anti cd28 (Bio X Cell)
Structured Review
![( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 <t>and</t> <t>anti-CD28</t> (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.](https://pub-med-central-images-cdn.bioz.com/pub_med_central_ids_ending_with_1753/pmc13041753/pmc13041753__sciadv.aea4262-f1.jpg)
Anti Cd28, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 502 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/be0291/InVivoMAb+anti-human+monkey+CD28/pmc13041753-252-27-28
Average 96 stars, based on 502 article reviews
Images
1) Product Images from "Inflammatory arthritis irAE may represent a unique autoimmune disease primarily driven by T cells but likely not autoantibodies"
Article Title: Inflammatory arthritis irAE may represent a unique autoimmune disease primarily driven by T cells but likely not autoantibodies
Journal: Science Advances
doi: 10.1126/sciadv.aea4262
Figure Legend Snippet: ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 and anti-CD28 (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.
Techniques Used: Control, Expressing, Phospho-proteomics, Fluorescence, Clone Assay
Figure Legend Snippet: ( A to G ) PBMCs from the patients with irAE were cultured in the plate coated with anti-CD3 and anti-CD28 (10 μg/ml) in the presence of IgG1 isotype control or anti–human IL-6R (50 μg/ml), anti–human IL-12p40 (50 μg/ml), and anti–human IFNAR1 (50 μg/ml) for 3 days; n = 9. (A) Expression of CD38 and CD127 on CD8 + T cells. Right: Percentage of CD38 + CD127 − CD8 + T cells. (B and C) CD8 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (B) Expression of granzyme B and IFN-γ. Right: Percentage of granzyme B + IFN-γ + CD8 + T cells. (C) Expression of perforin and IFN-γ. Right: Percentage of perforin + IFN-γ + CD8 + T cells. [(D) and (E)] MFIs of GluCy5 (D), TMRM, and MTDR (E) in CD8 + T cells were presented. [(F) and (G)] CD4 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (F) Expression of IL-21 and IL-2. Right: Percentage of IL-21 + IL-2 + CD4 + T cells. (G) Expression of CD38 and CXCR5 on CD4 + T cells. Right: Percentage of CD38 + CXCR5 − CD4 + T cells. Data in graphs represent mean ± SEM. Significance was tested paired Student’s t test [(A) to (G)].
Techniques Used: Cell Culture, Control, Expressing
Related Articles
other:Article Title: PD-L1:CD80 Cis-Heterodimer Triggers the Co-stimulatory Receptor CD28 While Repressing the Inhibitory PD-1 and CTLA-4 Pathways. Article Snippet: REAGENT or Recombinant:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: FACS:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: Membrane:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: Clinical Proteomics:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: Staining:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: Labeling:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: Isolation:Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: |

