Review



b subtilis 3610  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    ATCC b subtilis 3610
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Subtilis 3610, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 207 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/EML+Cell+Line%2C+Clone+1/pmc12826055-167-6-9
    Average 95 stars, based on 207 article reviews
    b subtilis 3610 - by Bioz Stars, 2026-10
    95/100 stars

    Images

    1) Product Images from "A 3D-printed capillary tube holder for high-throughput chemotaxis assays"

    Article Title: A 3D-printed capillary tube holder for high-throughput chemotaxis assays

    Journal: Journal of Bacteriology

    doi: 10.1128/jb.00384-25

    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus subtilis 3610 and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    Figure Legend Snippet: Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus subtilis 3610 and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.

    Techniques Used: Construct, Concentration Assay

    Related Articles

    DNA Sequencing:

    Article Title: Genome-Wide Investigation of Biofilm Formation in Bacillus cereus
    Article Snippet: Primers were ordered from Integrated DNA Technologies (Coralville, IA, USA). .. DNA sequencing was performed at Genewiz (Cambridge, MA, USA). table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain, plasmid, or primer a Description or sequence (5′ to 3′) b Reference or source Strains NICB3610 Undomesticated wild strain of B. subtilis 6 YC1025 Mutant of B. subtilis 3610 with transposon insertion in yclQ This study YC1104 Mutant of B. subtilis 3610 with transposon insertion in fhuD This study AR156 Environmental isolate of B. cereus 25 ATCC 14579 Domesticated laboratory strain of B. cereus 27 FY178 clpYQ in-frame deletion mutant of AR156 This study YY250 clpYQ in-frame deletion mutant (FY178), complemented by pGFP78- clpYQ This study YY251 purD ::Tn 10 (BC61), complemented by pGFP78- purDH This study YY252 purD ::Tn 10 (BC85), complemented by pGFP78- purDH This study Plasmids pIC333 Plasmid containing the mini-Tn 10 transposition system, Spc r 53 pMAD Suicide vector containing temp-sensitive origin, Mls r Spc r 51 pGFP78 Plasmid replicable in B. cereus with gfp under constitutive promoter 20 Primers Tn10-(113–98) GCCGCGTTGGCCGATTC Tn10-(2235–2249) GATATTCACGGTTTA clpYQ(Bc)-P1 GTACGGATCCACTTTGTACTGACACCACTGCT clpYQ(Bc)-P2 GTACGTCGACACGTTGAGGAGAAATTAGCAACG clpYQ(Bc)-P3 GTACGAATTC CGCCATTGTTTCGCCATCTC clpYQ(Bc)-P4 GTACCCATGG ACGACGTTGCACGATGAAAA clpYQ(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGGGAAATTTCCACGCT clpYQ(Bc)-ComR GTACTCTAGATTACAAAATAAACTGGCT purDH(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGAAAAAGCGTGCATTA purDH(Bc)-ComR GTACTCTAGATTAACTTCTCGCCATCTC aad-1 TAGGACATTCAGCAGTTATC aad-2 CAAGCGTAAGTGATGGAA ackA-1 ACAGTAGAAGAAGTGGTTA ackA-2 TACGGCTTACGAATACAT aldC-1 GAAGAAGTGGAAGCATTA aldC-2 ATGAGAAGATTGGTTGTG bdhA-1 CATTAGCAGGCGTTGATAT bdhA-2 GTTATTCGGAGTAATTGTTG ldh-1 TAGAGCACTTAGGATGGA ldh-2 ATTAGCGAACTCAGAACA lrgA-1 TGCTGTTCCAAGTGCTAA lrgA-2 TGCGTTACCAATCTCTGAA pgm-1 GCTATGGTGAATGGTGAA pgm-2 GGCGTGTTATCTTCGTTA pk-1 TTACAACAAGCACTGATA pk-2 GGAATACCGATTGATACA pta-1 CATTAGCAGGCGTTGATAT pta-2 GAGCGTCTTCTTCAGTTG ywbH-1 TGCTGTTCCAAGTGCTAA ywbH-2 TGCGTTACCAATCTCTGAA clpY-Int(Bc)-F GAAACGCTCCAGCTGCAACG clpY-Int(Bc)-R GTCGAATAGCGTAGATGTATC sinR-Int(Bc)-F GAAGTAGAGTATCAACTGGA sinR-Int(Bc)-R GCTGGTGTTGCTAAATCTTAC calY1-Int(Bc)-F AGGTGATTAGCAACGTAATCT calY1-Int(Bc)-R GTTCCATCGATCCTGAAAGAA Open in a separate window a All transposon insertion mutants of B. cereus AR156 are described in . b Spc r , spectinomycin resistance; Mls r , erythromycin resistance. ..

    Plasmid Preparation:

    Article Title: Genome-Wide Investigation of Biofilm Formation in Bacillus cereus
    Article Snippet: Primers were ordered from Integrated DNA Technologies (Coralville, IA, USA). .. DNA sequencing was performed at Genewiz (Cambridge, MA, USA). table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain, plasmid, or primer a Description or sequence (5′ to 3′) b Reference or source Strains NICB3610 Undomesticated wild strain of B. subtilis 6 YC1025 Mutant of B. subtilis 3610 with transposon insertion in yclQ This study YC1104 Mutant of B. subtilis 3610 with transposon insertion in fhuD This study AR156 Environmental isolate of B. cereus 25 ATCC 14579 Domesticated laboratory strain of B. cereus 27 FY178 clpYQ in-frame deletion mutant of AR156 This study YY250 clpYQ in-frame deletion mutant (FY178), complemented by pGFP78- clpYQ This study YY251 purD ::Tn 10 (BC61), complemented by pGFP78- purDH This study YY252 purD ::Tn 10 (BC85), complemented by pGFP78- purDH This study Plasmids pIC333 Plasmid containing the mini-Tn 10 transposition system, Spc r 53 pMAD Suicide vector containing temp-sensitive origin, Mls r Spc r 51 pGFP78 Plasmid replicable in B. cereus with gfp under constitutive promoter 20 Primers Tn10-(113–98) GCCGCGTTGGCCGATTC Tn10-(2235–2249) GATATTCACGGTTTA clpYQ(Bc)-P1 GTACGGATCCACTTTGTACTGACACCACTGCT clpYQ(Bc)-P2 GTACGTCGACACGTTGAGGAGAAATTAGCAACG clpYQ(Bc)-P3 GTACGAATTC CGCCATTGTTTCGCCATCTC clpYQ(Bc)-P4 GTACCCATGG ACGACGTTGCACGATGAAAA clpYQ(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGGGAAATTTCCACGCT clpYQ(Bc)-ComR GTACTCTAGATTACAAAATAAACTGGCT purDH(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGAAAAAGCGTGCATTA purDH(Bc)-ComR GTACTCTAGATTAACTTCTCGCCATCTC aad-1 TAGGACATTCAGCAGTTATC aad-2 CAAGCGTAAGTGATGGAA ackA-1 ACAGTAGAAGAAGTGGTTA ackA-2 TACGGCTTACGAATACAT aldC-1 GAAGAAGTGGAAGCATTA aldC-2 ATGAGAAGATTGGTTGTG bdhA-1 CATTAGCAGGCGTTGATAT bdhA-2 GTTATTCGGAGTAATTGTTG ldh-1 TAGAGCACTTAGGATGGA ldh-2 ATTAGCGAACTCAGAACA lrgA-1 TGCTGTTCCAAGTGCTAA lrgA-2 TGCGTTACCAATCTCTGAA pgm-1 GCTATGGTGAATGGTGAA pgm-2 GGCGTGTTATCTTCGTTA pk-1 TTACAACAAGCACTGATA pk-2 GGAATACCGATTGATACA pta-1 CATTAGCAGGCGTTGATAT pta-2 GAGCGTCTTCTTCAGTTG ywbH-1 TGCTGTTCCAAGTGCTAA ywbH-2 TGCGTTACCAATCTCTGAA clpY-Int(Bc)-F GAAACGCTCCAGCTGCAACG clpY-Int(Bc)-R GTCGAATAGCGTAGATGTATC sinR-Int(Bc)-F GAAGTAGAGTATCAACTGGA sinR-Int(Bc)-R GCTGGTGTTGCTAAATCTTAC calY1-Int(Bc)-F AGGTGATTAGCAACGTAATCT calY1-Int(Bc)-R GTTCCATCGATCCTGAAAGAA Open in a separate window a All transposon insertion mutants of B. cereus AR156 are described in . b Spc r , spectinomycin resistance; Mls r , erythromycin resistance. ..

    Sequencing:

    Article Title: Genome-Wide Investigation of Biofilm Formation in Bacillus cereus
    Article Snippet: Primers were ordered from Integrated DNA Technologies (Coralville, IA, USA). .. DNA sequencing was performed at Genewiz (Cambridge, MA, USA). table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain, plasmid, or primer a Description or sequence (5′ to 3′) b Reference or source Strains NICB3610 Undomesticated wild strain of B. subtilis 6 YC1025 Mutant of B. subtilis 3610 with transposon insertion in yclQ This study YC1104 Mutant of B. subtilis 3610 with transposon insertion in fhuD This study AR156 Environmental isolate of B. cereus 25 ATCC 14579 Domesticated laboratory strain of B. cereus 27 FY178 clpYQ in-frame deletion mutant of AR156 This study YY250 clpYQ in-frame deletion mutant (FY178), complemented by pGFP78- clpYQ This study YY251 purD ::Tn 10 (BC61), complemented by pGFP78- purDH This study YY252 purD ::Tn 10 (BC85), complemented by pGFP78- purDH This study Plasmids pIC333 Plasmid containing the mini-Tn 10 transposition system, Spc r 53 pMAD Suicide vector containing temp-sensitive origin, Mls r Spc r 51 pGFP78 Plasmid replicable in B. cereus with gfp under constitutive promoter 20 Primers Tn10-(113–98) GCCGCGTTGGCCGATTC Tn10-(2235–2249) GATATTCACGGTTTA clpYQ(Bc)-P1 GTACGGATCCACTTTGTACTGACACCACTGCT clpYQ(Bc)-P2 GTACGTCGACACGTTGAGGAGAAATTAGCAACG clpYQ(Bc)-P3 GTACGAATTC CGCCATTGTTTCGCCATCTC clpYQ(Bc)-P4 GTACCCATGG ACGACGTTGCACGATGAAAA clpYQ(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGGGAAATTTCCACGCT clpYQ(Bc)-ComR GTACTCTAGATTACAAAATAAACTGGCT purDH(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGAAAAAGCGTGCATTA purDH(Bc)-ComR GTACTCTAGATTAACTTCTCGCCATCTC aad-1 TAGGACATTCAGCAGTTATC aad-2 CAAGCGTAAGTGATGGAA ackA-1 ACAGTAGAAGAAGTGGTTA ackA-2 TACGGCTTACGAATACAT aldC-1 GAAGAAGTGGAAGCATTA aldC-2 ATGAGAAGATTGGTTGTG bdhA-1 CATTAGCAGGCGTTGATAT bdhA-2 GTTATTCGGAGTAATTGTTG ldh-1 TAGAGCACTTAGGATGGA ldh-2 ATTAGCGAACTCAGAACA lrgA-1 TGCTGTTCCAAGTGCTAA lrgA-2 TGCGTTACCAATCTCTGAA pgm-1 GCTATGGTGAATGGTGAA pgm-2 GGCGTGTTATCTTCGTTA pk-1 TTACAACAAGCACTGATA pk-2 GGAATACCGATTGATACA pta-1 CATTAGCAGGCGTTGATAT pta-2 GAGCGTCTTCTTCAGTTG ywbH-1 TGCTGTTCCAAGTGCTAA ywbH-2 TGCGTTACCAATCTCTGAA clpY-Int(Bc)-F GAAACGCTCCAGCTGCAACG clpY-Int(Bc)-R GTCGAATAGCGTAGATGTATC sinR-Int(Bc)-F GAAGTAGAGTATCAACTGGA sinR-Int(Bc)-R GCTGGTGTTGCTAAATCTTAC calY1-Int(Bc)-F AGGTGATTAGCAACGTAATCT calY1-Int(Bc)-R GTTCCATCGATCCTGAAAGAA Open in a separate window a All transposon insertion mutants of B. cereus AR156 are described in . b Spc r , spectinomycin resistance; Mls r , erythromycin resistance. ..

    Mutagenesis:

    Article Title: Genome-Wide Investigation of Biofilm Formation in Bacillus cereus
    Article Snippet: Primers were ordered from Integrated DNA Technologies (Coralville, IA, USA). .. DNA sequencing was performed at Genewiz (Cambridge, MA, USA). table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Strain, plasmid, or primer a Description or sequence (5′ to 3′) b Reference or source Strains NICB3610 Undomesticated wild strain of B. subtilis 6 YC1025 Mutant of B. subtilis 3610 with transposon insertion in yclQ This study YC1104 Mutant of B. subtilis 3610 with transposon insertion in fhuD This study AR156 Environmental isolate of B. cereus 25 ATCC 14579 Domesticated laboratory strain of B. cereus 27 FY178 clpYQ in-frame deletion mutant of AR156 This study YY250 clpYQ in-frame deletion mutant (FY178), complemented by pGFP78- clpYQ This study YY251 purD ::Tn 10 (BC61), complemented by pGFP78- purDH This study YY252 purD ::Tn 10 (BC85), complemented by pGFP78- purDH This study Plasmids pIC333 Plasmid containing the mini-Tn 10 transposition system, Spc r 53 pMAD Suicide vector containing temp-sensitive origin, Mls r Spc r 51 pGFP78 Plasmid replicable in B. cereus with gfp under constitutive promoter 20 Primers Tn10-(113–98) GCCGCGTTGGCCGATTC Tn10-(2235–2249) GATATTCACGGTTTA clpYQ(Bc)-P1 GTACGGATCCACTTTGTACTGACACCACTGCT clpYQ(Bc)-P2 GTACGTCGACACGTTGAGGAGAAATTAGCAACG clpYQ(Bc)-P3 GTACGAATTC CGCCATTGTTTCGCCATCTC clpYQ(Bc)-P4 GTACCCATGG ACGACGTTGCACGATGAAAA clpYQ(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGGGAAATTTCCACGCT clpYQ(Bc)-ComR GTACTCTAGATTACAAAATAAACTGGCT purDH(Bc)-ComF GTACTCTAGAAGGAGGGATGAAACAATGAAAAAGCGTGCATTA purDH(Bc)-ComR GTACTCTAGATTAACTTCTCGCCATCTC aad-1 TAGGACATTCAGCAGTTATC aad-2 CAAGCGTAAGTGATGGAA ackA-1 ACAGTAGAAGAAGTGGTTA ackA-2 TACGGCTTACGAATACAT aldC-1 GAAGAAGTGGAAGCATTA aldC-2 ATGAGAAGATTGGTTGTG bdhA-1 CATTAGCAGGCGTTGATAT bdhA-2 GTTATTCGGAGTAATTGTTG ldh-1 TAGAGCACTTAGGATGGA ldh-2 ATTAGCGAACTCAGAACA lrgA-1 TGCTGTTCCAAGTGCTAA lrgA-2 TGCGTTACCAATCTCTGAA pgm-1 GCTATGGTGAATGGTGAA pgm-2 GGCGTGTTATCTTCGTTA pk-1 TTACAACAAGCACTGATA pk-2 GGAATACCGATTGATACA pta-1 CATTAGCAGGCGTTGATAT pta-2 GAGCGTCTTCTTCAGTTG ywbH-1 TGCTGTTCCAAGTGCTAA ywbH-2 TGCGTTACCAATCTCTGAA clpY-Int(Bc)-F GAAACGCTCCAGCTGCAACG clpY-Int(Bc)-R GTCGAATAGCGTAGATGTATC sinR-Int(Bc)-F GAAGTAGAGTATCAACTGGA sinR-Int(Bc)-R GCTGGTGTTGCTAAATCTTAC calY1-Int(Bc)-F AGGTGATTAGCAACGTAATCT calY1-Int(Bc)-R GTTCCATCGATCCTGAAAGAA Open in a separate window a All transposon insertion mutants of B. cereus AR156 are described in . b Spc r , spectinomycin resistance; Mls r , erythromycin resistance. ..

    Incubation:

    Article Title: A 3D-printed capillary tube holder for high-throughput chemotaxis assays.
    Article Snippet: .. Preparing bacterial cells for experiments E. coli K12 (ATCC 25404) and B. subtilis 3610 (ATCC 6051) were inoculated into LB media and incubated at 37°C with shaking at 250 rpm for 16–18 hours. ..

    Article Title: A 3D-printed capillary tube holder for high-throughput chemotaxis assays
    Article Snippet: .. E. coli K12 (ATCC 25404) and B. subtilis 3610 (ATCC 6051) were inoculated into LB media and incubated at 37°C with shaking at 250 rpm for 16–18 hours. ..

    other:

    Article Title: The complete genome sequence of Bacillus velezensis LPL061, an exopolysaccharide-producing bacterium
    Article Snippet: The similarity of the gene cluster with other strains such as B. velezensis FZB42, B. velezensis L-H15, B. velezensis LPL-K103, B. amyloliquefaciens DSM7, B. subtilis 168, B. subtilis 3610, and B. subtilis ATCC 21228 was 98.13%, 100%, 89.65%, 95.04%, 72.99%, 72.99%, and 70.07%, respectively.

    Bacteria:

    Article Title: A simple method to create hydrophobic mortar using bacteria grown in liquid cultures
    Article Snippet: .. The bacteria used in this study for the hydrophobic modification are B. subtilis 3610 and E. coli (BL21 (DE3)) from ATCC. .. Two kinds of culture medium (Luria/Miller LB-Medium and LBPlus from Sigma Aldrich) are used to investigate the influence of the culture medium on the hydrophobic performance of the bacteria.

    Modification:

    Article Title: A simple method to create hydrophobic mortar using bacteria grown in liquid cultures
    Article Snippet: .. The bacteria used in this study for the hydrophobic modification are B. subtilis 3610 and E. coli (BL21 (DE3)) from ATCC. .. Two kinds of culture medium (Luria/Miller LB-Medium and LBPlus from Sigma Aldrich) are used to investigate the influence of the culture medium on the hydrophobic performance of the bacteria.



    Similar Products

    b subtilis 3610  (ATCC)
    95
    ATCC b subtilis 3610
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Subtilis 3610, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/EML+Cell+Line%2C+Clone+1/pmc12826055-167-6-9
    Average 95 stars, based on 1 article reviews
    b subtilis 3610 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    b subtilis ncib 3610 t  (ATCC)
    95
    ATCC b subtilis ncib 3610 t
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Subtilis Ncib 3610 T, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/EML+Cell+Line%2C+Clone+1/10__1016_slash_j__pestbp__2026__106967-158-10-45
    Average 95 stars, based on 1 article reviews
    b subtilis ncib 3610 t - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    b subtilis 3610 strains  (Novo Nordisk)
    86
    Novo Nordisk b subtilis 3610 strains
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Subtilis 3610 Strains, supplied by Novo Nordisk, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/3610+b+strains+subtilis/pmc12579842-46-4-12
    Average 86 stars, based on 1 article reviews
    b subtilis 3610 strains - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    b su bacillus subtilis strain ncib 3610  (ATCC)
    94
    ATCC b su bacillus subtilis strain ncib 3610
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Su Bacillus Subtilis Strain Ncib 3610, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/Phytophthora+citrophthora+(Smith+et+Smith)+Leonian/10__46488_slash_nept__2025__v24i03__d1737-161-43-62
    Average 94 stars, based on 1 article reviews
    b su bacillus subtilis strain ncib 3610 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    b subtilis ncib 3610  (ATCC)
    95
    ATCC b subtilis ncib 3610
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Subtilis Ncib 3610, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/EML+Cell+Line%2C+Clone+1/10__3390_slash_pr13051503-64-7-4
    Average 95 stars, based on 1 article reviews
    b subtilis ncib 3610 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    b subtilis ncib 3610 genome  (ATCC)
    95
    ATCC b subtilis ncib 3610 genome
    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus <t>subtilis</t> <t>3610</t> and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.
    B Subtilis Ncib 3610 Genome, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/b+subtilis+3610/EML+Cell+Line%2C+Clone+1/10__3390_slash_pr13051503-85-10-7
    Average 95 stars, based on 1 article reviews
    b subtilis ncib 3610 genome - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus subtilis 3610 and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.

    Journal: Journal of Bacteriology

    Article Title: A 3D-printed capillary tube holder for high-throughput chemotaxis assays

    doi: 10.1128/jb.00384-25

    Figure Lengend Snippet: Constructing standard curves. Standard curves were constructed for each species in both 96- and 384-well plates by plotting the lag times of each well by the number of cells in each well. ( A ) Representative growth curves for the twofold serial dilutions of Bacillus subtilis 3610 and Escherichia coli K12 in 96- and 384-well plates. The solid lines indicate the mean of the technical replicates, while the shaded regions represent the 95% CI. Growth curves are colored by dilution with the wells with the highest concentration of bacterial cells shown in the darkest shade. For 96-well plates, three technical replicates were included for each condition. For 384-well plates, eight technical replicates were included for each condition. ( B ) Standard curves are calculated from growth curves by plotting the number of cells in each well against the lag time. Equations for the best fit line and R 2 value are shown in the figure. Results in this figure are representative of two biological replicates, each containing three or eight technical replicates, for 96- or 384-well plates, respectively.

    Article Snippet: E. coli K12 (ATCC 25404) and B. subtilis 3610 (ATCC 6051) were inoculated into LB media and incubated at 37°C with shaking at 250 rpm for 16–18 hours.

    Techniques: Construct, Concentration Assay