Review



caption a7 strain plasmid relevant genotype  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC caption a7 strain plasmid relevant genotype
    Caption A7 Strain Plasmid Relevant Genotype, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 20065 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+strain/Plasmid/pmc09197939-226-43-62
    Average 99 stars, based on 20065 article reviews
    caption a7 strain plasmid relevant genotype - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: Roles of OmpX, an Outer Membrane Protein, on Virulence and Flagellar Expression in Uropathogenic Escherichia coli
    Article Snippet: .. HTB-44 kidney epithelial cells were cultured as previously described ( 36 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype/phenotype Reference Strains CFT073 Parent strain (ATCC 700928) ATCC 700928 CFT073ΔompX ompX mutant of CFT073 This work CFT073ΔfliC fliC mutant of CFT073 11 CFT073ΔfliCΔompX fliC and ompX double mutant of CFT073 This work Plasmids pKO3 Temperature-sensitive vector for gene targeting, sacB , Cm r 37 pTrc99K Vector for IPTG-inducible expression; Km r 38 pTrc99KompX ompX expression plasmid; Km r This work pTrc99A Vector for IPTG-inducible expression; Ap r 38 pTrc99AompX ompX expression plasmid; Ap r This work pTrc99AfliC fliC expression plasmid; Ap r This work pTH18kr Low-copy-no. plasmid; Km r 39 pTH18krfliC-VSVG C-terminally VSVG-tagged FliC expression plasmid; Km r This work pTH18krompX ompX expression plasmid; Km r This work pNN387 Single-copy plasmid with promoterless lacZ ; Cm r 40 pNNflhD-P flhD promoter reporter; Cm r This work pNNfliA-P fliA promoter reporter; Cm r This work pNNfliC-P fliC promoter reporter; Cm r This work pTurboGFP-B GFP expression plasmid; Ap r Evrogen Open in a separate window a Cm r , chloramphenicol resistance; Km r , kanamycin resistance; Ap r , ampicillin resistance. ..

    Plasmid Preparation:

    Article Title: Roles of OmpX, an Outer Membrane Protein, on Virulence and Flagellar Expression in Uropathogenic Escherichia coli
    Article Snippet: .. HTB-44 kidney epithelial cells were cultured as previously described ( 36 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype/phenotype Reference Strains CFT073 Parent strain (ATCC 700928) ATCC 700928 CFT073ΔompX ompX mutant of CFT073 This work CFT073ΔfliC fliC mutant of CFT073 11 CFT073ΔfliCΔompX fliC and ompX double mutant of CFT073 This work Plasmids pKO3 Temperature-sensitive vector for gene targeting, sacB , Cm r 37 pTrc99K Vector for IPTG-inducible expression; Km r 38 pTrc99KompX ompX expression plasmid; Km r This work pTrc99A Vector for IPTG-inducible expression; Ap r 38 pTrc99AompX ompX expression plasmid; Ap r This work pTrc99AfliC fliC expression plasmid; Ap r This work pTH18kr Low-copy-no. plasmid; Km r 39 pTH18krfliC-VSVG C-terminally VSVG-tagged FliC expression plasmid; Km r This work pTH18krompX ompX expression plasmid; Km r This work pNN387 Single-copy plasmid with promoterless lacZ ; Cm r 40 pNNflhD-P flhD promoter reporter; Cm r This work pNNfliA-P fliA promoter reporter; Cm r This work pNNfliC-P fliC promoter reporter; Cm r This work pTurboGFP-B GFP expression plasmid; Ap r Evrogen Open in a separate window a Cm r , chloramphenicol resistance; Km r , kanamycin resistance; Ap r , ampicillin resistance. ..

    Article Title: A Riboflavin Transporter in Bdellovibrio exovorous JSS
    Article Snippet: .. Bacterial strains, plasmids, media and culture conditions Bacterial strains and plasmids used in this study are listed in . table ft1 table-wrap mode="anchored" t5 Table 1- caption a7 Strain or Plasmid Relevant characteristics Source Bdellovibrio exovorous JSS Wild type ATCC BAA-2330 Caulobacter crescentus CB15N Wild type SDSU, Dr. Shapiro Escherichia coli BW25113 Wild type In house E. coli BSV13 Δ ribC CGSC Plasmid PKD13 Amp + Kan + Temp - In house Plasmid PCP20 Amp + Kan + Temp - In house Open in a separate window Strains and plasmids used in this study. .. Initial studies on the growth of B. exovorous strain JSS (ATCC BAA-2330) were conducted in co-cultures in 1/10-strength yeast extract-peptone medium supplemented with calcium [ Gordon et al., 1993 ].

    Article Title: A Riboflavin Transporter in Bdellovibrio exovorous JSS
    Article Snippet: .. Bacterial strains and plasmids used in this study are listed in . table ft1 table-wrap mode="anchored" t5 Table 1- caption a7 Strain or Plasmid Relevant characteristics Source Bdellovibrio exovorous JSS Wild type ATCC BAA-2330 Caulobacter crescentus CB15N Wild type SDSU, Dr. Shapiro Escherichia coli BW25113 Wild type In house E. coli BSV13 Δ ribC CGSC Plasmid PKD13 Amp + Kan + Temp - In house Plasmid PCP20 Amp + Kan + Temp - In house Open in a separate window Strains and plasmids used in this study. .. Initial studies on the growth of B. exovorous strain JSS (ATCC BAA-2330) were conducted in co-cultures in 1/10-strength yeast extract-peptone medium supplemented with calcium [ Gordon et al., 1993 ].

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study Screen for spontaneous desiccation-sensitive mutants and genomic analysis. ..

    Mutagenesis:

    Article Title: Roles of OmpX, an Outer Membrane Protein, on Virulence and Flagellar Expression in Uropathogenic Escherichia coli
    Article Snippet: .. HTB-44 kidney epithelial cells were cultured as previously described ( 36 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype/phenotype Reference Strains CFT073 Parent strain (ATCC 700928) ATCC 700928 CFT073ΔompX ompX mutant of CFT073 This work CFT073ΔfliC fliC mutant of CFT073 11 CFT073ΔfliCΔompX fliC and ompX double mutant of CFT073 This work Plasmids pKO3 Temperature-sensitive vector for gene targeting, sacB , Cm r 37 pTrc99K Vector for IPTG-inducible expression; Km r 38 pTrc99KompX ompX expression plasmid; Km r This work pTrc99A Vector for IPTG-inducible expression; Ap r 38 pTrc99AompX ompX expression plasmid; Ap r This work pTrc99AfliC fliC expression plasmid; Ap r This work pTH18kr Low-copy-no. plasmid; Km r 39 pTH18krfliC-VSVG C-terminally VSVG-tagged FliC expression plasmid; Km r This work pTH18krompX ompX expression plasmid; Km r This work pNN387 Single-copy plasmid with promoterless lacZ ; Cm r 40 pNNflhD-P flhD promoter reporter; Cm r This work pNNfliA-P fliA promoter reporter; Cm r This work pNNfliC-P fliC promoter reporter; Cm r This work pTurboGFP-B GFP expression plasmid; Ap r Evrogen Open in a separate window a Cm r , chloramphenicol resistance; Km r , kanamycin resistance; Ap r , ampicillin resistance. ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study Screen for spontaneous desiccation-sensitive mutants and genomic analysis. ..

    Expressing:

    Article Title: Roles of OmpX, an Outer Membrane Protein, on Virulence and Flagellar Expression in Uropathogenic Escherichia coli
    Article Snippet: .. HTB-44 kidney epithelial cells were cultured as previously described ( 36 ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or plasmid Relevant genotype/phenotype Reference Strains CFT073 Parent strain (ATCC 700928) ATCC 700928 CFT073ΔompX ompX mutant of CFT073 This work CFT073ΔfliC fliC mutant of CFT073 11 CFT073ΔfliCΔompX fliC and ompX double mutant of CFT073 This work Plasmids pKO3 Temperature-sensitive vector for gene targeting, sacB , Cm r 37 pTrc99K Vector for IPTG-inducible expression; Km r 38 pTrc99KompX ompX expression plasmid; Km r This work pTrc99A Vector for IPTG-inducible expression; Ap r 38 pTrc99AompX ompX expression plasmid; Ap r This work pTrc99AfliC fliC expression plasmid; Ap r This work pTH18kr Low-copy-no. plasmid; Km r 39 pTH18krfliC-VSVG C-terminally VSVG-tagged FliC expression plasmid; Km r This work pTH18krompX ompX expression plasmid; Km r This work pNN387 Single-copy plasmid with promoterless lacZ ; Cm r 40 pNNflhD-P flhD promoter reporter; Cm r This work pNNfliA-P fliA promoter reporter; Cm r This work pNNfliC-P fliC promoter reporter; Cm r This work pTurboGFP-B GFP expression plasmid; Ap r Evrogen Open in a separate window a Cm r , chloramphenicol resistance; Km r , kanamycin resistance; Ap r , ampicillin resistance. ..

    other:

    Article Title: Analyzing Possible Native Functions of the Quinolone Resistance Gene qnr in Vibrio vulnificus
    Article Snippet: MICs for all the tested agents were the same at 37°C and 15°C except for bile salts, which were lower at 15°C ( ). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or genotype MIC (μg/ml) Bile salts (%) at 37°C/15°C H 2 O 2 (mM) Ciprofloxacin Levofloxacin Novobiocin Coumermycin A1 Mitomycin C 4-Nitroquinoline- N -oxide 5-Azacytidine V. vulnificus ATCC 27562 0.031 0.063 1 0.5 0.25 2 >512 0.63/0.25 1 Δ qnrVv 0.004 0.016 1 0.5 0.063 2 >512 0.63/0.13 1 Δ cspA 0.031 0.063 2 1 0.25 2 >512 0.63/0.25 1 Δ qnrVv Δ cspA 0.004 0.016 2 1 0.031 2 >512 0.63/0.13 1 V. vulnificus ATCC 27562/pQE60 0.063 0.063 1 1 0.125 2 >512 0.63/0.25 1 V. vulnificus ATCC 27562/pET-Duet-1 0.063 0.063 0.5 1 0.125 2 >512 0.63/0.25 1 Δ qnrVv /pQE60- qnrVv 0.063 0.063 0.5 0.5 0.125 2 >512 1.25/0.13 1 Δ cspA /pQE60- cspA 0.063 0.063 1 1 0.125 2 >512 1.25/0.25 1 Δ qnrVv Δ cspA /pET-Duet-1- qnrVv - cspA 0.063 0.063 1 1 0.125 2 >512 1.25/0.13 1 Δ qnrVv /pQE60 0.008 0.016 1 1 0.063 2 >512 0.63/0.25 1 Δ cspA /pQE60 0.063 0.063 1 2 0.25 2 >512 0.63/0.25 1 Δ qnrVv Δ cspA /pET-Duet-1 0.008 0.016 1 2 0.063 2 >512 0.63/0.25 1 Open in a separate window MIC values for the different Vibrio vulnificus ATCC 27562 strains

    Selection:

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study Screen for spontaneous desiccation-sensitive mutants and genomic analysis. ..

    Derivative Assay:

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study Screen for spontaneous desiccation-sensitive mutants and genomic analysis. ..

    Sequencing:

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study Screen for spontaneous desiccation-sensitive mutants and genomic analysis. ..

    Clone Assay:

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study ..

    Article Title: CsrA Supports both Environmental Persistence and Host-Associated Growth of Acinetobacter baumannii
    Article Snippet: .. Antibiotics used for selection were purchased from Research Products International and were used to supplement media at the concentrations indicated in the text. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Strain or plasmid Description Reference or source Strains ATCC 17961 Clinical isolate from blood ATCC AB09-003 Military isolate from cerebrospinal fluid 11 ATCC 17978 Clinical isolate from spinal meningitis ATCC AB5075 Military isolate from osteomyelitis 58 AB003-04D4 Laboratory-adapted isolate derived from AB09-003 This study AB003-14F2 Laboratory-adapted isolate derived from AB09-003 This study AB003-01C11 Laboratory-adapted isolate derived from AB09-003 This study AB003-02F8 Laboratory-adapted isolate derived from AB09-003 This study AB003-02H10 Laboratory-adapted isolate derived from AB09-003 This study 17961-Δ14.5kb Mutant derived from strain ATCC 17961 with approx 14.5 kb of sequence downstream from csrA deleted This study 17961-Δ csrA csrA deletion mutant derived from strain ATCC 17961 This study 17961-Δ csrA comp 17961-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study AB09-003-Δ csrA csrA deletion mutant derived from strain AB09-003 This study AB09-003-Δ csrA comp AB09-003-Δ csrA with an intact copy of csrA integrated at the att Tn7 site This study Plasmids pEX18Ap Suicide vector 80 pEX18Gm Suicide vector This study pΔ14.5-dsr961 Suicide plasmid carrying approx 14.5-kb deletion This study pEX18Ap-csrA-FL pEX18Ap carrying full-length csrA This study pΔcsrA-suc Suicide plasmid carrying csrA deletion This study pΔcsrA-sucGm Suicide plasmid carrying csrA deletion This study pWH1266 Escherichia coli - A. baumannii shuttle plasmid 45 pJF-csrA csrA cloned into pWH1266 This study pUC18T-mini-Tn7T-Gm Vector for integration of DNA fragments at chromosomal att Tn7 site 44 pJF-Tn7T-csrA csrA cloned into pUC18T-mini-Tn7T-Gm This study pTNS2 Helper plasmid 44 pFLP2A Plasmid encoding Flp recombinase 78 Open in a separate window A. baumannii strains and plasmids used in this study Screen for spontaneous desiccation-sensitive mutants and genomic analysis. ..



    Similar Products

    99
    ATCC caption a7 strain plasmid relevant genotype
    Caption A7 Strain Plasmid Relevant Genotype, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+strain/Plasmid/pmc09197939-226-43-62
    Average 99 stars, based on 1 article reviews
    caption a7 strain plasmid relevant genotype - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    ATCC caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca
    Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.
    Caption A7 S Mutans Strains Relevant Characteristics Source Ua159 Wild Type Atcc δ Adca Adca, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+strain/A7/pmc09178666-207-25-35
    Average 96 stars, based on 1 article reviews
    caption a7 s mutans strains relevant characteristics source ua159 wild type atcc δ adca adca - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    92
    ATCC t5 caption a7 strains mic mg l mic combination fici van lnz fos lnz fos lnz fos no
    Summary of <t> MIC </t> and <t> FICI </t> values of the 8 enterococci strains
    T5 Caption A7 Strains Mic Mg L Mic Combination Fici Van Lnz Fos Lnz Fos Lnz Fos No, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+strain/Arthrobacter+ilicis+(Mandel+et+al%2E)+Collins+et+al/pmc08904999-198-49-107
    Average 92 stars, based on 1 article reviews
    t5 caption a7 strains mic mg l mic combination fici van lnz fos lnz fos lnz fos no - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    91
    ATCC caption a7 bacterial strain mic
    Summary of <t> MIC </t> and <t> FICI </t> values of the 8 enterococci strains
    Caption A7 Bacterial Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+strain/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pmc08739753-351-30-95
    Average 91 stars, based on 1 article reviews
    caption a7 bacterial strain mic - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    97
    ATCC caption a7 strain azm
    Summary of <t> MIC </t> and <t> FICI </t> values of the 8 enterococci strains
    Caption A7 Strain Azm, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/caption+a7+strain/A20/pmc08317130-451-30-77
    Average 97 stars, based on 1 article reviews
    caption a7 strain azm - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results


    Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Alignment of AdcA of S. mutans with AdcA and AdcAII proteins of S. agalactiae. Dark and light grey shades represent identical and similar residues, respectively. Orange shaded residues are the N-terminal histidine rich metal-binding motif, yellow boxed residues depict the C-terminal ZinT domain while the glutamic acid and additional histidine residues that aid in metal recruitment are indicated in blue shades.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Binding Assay

    AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: AdcABC mediates the growth of S. mutans under zinc-depleted conditions. Growth curves of UA159, ΔadcA, ΔadcCB or ΔadcCBcomp in (A) FMC, (B) FMC supplemented with 5 μM ZnSO4, (C) BHI, (D) CP/BHI medium containing 200 μg ml−1 of human calprotectin, and (E) BHI containing 10 μM TPEN. Curves shown represent average and standard deviation of at least five independent biological replicates.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Standard Deviation

    ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: ICP-MS quantifications of intracellular zinc and manganese in the UA159, ΔadcA, ΔadcCB or ΔadcCBcomp strains. The bar graphs indicate zinc or manganese levels in cells grown in BHI (A and C) or BHI containing 6 μM TPEN (B and D). Data represent averages and standard deviations of three independent biological replicates. One-way ANOVA was used to compare the metal content of mutants and UA159 (*) and between ΔadcCB and ΔadcCBcomp (#). A p value <0.05 was considered significant.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques:

    The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: The ΔadcCB mutant strain is hypersensitive to manganese. Mid-log grown cultures of UA159, ΔadcCB or ΔadcCBcomp were serially diluted and spotted on BHI agar containing different concentrations of manganese or zinc as indicated in the figure labels.

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Mutagenesis

    Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Colonization of S. mutans UA159 or ΔadcCB on the teeth of rats. (A) Total S. mutans colonies recovered from rat jaws by plating on MS agar, and (B) percentage of S. mutans colonies among total recovered flora plated on blood agar plates. The limit of detection for CFU is 102. (*) Indicates statistical significance (p = 0.0003 (A) and 0.0002 (B) by Mann-Whitney test).

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: MANN-WHITNEY

    Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Expression of virulence-related attributes in the UA159, ΔadcA and ΔadcCB strains. (A) Growth in in the presence of a sub-inhibitory concentration of H2O2 (0.75 mM) in FMC supplemented with 5 μM (A) or 20 μM ZnSO4 (B). Curves shown represent average and standard deviation of at least five independent biological replicates. (C) 24-h biofilms formed on the surface of saliva-coated microtiter plate wells from cells grown in FMC supplemented with 1% sucrose in presence of varying amount of Zn. (*) Indicates statistical significance when compared to UA159 strain (p < 0.05, one-way ANOVA).

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques: Expressing, Concentration Assay, Standard Deviation

    Bacterial strains and primers used in the study

    Journal: Molecular oral microbiology

    Article Title: Zinc Import Mediated by AdcABC is Critical for Colonization of the Dental Biofilm by Streptococcus mutans in an Animal Model

    doi: 10.1111/omi.12337

    Figure Lengend Snippet: Bacterial strains and primers used in the study

    Article Snippet: Plates were incubated for 24 hours at 37°C in a 5% CO 2 incubator before they were photographed. table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 S. mutans strains Relevant characteristics Source UA159 Wild-type ATCC Δ adcA adcA ::Kan This study Δ adcCB adcCB ::Kan This study Δ adcCB comp adcCB ::Kan, adcCB + in pBGE This study Δ smu2069 smu2069 ::Spec This study Δ adcCB Δ smu2069 adcCB ::Kan; smu2069 ::Spec This study Primers Sequence a Application adcAdel5arm1 GCA AGA TTA CGG TAG AAG ACA adcA deletion adcAdelarm1BamHI TGA CTA ACA GAA G GG ATC C CG ATA ATA AA adcA deletion adcAdelarm2 BamHI CCA GCT AA G GAT CC A GGC CGA adcA deletion adcAdel3arm2 CCC CAA AAC CCT TCA TCC adcA deletion adcCBdel5arm1 ACA AGA ATA GCG ACT GGA AA adcCB deletion adcCBdelarm1BamHI GGA TTG ATG G GG ATC C TG GTG AAA adcCB deletion adcCBdelarm2 BamHI GAT AAG ACC G GG ATC C AA CAG TAA TG adcCB deletion adcCBdel3arm2 CCC ATG TCA TTA CTG TCC C adcCB deletion adcCBcompXbaI5’ GC TCTAGA CTTTGAAATCTTACCTTATCGTTGC Δ adcCB comp. adcCBcompBsrG3’ CGC TGTACA CTGTCTTTTCCCCAGCCTC Δ adcCB comp. smu2069del5arm1 GGTTCTCCCTTACGGTCACGC smu2069 deletion smu2069delarm1SphI CCAGCAA GCATGC GAGCAGTAAGTATAAAGGCA smu2069 deletion smu2069delarm2SphI GGAGTT GCATGC ATTTCTGGTATGCTTATCATGGCTG smu2069 deletion smu2069del3arm2 GCTGCAATTCCGAGGTTCTTCC smu2069 deletion Open in a separate window a Restriction sites are underlined.

    Techniques:

    Summary of  MIC  and  FICI  values of the 8 enterococci strains

    Journal: Annals of Translational Medicine

    Article Title: Factorial design and post-antibiotic sub-MIC effects of linezolid combined with fosfomycin against vancomycin-resistant enterococci

    doi: 10.21037/atm-21-4595

    Figure Lengend Snippet: Summary of MIC and FICI values of the 8 enterococci strains

    Article Snippet: The FICI values illustrated that linezolid combined with fosfomycin had a synergistic or an additive effect on the 6 strains, had an indifferent effect on the No. 1 and ATCC29212 strains, and did not have an antagonistic effect on any of the strains (see ). table ft1 table-wrap mode="anchored" t5 caption a7 Strains MIC (mg/L) MIC combination FICI VAN LNZ FOS LNZ/FOS LNZ + FOS No. 1 4 2 64 0.03125/64 1.015 No. 2 4 2 128 0.5/32 0.5 No. 3 2 2 128 1/32 0.75 No. 4 2 4 256 0.5/128 0.625 No. 5 1 4 128 1/32 0.5 No. 8 128 2 128 1/32 0.75 ATCC 29212 1 2 128 1/64 1 ATCC 51299 256 2 128 0.5/32 0.5 Open in a separate window VAN: ≤4 mg/L, susceptible (S); 8–16 mg/L, intermediate (I); ≥32 mg/L, resistant (R).

    Techniques: