Review



anti cd28  (Bio X Cell)


Bioz Verified Symbol Bio X Cell is a verified supplier
Bioz Manufacturer Symbol Bio X Cell manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Bio X Cell anti cd28
    ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 <t>and</t> <t>anti-CD28</t> (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.
    Anti Cd28, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 502 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/be0291/InVivoMAb+anti-human+monkey+CD28/pmc13041753-252-27-28
    Average 96 stars, based on 502 article reviews
    anti cd28 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "Inflammatory arthritis irAE may represent a unique autoimmune disease primarily driven by T cells but likely not autoantibodies"

    Article Title: Inflammatory arthritis irAE may represent a unique autoimmune disease primarily driven by T cells but likely not autoantibodies

    Journal: Science Advances

    doi: 10.1126/sciadv.aea4262

    ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 and anti-CD28 (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.
    Figure Legend Snippet: ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 and anti-CD28 (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.

    Techniques Used: Control, Expressing, Phospho-proteomics, Fluorescence, Clone Assay

    ( A to G ) PBMCs from the patients with irAE were cultured in the plate coated with anti-CD3 and anti-CD28 (10 μg/ml) in the presence of IgG1 isotype control or anti–human IL-6R (50 μg/ml), anti–human IL-12p40 (50 μg/ml), and anti–human IFNAR1 (50 μg/ml) for 3 days; n = 9. (A) Expression of CD38 and CD127 on CD8 + T cells. Right: Percentage of CD38 + CD127 − CD8 + T cells. (B and C) CD8 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (B) Expression of granzyme B and IFN-γ. Right: Percentage of granzyme B + IFN-γ + CD8 + T cells. (C) Expression of perforin and IFN-γ. Right: Percentage of perforin + IFN-γ + CD8 + T cells. [(D) and (E)] MFIs of GluCy5 (D), TMRM, and MTDR (E) in CD8 + T cells were presented. [(F) and (G)] CD4 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (F) Expression of IL-21 and IL-2. Right: Percentage of IL-21 + IL-2 + CD4 + T cells. (G) Expression of CD38 and CXCR5 on CD4 + T cells. Right: Percentage of CD38 + CXCR5 − CD4 + T cells. Data in graphs represent mean ± SEM. Significance was tested paired Student’s t test [(A) to (G)].
    Figure Legend Snippet: ( A to G ) PBMCs from the patients with irAE were cultured in the plate coated with anti-CD3 and anti-CD28 (10 μg/ml) in the presence of IgG1 isotype control or anti–human IL-6R (50 μg/ml), anti–human IL-12p40 (50 μg/ml), and anti–human IFNAR1 (50 μg/ml) for 3 days; n = 9. (A) Expression of CD38 and CD127 on CD8 + T cells. Right: Percentage of CD38 + CD127 − CD8 + T cells. (B and C) CD8 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (B) Expression of granzyme B and IFN-γ. Right: Percentage of granzyme B + IFN-γ + CD8 + T cells. (C) Expression of perforin and IFN-γ. Right: Percentage of perforin + IFN-γ + CD8 + T cells. [(D) and (E)] MFIs of GluCy5 (D), TMRM, and MTDR (E) in CD8 + T cells were presented. [(F) and (G)] CD4 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (F) Expression of IL-21 and IL-2. Right: Percentage of IL-21 + IL-2 + CD4 + T cells. (G) Expression of CD38 and CXCR5 on CD4 + T cells. Right: Percentage of CD38 + CXCR5 − CD4 + T cells. Data in graphs represent mean ± SEM. Significance was tested paired Student’s t test [(A) to (G)].

    Techniques Used: Cell Culture, Control, Expressing

    Related Articles

    other:

    Article Title: PD-L1:CD80 Cis-Heterodimer Triggers the Co-stimulatory Receptor CD28 While Repressing the Inhibitory PD-1 and CTLA-4 Pathways.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Human CD28 antibody Bio X Cell Cat # BE0291; RRID: AB_2687814 GFP-Trap Chromotek Cat # gta-20 RRID: AB_2631357 PI3 Kinase p85 antibody Cell Signaling Technology Cat # 4292; RRID: AB_329869 Phosphotyrosine antibody Sigma-Aldrich Cat # P4110; RRID: AB_477342 Human SHP2 antibody A. Veillette, Montreal Clinical Research Institute N.A.

    Recombinant:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH

    FACS:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH

    Membrane:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH

    Clinical Proteomics:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH

    Staining:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH

    Labeling:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH

    Isolation:

    Article Title: Deep-learning-based three-dimensional label-free tracking and analysis of immunological synapses of CAR-T cells
    Article Snippet: Cell line (Homo sapiens) Lenti-X 293T Takara Cat. #: 632180 Lentivirus production Recombinant DNA reagent pLV-DLNGFR-P2A-CD19-BBz CAR This paper Signal peptide: aa 1–28 hLNGFR (Uniprot TNR16_Human) Extracellular domain: aa 29–250 hLNGFR (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 hLNGFR (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL –G4S linker VH Hinge/Transmembrane domain aa 138–206 hCD8 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV- DLNGFR -P2A-CD19-28z CAR This paper Signal peptide: aa 1–28 (Uniprot TNR16_Human) Extracellular domain: aa 29–250 (Uniprot TNR16_Human) Transmembrane domain: aa 251–272 (Uniprot TNR16_Human) Cytosolic sequence: aa 273–275 (Uniprot TNR16_Human) DLNGFR was fused with P2A sequence (GGAAGCGGAGCTACTAACTTCAGCCTGC TGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCT) and followed by CAR sequence Signal peptide: aa 2–21 hCD8 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63); VL-G4S linker-VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 180–220 (Uniprot CD28_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) Recombinant DNA reagent pLV-CD19-BBz CAR-G4Smcherry This paper Signal peptide: aa 1–21 (Uniprot CD8A_Human) Extracellular domain: anti-CD19 scFv (Clone: FMC 63) VL –G4S linker VH Hinge/Transmembrane domain: aa 138–206 (Uniprot CD8A_Human) Co-stimulatory domain sequence: aa 214–255 (Uniprot TNR9_Human) Signaling domain: aa 52–164 (Uniprot CD3Z_Human) CAR and mcherry was fused with G4S linker mCherry: aa 2–236 (Uniprot X5DSL3_ANAMA) Recombinant DNA reagent pLV-hCD19-G4S-Zsgreen This paper Signal peptide: aa 1–19 (Uniprot CD19_Human) Extracellular domain: aa 20–291 (Uniprot CD19_Human) Cytoplasmic domain: aa314-556 (Uniprot CD19_Human) CD19 and Zsgreen was fused with G4S linker Zsgreen: aa 2–231 (Uniprot GFPL1_ZOASP) Recombinant DNA reagent pMDLg/pRRE other RRID:Addgene12251 3rd Lentivirus packaging vector Recombinant DNA reagent pRSV-Rev other RRID:Addgene12253 3rd Lentivirus packaging vector Recombinant DNA reagent pMD2.G other RRID:Addgene12259 Lentivirus envelop vector Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 16 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pMACS LNGFR Miltenyi Biotec Cat. #:130-091-890 Peptide, recombinant protein rhIL-2 BMI KOREA 300IU/mL Peptide, recombinant protein rhCD19-Fc ACRO Biosystems Cat. #: CD9-H5259 FACS Peptide, recombinant protein AF647-conjugated streptavidin Biolegend Cat. #: 405237 FACS Antibody InVivoMab anti-human CD3 Bio X cell Cat. #: BE0001-2-5MG OKT3 clone 4 mg/mL coated Antibody InVivoMab anti-human CD28 Bio X cell Cat. #: BE0291-5MG CD28.2 clone 2 mg/mL soluble Antibody hLNGFR-APC antibody Miltenyi Biotec Cat. #: 130-113-418 FACS Antibody hCD19-APC antibody Biolegend Cat. #: 302212 FACS Other DPBS Welgene Cat. #: LB001-02 Other Fetal Bovine Serum (FBS) Gibco Cat. #: 26140–079 Other DMEM Gibco Cat. #: 11965–118 Other RPMI Gibco Cat. #: 21870–092 Other HBSS with Ca2+ and Mg2+ Gibco Cat #: 14-025-092 Other HEPES Gibco Cat. #: 1530080 Other 2-Mercaptoethanol Sigma Cat. #: M6250-100mL Other Lipofectamine 2000 ThermoFisher Cat. #: 11668019 Other Glutamax Gibco Cat. #: 35050–061 Other Protamine Sulfate Sigma Cat. #: P3369 Other MEM Non-essential amino acid Gibco Cat. #: 111400500 Other Sodium pyruvate ThermoFisher Cat. #: 11360070 Other penicillin/streptomycin Gibco Cat. #: 15140–122 Other Tomodish Tomocube Other Paraformaldehyde Solution, 4% in PBS ThermoFisher Cat. #: AAJ19943K2 Fixation Other CellBrite Fix 640 Membrane Dye Biotium Cat. #: 30089 Plasma membrane staining Other VECTASHIELD Hardset w/ DAPI VECTOR Laboratory Cat. #: H-1400 Mounting Medium Other LysoTracker Deep Red ThermoFisher Cat #: L12492 Dye for labeling and tracking lytic granules Other TetraSpeck Microspheres,0.1 mm, fluorescent blue/green/ orange/dark red ThermoFisher Cat #: T7279 Fiducial markers Other FITC-dextran 10 kDa TdB Labs Cat #: 20682 Fluorescein-labeled dextran, 10 kDa Other FITC-dextran 2000 kDa TdB Labs Cat #: 20584 Fluorescein-labeled dextran, 2000 kDa Commercial assay or kit CD271 Microbeads kits, Human Miltenyi Biotec Cat. #: 130-099-023 Isolation of CAR+ T cells Commercial assay or kit SepMate PBMC Isolation tube STEMCELL 86460 PBMC Isolation Continued on next page Lee, Lee, Song, et al. eLife 2020;9:e49023. .. DOI: https://doi.org/10.7554/eLife.49023 17 of 26 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm Flowjo Flowjo Version 10 Software, algorithm Prism GraphPad Version 7 Software, algorithm ImageJ NIH



    Similar Products

    96
    Bio X Cell anti cd28
    ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 <t>and</t> <t>anti-CD28</t> (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.
    Anti Cd28, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/be0291/InVivoMAb+anti-human+monkey+CD28/pmc13041753-252-27-28
    Average 96 stars, based on 1 article reviews
    anti cd28 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio X Cell anti cd28 antibodies
    mRNA expression and RNA-seq analysis in pMIG and LXRβ OE CAR-T cells. (a) Comparison of LXRβ mRNA expression during CAR-T cell generation. LXRβ mRNA levels were analyzed in naïve T cells, T cells stimulated with <t>anti-CD3/CD28,</t> and untransduced or CAR-transduced T cells to assess the transcriptional changes associated with CAR transduction. Data were presented as the mean ± S.E.M. of n = 3 technical replicates. Statistical significance was calculated with one-way ANOVA followed by Tukey's multiple comparisons. * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001; and ns, not significant (not shown). (b–e) RNA-seq analysis comparing transcriptomic differences between pMIG and LXRβ OE CAR-T cells. (b) Principal component analysis (PCA) plot illustrating global transcriptomic differences between pMIG and LXRβ OE CAR-T cells. (c) Volcano plot illustrating differentially expressed mRNAs between pMIG and LXRβ OE CAR-T cells. A total of 169 genes were identified based on the criteria of |fold change| ≥ 2 and raw p -value < 0.05. The x-axis represents log₂ fold change, and the y-axis shows –log₁₀( p -value). Red and blue dots indicate significantly upregulated and downregulated genes in LXRβ OE CAR-T, respectively, while gray dots represent non-significant genes. (d) Heatmap of normalized RNA-seq reads (as z scores) showing the expression of genes involved in the inflammatory response, comparing pMIG and LXRβ OE CAR-T cells. (e) Heatmap of normalized RNA-seq reads (as z scores) illustrating the expression of genes associated with TNFα signaling via NF-κB, highlighting the transcriptional changes induced by LXRβ overexpression.
    Anti Cd28 Antibodies, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/be0291/InVivoMAb+anti-human+monkey+CD28/pmc12785237-137-15-17
    Average 96 stars, based on 1 article reviews
    anti cd28 antibodies - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Bio X Cell co stimulating anti cd28 mab
    Diluted whole blood samples from sepsis patients (n = 5–8) and healthy donors (n = 20) were stimulated ex vivo with defined immune agonists for 24–72 h, and cytokine levels were quantified in diluted plasma supernatants. Volcano plots display log 2 fold change versus −log 10 adjusted p values (FDR < 0.05). Statistical significance was assessed using multiple unpaired t -tests across individual cytokines. (A) Stimulation with the TLR2 ligand FSL-1 (100 ng/ml) for 24 h induced significantly attenuated cytokine production in sepsis samples compared with healthy controls, as visualized by a volcano plot and corresponding bar/dot plots. Reduced cytokine levels are shown in blue, while increased IP-10 is shown in red (n = 5). (B) Stimulation with the TLR4 ligand LPS (1 ng/ml) for 24 h resulted in significantly reduced production of IP-10 and IL-1β in sepsis samples compared with healthy controls (n = 5). (C) Stimulation with the TLR8 ligand TL8-506 (300 ng/ml) for 24 h demonstrated significantly reduced IP-10 and IL-12p70 production in sepsis samples (n = 5). (D) Stimulation of diluted whole blood with a T cell/MHC class II–dependent stimulus (Cytostim combined with <t>anti-CD28)</t> for 72 h revealed broadly attenuated cytokine responses in sepsis samples compared with healthy controls (n = 8).
    Co Stimulating Anti Cd28 Mab, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/be0291/InVivoMAb+anti-human+monkey+CD28/bio_rxiv__64898__2025__12__29__696918-68-32-36
    Average 96 stars, based on 1 article reviews
    co stimulating anti cd28 mab - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 and anti-CD28 (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.

    Journal: Science Advances

    Article Title: Inflammatory arthritis irAE may represent a unique autoimmune disease primarily driven by T cells but likely not autoantibodies

    doi: 10.1126/sciadv.aea4262

    Figure Lengend Snippet: ( A ) Circos plots showing the percentage of cells from HC (Healthy control, n = 6), ICI ( n = 2), RAC (RA control, n = 5), or irAE ( n = 5). ( B ) Expression of CD45RA and CCR7 on CD8 + T cells. Right: Summaries of the percentage of cells from HC ( n = 53), irAE ( n = 29), RAC ( n = 41), and ICI ( n = 26). ( C ) Expression of CXCR3 and CCR6 on CD8 + T cells. Right: Summaries of T cell subsets. HC ( n = 45), irAE ( n = 27), RAC ( n = 31), and ICI ( n = 26). ( D ) The cytotoxic score was evaluated using the gene list identified previously . ( E ) Specific genes were evaluated on CD8 + T cells. ( F ) Pathways that were significantly enriched in the CD8 + T cells between irAE and ICI. NF-κB, nuclear factor κB; STAT5, signal transducer and activator of transcription 5; DN, down. Gene set enrichment analysis (GSEA) plots of the allograft rejection ( G ), oxidative phosphorylation ( H ), IFN-α response ( I ), and IFN-γ response ( J ) between irAE and ICI. NES, normalized enrichment score ( K to M ) PBMCs were stimulated with plate-coated anti-CD3 and anti-CD28 (10 μg/ml) for 5 days. Mean fluorescence intensities (MFIs) of MitoTracker Green (MTG) (K), MitoTracker deep red (MTDR) (L) [HC ( n = 31), irAE ( n = 18), RAC ( n = 32), and ICI ( n = 16)] or Cy5-linked-1-amino-glucose (GluCy5) (M) [HC ( n = 35), irAE ( n = 20), RAC ( n = 36), and ICI ( n = 18)] in CD8 + T cells were presented. Expression was normalized to the HC in each experiment. ( N ) UMAP shows the presence or absence of T cell receptor (TCR) in the major immune cells across all the samples. ( O ) Pie charts showing the distribution of the top 100 TCR clones across different T cell subsets. Data in graphs represent mean ± SEM. Significance was tested by one-way analysis of variance (ANOVA). [(A) to (E) and (G) to (O)] ICI, ICI control.

    Article Snippet: A total of 0.5 million isolated CD4 + T cells or CD8 + T cells was stimulated with plate-coated anti-CD3 (10 μg/ml; BioXCell, catalog no. BE0001-2) and anti-CD28 (BioXCell, catalog no. BE0291), rhIL-6 (100 ng/ml), rhIFN-α 2 (100 ng/ml), rhIL-12 (100 ng/ml), or the combination of rhIL-6, rhIFN-α 2 , and rhIL-12 for 5 days.

    Techniques: Control, Expressing, Phospho-proteomics, Fluorescence, Clone Assay

    ( A to G ) PBMCs from the patients with irAE were cultured in the plate coated with anti-CD3 and anti-CD28 (10 μg/ml) in the presence of IgG1 isotype control or anti–human IL-6R (50 μg/ml), anti–human IL-12p40 (50 μg/ml), and anti–human IFNAR1 (50 μg/ml) for 3 days; n = 9. (A) Expression of CD38 and CD127 on CD8 + T cells. Right: Percentage of CD38 + CD127 − CD8 + T cells. (B and C) CD8 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (B) Expression of granzyme B and IFN-γ. Right: Percentage of granzyme B + IFN-γ + CD8 + T cells. (C) Expression of perforin and IFN-γ. Right: Percentage of perforin + IFN-γ + CD8 + T cells. [(D) and (E)] MFIs of GluCy5 (D), TMRM, and MTDR (E) in CD8 + T cells were presented. [(F) and (G)] CD4 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (F) Expression of IL-21 and IL-2. Right: Percentage of IL-21 + IL-2 + CD4 + T cells. (G) Expression of CD38 and CXCR5 on CD4 + T cells. Right: Percentage of CD38 + CXCR5 − CD4 + T cells. Data in graphs represent mean ± SEM. Significance was tested paired Student’s t test [(A) to (G)].

    Journal: Science Advances

    Article Title: Inflammatory arthritis irAE may represent a unique autoimmune disease primarily driven by T cells but likely not autoantibodies

    doi: 10.1126/sciadv.aea4262

    Figure Lengend Snippet: ( A to G ) PBMCs from the patients with irAE were cultured in the plate coated with anti-CD3 and anti-CD28 (10 μg/ml) in the presence of IgG1 isotype control or anti–human IL-6R (50 μg/ml), anti–human IL-12p40 (50 μg/ml), and anti–human IFNAR1 (50 μg/ml) for 3 days; n = 9. (A) Expression of CD38 and CD127 on CD8 + T cells. Right: Percentage of CD38 + CD127 − CD8 + T cells. (B and C) CD8 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (B) Expression of granzyme B and IFN-γ. Right: Percentage of granzyme B + IFN-γ + CD8 + T cells. (C) Expression of perforin and IFN-γ. Right: Percentage of perforin + IFN-γ + CD8 + T cells. [(D) and (E)] MFIs of GluCy5 (D), TMRM, and MTDR (E) in CD8 + T cells were presented. [(F) and (G)] CD4 + T cells activated for 5 days were restimulated with PMA, ionomycin, and monensin for 5 hours. (F) Expression of IL-21 and IL-2. Right: Percentage of IL-21 + IL-2 + CD4 + T cells. (G) Expression of CD38 and CXCR5 on CD4 + T cells. Right: Percentage of CD38 + CXCR5 − CD4 + T cells. Data in graphs represent mean ± SEM. Significance was tested paired Student’s t test [(A) to (G)].

    Article Snippet: A total of 0.5 million isolated CD4 + T cells or CD8 + T cells was stimulated with plate-coated anti-CD3 (10 μg/ml; BioXCell, catalog no. BE0001-2) and anti-CD28 (BioXCell, catalog no. BE0291), rhIL-6 (100 ng/ml), rhIFN-α 2 (100 ng/ml), rhIL-12 (100 ng/ml), or the combination of rhIL-6, rhIFN-α 2 , and rhIL-12 for 5 days.

    Techniques: Cell Culture, Control, Expressing

    mRNA expression and RNA-seq analysis in pMIG and LXRβ OE CAR-T cells. (a) Comparison of LXRβ mRNA expression during CAR-T cell generation. LXRβ mRNA levels were analyzed in naïve T cells, T cells stimulated with anti-CD3/CD28, and untransduced or CAR-transduced T cells to assess the transcriptional changes associated with CAR transduction. Data were presented as the mean ± S.E.M. of n = 3 technical replicates. Statistical significance was calculated with one-way ANOVA followed by Tukey's multiple comparisons. * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001; and ns, not significant (not shown). (b–e) RNA-seq analysis comparing transcriptomic differences between pMIG and LXRβ OE CAR-T cells. (b) Principal component analysis (PCA) plot illustrating global transcriptomic differences between pMIG and LXRβ OE CAR-T cells. (c) Volcano plot illustrating differentially expressed mRNAs between pMIG and LXRβ OE CAR-T cells. A total of 169 genes were identified based on the criteria of |fold change| ≥ 2 and raw p -value < 0.05. The x-axis represents log₂ fold change, and the y-axis shows –log₁₀( p -value). Red and blue dots indicate significantly upregulated and downregulated genes in LXRβ OE CAR-T, respectively, while gray dots represent non-significant genes. (d) Heatmap of normalized RNA-seq reads (as z scores) showing the expression of genes involved in the inflammatory response, comparing pMIG and LXRβ OE CAR-T cells. (e) Heatmap of normalized RNA-seq reads (as z scores) illustrating the expression of genes associated with TNFα signaling via NF-κB, highlighting the transcriptional changes induced by LXRβ overexpression.

    Journal: Oncoimmunology

    Article Title: The LXRβ/NF-κB axis reprograms CAR-T cells to resist exhaustion in the tumor microenvironment

    doi: 10.1080/2162402X.2025.2611615

    Figure Lengend Snippet: mRNA expression and RNA-seq analysis in pMIG and LXRβ OE CAR-T cells. (a) Comparison of LXRβ mRNA expression during CAR-T cell generation. LXRβ mRNA levels were analyzed in naïve T cells, T cells stimulated with anti-CD3/CD28, and untransduced or CAR-transduced T cells to assess the transcriptional changes associated with CAR transduction. Data were presented as the mean ± S.E.M. of n = 3 technical replicates. Statistical significance was calculated with one-way ANOVA followed by Tukey's multiple comparisons. * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; **** p ≤ 0.0001; and ns, not significant (not shown). (b–e) RNA-seq analysis comparing transcriptomic differences between pMIG and LXRβ OE CAR-T cells. (b) Principal component analysis (PCA) plot illustrating global transcriptomic differences between pMIG and LXRβ OE CAR-T cells. (c) Volcano plot illustrating differentially expressed mRNAs between pMIG and LXRβ OE CAR-T cells. A total of 169 genes were identified based on the criteria of |fold change| ≥ 2 and raw p -value < 0.05. The x-axis represents log₂ fold change, and the y-axis shows –log₁₀( p -value). Red and blue dots indicate significantly upregulated and downregulated genes in LXRβ OE CAR-T, respectively, while gray dots represent non-significant genes. (d) Heatmap of normalized RNA-seq reads (as z scores) showing the expression of genes involved in the inflammatory response, comparing pMIG and LXRβ OE CAR-T cells. (e) Heatmap of normalized RNA-seq reads (as z scores) illustrating the expression of genes associated with TNFα signaling via NF-κB, highlighting the transcriptional changes induced by LXRβ overexpression.

    Article Snippet: Purified CD8+ T cells were activated for 24 h with 5 μg/mL plate-bound anti-CD3 and anti-CD28 antibodies (Bio X Cell) before CAR-T cell generation.

    Techniques: Expressing, RNA Sequencing, Comparison, Transduction, Over Expression

    Diluted whole blood samples from sepsis patients (n = 5–8) and healthy donors (n = 20) were stimulated ex vivo with defined immune agonists for 24–72 h, and cytokine levels were quantified in diluted plasma supernatants. Volcano plots display log 2 fold change versus −log 10 adjusted p values (FDR < 0.05). Statistical significance was assessed using multiple unpaired t -tests across individual cytokines. (A) Stimulation with the TLR2 ligand FSL-1 (100 ng/ml) for 24 h induced significantly attenuated cytokine production in sepsis samples compared with healthy controls, as visualized by a volcano plot and corresponding bar/dot plots. Reduced cytokine levels are shown in blue, while increased IP-10 is shown in red (n = 5). (B) Stimulation with the TLR4 ligand LPS (1 ng/ml) for 24 h resulted in significantly reduced production of IP-10 and IL-1β in sepsis samples compared with healthy controls (n = 5). (C) Stimulation with the TLR8 ligand TL8-506 (300 ng/ml) for 24 h demonstrated significantly reduced IP-10 and IL-12p70 production in sepsis samples (n = 5). (D) Stimulation of diluted whole blood with a T cell/MHC class II–dependent stimulus (Cytostim combined with anti-CD28) for 72 h revealed broadly attenuated cytokine responses in sepsis samples compared with healthy controls (n = 8).

    Journal: bioRxiv

    Article Title: SLAMF1-peptide mediated epigenetic priming reprograms innate immune responses in sepsis

    doi: 10.64898/2025.12.29.696918

    Figure Lengend Snippet: Diluted whole blood samples from sepsis patients (n = 5–8) and healthy donors (n = 20) were stimulated ex vivo with defined immune agonists for 24–72 h, and cytokine levels were quantified in diluted plasma supernatants. Volcano plots display log 2 fold change versus −log 10 adjusted p values (FDR < 0.05). Statistical significance was assessed using multiple unpaired t -tests across individual cytokines. (A) Stimulation with the TLR2 ligand FSL-1 (100 ng/ml) for 24 h induced significantly attenuated cytokine production in sepsis samples compared with healthy controls, as visualized by a volcano plot and corresponding bar/dot plots. Reduced cytokine levels are shown in blue, while increased IP-10 is shown in red (n = 5). (B) Stimulation with the TLR4 ligand LPS (1 ng/ml) for 24 h resulted in significantly reduced production of IP-10 and IL-1β in sepsis samples compared with healthy controls (n = 5). (C) Stimulation with the TLR8 ligand TL8-506 (300 ng/ml) for 24 h demonstrated significantly reduced IP-10 and IL-12p70 production in sepsis samples (n = 5). (D) Stimulation of diluted whole blood with a T cell/MHC class II–dependent stimulus (Cytostim combined with anti-CD28) for 72 h revealed broadly attenuated cytokine responses in sepsis samples compared with healthy controls (n = 8).

    Article Snippet: T cell responses were assessed after 72 h, under non-stimulated conditions (RPMI alone) and RPMI with a synthetic superantigen (CytoStim, 2 μl/ml) from Miltenyi Biotec (cross-binding TCR and MCH) in combination with co-stimulating anti-CD28 mAb (InVivoMAb, BioXCell, 300 ng/ml).

    Techniques: Ex Vivo, Clinical Proteomics