+%2369893)/pmc07511192-131-18-27
    Average 96 stars, based on 2723 article reviews
    caption a7 vector - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
    Article Snippet: The PCR product was cloned into vector pTA2 (Toyobo, Osaka, Japan), and the construct was confirmed using sequencing (pYS1). .. Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2. ..

    Recombinant:

    Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
    Article Snippet: The PCR product was cloned into vector pTA2 (Toyobo, Osaka, Japan), and the construct was confirmed using sequencing (pYS1). .. Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2. ..

    Transgenic Assay:

    Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
    Article Snippet: The PCR product was cloned into vector pTA2 (Toyobo, Osaka, Japan), and the construct was confirmed using sequencing (pYS1). .. Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2. ..

    Construct:

    Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
    Article Snippet: The PCR product was cloned into vector pTA2 (Toyobo, Osaka, Japan), and the construct was confirmed using sequencing (pYS1). .. Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2. ..

    Amplification:

    Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
    Article Snippet: The PCR product was cloned into vector pTA2 (Toyobo, Osaka, Japan), and the construct was confirmed using sequencing (pYS1). .. Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2. ..

    Polymerase Chain Reaction:

    Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
    Article Snippet: The PCR product was cloned into vector pTA2 (Toyobo, Osaka, Japan), and the construct was confirmed using sequencing (pYS1). .. Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2. ..



    Similar Products

    96
    Addgene inc caption a7 vector
    Caption A7 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+vector/pcDNA3%2E1(%2B)+Laccase2+MCS+Exon+Vector+(Plasmid+%2369893)/pmc07511192-131-18-27
    Average 96 stars, based on 1 article reviews
    caption a7 vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Thermo Fisher caption a7 plasmid description references pmetαb vector
    Caption A7 Plasmid Description References Pmetαb Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+vector/pmc07058725-211-18-29
    Average 86 stars, based on 1 article reviews
    caption a7 plasmid description references pmetαb vector - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    91
    Addgene inc caption a7 construct vector resistance reference addgene id gst pglfδ1
    Plasmids used in this manuscript.
    Caption A7 Construct Vector Resistance Reference Addgene Id Gst Pglfδ1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+vector/GST-PglF130+(Plasmid+%2389708)/pmc06710627-86-32-38
    Average 91 stars, based on 1 article reviews
    caption a7 construct vector resistance reference addgene id gst pglfδ1 - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    88
    Addgene inc caption a7 caption a8 3 slot grids apex2 csgbp vector
    Plasmids used in this manuscript.
    Caption A7 Caption A8 3 Slot Grids Apex2 Csgbp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+vector/APEX2-csGBP+(Plasmid+%23108874)/pmc08342056-20-50-59
    Average 88 stars, based on 1 article reviews
    caption a7 caption a8 3 slot grids apex2 csgbp vector - by Bioz Stars, 2026-09
    88/100 stars
      Buy from Supplier

    Image Search Results


    Plasmids used in this manuscript.

    Journal: Methods in enzymology

    Article Title: Chemoenzymatic Synthesis and Applications of Prokaryote-Specific UDP-Sugars

    doi: 10.1016/bs.mie.2017.06.003

    Figure Lengend Snippet: Plasmids used in this manuscript.

    Article Snippet: Transform plasmid into freshly-competent BL21 (DE3) RIL cells, growing transformants on LB-agar selection media containing corresponding vector selection antibiotic (see ) and 30 μg/mL CAM. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Construct Vector Resistance Reference Addgene ID GST-PglFΔ1–130 ( Cj ) pGEX4T-2 Carb, 50 μg/mL Olivier et al., 2006 89708 His 8 -TEV-PglC ( Ng ) modified pET30b(+) Kan, 30 μμg/mL Hartley et al., 2011 89709 T7-PglD-His 6 ( Cj ) pET24a(+) Kan, 30 μg/mL Morrison et al., 2010 89710 PseB-His 6 ( Cj ) pET-24a(+) Kan, 30 μg/mL this report 89723 His 8 -TEV-PseC ( Cj ) modified pET30b(+) Kan, 30 μg/mL Hartley et al., 2011 89724 His 8 -TEV-PseH ( Cj ) modified pET30b(+) Kan, 30 μg/mL Hartley et al., 2011 89725 T7-WbpB-His 6 ( Pa ) pET-24a(+) Kan, 30 μg/mL Larkin et al., 2009 89711 T7-WbpE-His 6 ( Pa ) pET-24a(+) Kan, 30 μg/mL Larkin et al., 2009 89712 T7-WbpD-His 6 ( Pa ) pET-24a(+) Kan, 30 μg/mL Larkin et al., 2009 89713 T7-AglK-His 6 ( Mv ) pET-24a(+) Kan, 30 μg/mL Larkin et al., 2013 89714 T7-AglC-His 6 ( Mv ) pET-24a(+) Kan, 30 μg/mL Larkin et al., 2013 89726 Open in a separate window Plasmids used in this manuscript.

    Techniques: Plasmid Preparation, Modification