t pertm lysis buffer (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
95
Structured Review
Thermo Fisher
t pertm lysis buffer
T Pertm Lysis Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/buffer+t/Triton%26mid%3Br+X-100+lysis+buffer%2C+pH+7%2E4/us12649830-904-13-16
Average 95 stars, based on 1 article reviews
T Pertm Lysis Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/buffer+t/Triton%26mid%3Br+X-100+lysis+buffer%2C+pH+7%2E4/us12649830-904-13-16
Average 95 stars, based on 1 article reviews
t pertm lysis buffer - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Electroporation:Article Title: LCL161 enhances expansion and survival of engineered anti-tumor T cells but is restricted by death signaling. Article Snippet: .. 5x105 T cells per electroporation were resuspended in Article Title: DICER1 syndrome mutations lead to a gain of 3p-miRNA function, HERVH activity and increased metastatic potential Article Snippet: Repair template-D1709N (5’CTTCGGATCCCCTCAGATTGTTACCAGCGCTTAGAATTTCTGGGAAATGCAAT ATTGGACTACCTCATAACCAAGCACCTTTATGAAGACCCGCGGCAGCACTCCCCG GGGGTCCTGACAGACCTGCGGTCTGCCCTGG-3’) Equimolar amount of either crRNA-S1344 or crRNA-D1709 (245pmol, IDT) where incubated with tracrRNA (245 pmol, IDT) in 25ul nuclease-free buffer at 95°C for 5 mins and annealed by allowing to cool to room temperature (RT). .. Cas9 Nuclease V3 (IDT) in 22.5 μl Transfection:Article Title: DICER1 syndrome mutations lead to a gain of 3p-miRNA function, HERVH activity and increased metastatic potential Article Snippet: Repair template-D1709N (5’CTTCGGATCCCCTCAGATTGTTACCAGCGCTTAGAATTTCTGGGAAATGCAAT ATTGGACTACCTCATAACCAAGCACCTTTATGAAGACCCGCGGCAGCACTCCCCG GGGGTCCTGACAGACCTGCGGTCTGCCCTGG-3’) Equimolar amount of either crRNA-S1344 or crRNA-D1709 (245pmol, IDT) where incubated with tracrRNA (245 pmol, IDT) in 25ul nuclease-free buffer at 95°C for 5 mins and annealed by allowing to cool to room temperature (RT). .. Cas9 Nuclease V3 (IDT) in 22.5 μl other:Article Title: LCL161 enhances expansion and survival of engineered anti-tumor T cells but is restricted by death signaling Article Snippet: To generate RNP, a triple sgRNA pool (Synthego, Redwood City, CA, USA) or negative control gRNA (IDT, Newark, NJ, USA) was complexed with 20 pmol Alt-R HiFi Cas9 V3 (IDT) at a 3:1 sgRNA , Cas9 molar ratio for 10-15 min at room temperature. Incubation:Article Title: The genomic basis of childhood T-lineage acute lymphoblastic leukemia Article Snippet: .. A mixture consisting of 3 μl of Cas9 protein (20 μM) and sgRNAs (60 μM) was incubated for 15 minutes at room temperature and subsequently combined with Page 22/35 LOUCY cells at a concentration of 1 x 105 cells/ml in Concentration Assay:Article Title: The genomic basis of childhood T-lineage acute lymphoblastic leukemia Article Snippet: .. A mixture consisting of 3 μl of Cas9 protein (20 μM) and sgRNAs (60 μM) was incubated for 15 minutes at room temperature and subsequently combined with Page 22/35 LOUCY cells at a concentration of 1 x 105 cells/ml in |