antisense sequence against pir 19521 (Genechem)
86
Structured Review
Genechem
antisense sequence against pir 19521
Antisense Sequence Against Pir 19521, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+sequences/19521+against+antisense+pir+sequence/pm41109384-72-7-25
Average 86 stars, based on 1 article reviews
Antisense Sequence Against Pir 19521, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+sequences/19521+against+antisense+pir+sequence/pm41109384-72-7-25
Average 86 stars, based on 1 article reviews
antisense sequence against pir 19521 - by Bioz Stars,
2026-11
86/100 stars
Images
Related Articles
other:Article Title: Intensive stretch-activated CRT-PMCA1 feedback loop promoted Ca2+ overloading and apoptosis of myoblasts Article Snippet: Adenovirus vector–mediated CRT and PMCA1 siRNA infection The CRT small interference RNA (siRNA) plasmids (siRNA1: sense sequences 5’- GCAGACCCUGCCAUCUAUUTT-3’; antisense sequences 5’-AAUAGAUGGCAGGG UCUGCTT-3’), (siRNA2: sense sequences 5’-GGACCAGAAGGACAUGCA UTT-3’; antisense sequences 5’- AUGCAUGUCCUUCUGGUCCTT-3’), (siRNA3: sense sequences 5’-GCCCAAGAAGAUUAAGGAUTT-3’; antisense sequences 5’-AUCCUUAAUCUUCUUGGGCTT-3’), and PMCA1 siRNA plasmids (siRNA1: sense sequences 5’-CUUGGGCCAUGCGUUCUAUTT-3’; antisense sequences 5’-AUAGA ACGCAUGGCCCAAGTT-3’), (siRNA2: sense sequences 5’-GGGAUCUUCAACAA CGCCATT-3’; antisense sequences 5’- Page 6/25 UGGCGUUGUUGAAGAUCCCTT-3’), (siRNA3: sense sequences 5’-CGUGGCCAGAUCUUGUGGUTT-3’; antisense sequences 5’-ACCACAAGAUCUGGCCACGTT-3’) were constructed by Article Title: Landscape of tumor suppressor long noncoding RNAs in breast cancer Article Snippet: For the Article Title: Analysis of Differentially Expressed Genes in Endothelial Cells Following Tumor Cell Adhesion, and the Role of PRKAA2 and miR-124-3p Article Snippet: The infection of antisense miR-124-3p sequences (GGCATTCACCGCGTGCCTTA) was done according to Shanghai GeneChem Corporation’s operation manual. Article Title: MiR-106b inhibitors sensitize TRAIL-induced apoptosis in hepatocellular carcinoma through increase of death receptor 4 Article Snippet: For xenograft, HepG2 cells were transfected with 5 × 10 5 transducing units of empty lentivirus (LT-control) or Incubation:Article Title: Nuclear translocation of ATG5 induces DNA mismatch repair deficiency (MMR-D)/microsatellite instability (MSI) via interacting with Mis18α in colorectal cancer. Article Snippet: Department of Pharmacology, School of Basic Medical Sciences, Capital Medical University, Beijing, China Institute of Acu-moxibustion, China Academy of Chinese Medical Sciences, Beijing, China Department of Experimental Pathology, College of Basic Medical Sciences, Shandong First Medical University and Shandong Academy of Medical Sciences, Jinan, China Department of Pathology, Hospital of Bin Zhou Medical College, Binzhou, China Toxicology and Sanitary Chemistry, School of Public Health, Capital Medical University, Beijing, China Negative Control:Article Title: Nuclear translocation of ATG5 induces DNA mismatch repair deficiency (MMR-D)/microsatellite instability (MSI) via interacting with Mis18α in colorectal cancer. Article Snippet: Department of Pharmacology, School of Basic Medical Sciences, Capital Medical University, Beijing, China Institute of Acu-moxibustion, China Academy of Chinese Medical Sciences, Beijing, China Department of Experimental Pathology, College of Basic Medical Sciences, Shandong First Medical University and Shandong Academy of Medical Sciences, Jinan, China Department of Pathology, Hospital of Bin Zhou Medical College, Binzhou, China Toxicology and Sanitary Chemistry, School of Public Health, Capital Medical University, Beijing, China Synthesized:Article Title: Nuclear translocation of ATG5 induces DNA mismatch repair deficiency (MMR-D)/microsatellite instability (MSI) via interacting with Mis18α in colorectal cancer. Article Snippet: Department of Pharmacology, School of Basic Medical Sciences, Capital Medical University, Beijing, China Institute of Acu-moxibustion, China Academy of Chinese Medical Sciences, Beijing, China Department of Experimental Pathology, College of Basic Medical Sciences, Shandong First Medical University and Shandong Academy of Medical Sciences, Jinan, China Department of Pathology, Hospital of Bin Zhou Medical College, Binzhou, China Toxicology and Sanitary Chemistry, School of Public Health, Capital Medical University, Beijing, China Plasmid Preparation:Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116 and HeLa cells were stimulated with 2 mg/mL LPS (#L2630, Sigma-Aldrich) and continued to cultivate with the same culture medium for 3 hours. .. Plasmid, lentivirus production, and infection For the knockdown of HCP5 and MIAT expression, two human HCP5-targeted RNAi sequences (RNAi# sense: TGCTGATGAGTAGGACATTT; RNAi# antisense: AAATGTCCTACTCATCAGCA) and Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116, HeLa, 4T1, 786-O, Hs578T, BT549, and MCF7 cells obtained from ATCC in 2017 were cultured in RPMI1640 or DMEM and were not authenticated in the past year (Gibco). .. Long noncoding RNAs control the modulation of immune checkpoint molecules in cancer 1 Shouping Xu 1,# , Qin Wang 1,# , Yujuan Kang 1 , Jiena Liu 1 , Yanling Yin 1 , Lei Liu 1 , Hao Wu 1 , Siwei 2 Li 1 , Shiyao Sui 1 , Meiying Shen 1 , Wei Zheng 1 , Da Pang 1,2* 3 Shouping Xu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 4 China; E-mail: Shoupingxu@hrbmu.edu.cn 5 Qin Wang, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 6 China; E-mail: wangqin0923@163.com 7 Yujuan Kang, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 8 China; E-mail: 991979837@qq.com 9 Jiena Liu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 10 China; E-mail: liujienana@163.com 11 Yanling Yin, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 12 China; E-mail: yinyanling426@163.com 13 Lei Liu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 14 China; E-mail: 13263530798@163.com 15 Hao Wu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 16 China; E-mail: wh849399985@qq.com 17 Siwei Li, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 18 China; E-mail: lisiwei396469776@163.com 19 Shiyao Sui, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 20 China; E-mail: ssy19881227@126.com 21 Meiying Shen, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 22 .. Infection:Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116 and HeLa cells were stimulated with 2 mg/mL LPS (#L2630, Sigma-Aldrich) and continued to cultivate with the same culture medium for 3 hours. .. Plasmid, lentivirus production, and infection For the knockdown of HCP5 and MIAT expression, two human HCP5-targeted RNAi sequences (RNAi# sense: TGCTGATGAGTAGGACATTT; RNAi# antisense: AAATGTCCTACTCATCAGCA) and Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116, HeLa, 4T1, 786-O, Hs578T, BT549, and MCF7 cells obtained from ATCC in 2017 were cultured in RPMI1640 or DMEM and were not authenticated in the past year (Gibco). .. Long noncoding RNAs control the modulation of immune checkpoint molecules in cancer 1 Shouping Xu 1,# , Qin Wang 1,# , Yujuan Kang 1 , Jiena Liu 1 , Yanling Yin 1 , Lei Liu 1 , Hao Wu 1 , Siwei 2 Li 1 , Shiyao Sui 1 , Meiying Shen 1 , Wei Zheng 1 , Da Pang 1,2* 3 Shouping Xu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 4 China; E-mail: Shoupingxu@hrbmu.edu.cn 5 Qin Wang, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 6 China; E-mail: wangqin0923@163.com 7 Yujuan Kang, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 8 China; E-mail: 991979837@qq.com 9 Jiena Liu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 10 China; E-mail: liujienana@163.com 11 Yanling Yin, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 12 China; E-mail: yinyanling426@163.com 13 Lei Liu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 14 China; E-mail: 13263530798@163.com 15 Hao Wu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 16 China; E-mail: wh849399985@qq.com 17 Siwei Li, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 18 China; E-mail: lisiwei396469776@163.com 19 Shiyao Sui, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 20 China; E-mail: ssy19881227@126.com 21 Meiying Shen, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 22 .. Knockdown:Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116 and HeLa cells were stimulated with 2 mg/mL LPS (#L2630, Sigma-Aldrich) and continued to cultivate with the same culture medium for 3 hours. .. Plasmid, lentivirus production, and infection For the knockdown of HCP5 and MIAT expression, two human HCP5-targeted RNAi sequences (RNAi# sense: TGCTGATGAGTAGGACATTT; RNAi# antisense: AAATGTCCTACTCATCAGCA) and Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116, HeLa, 4T1, 786-O, Hs578T, BT549, and MCF7 cells obtained from ATCC in 2017 were cultured in RPMI1640 or DMEM and were not authenticated in the past year (Gibco). .. Long noncoding RNAs control the modulation of immune checkpoint molecules in cancer 1 Shouping Xu 1,# , Qin Wang 1,# , Yujuan Kang 1 , Jiena Liu 1 , Yanling Yin 1 , Lei Liu 1 , Hao Wu 1 , Siwei 2 Li 1 , Shiyao Sui 1 , Meiying Shen 1 , Wei Zheng 1 , Da Pang 1,2* 3 Shouping Xu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 4 China; E-mail: Shoupingxu@hrbmu.edu.cn 5 Qin Wang, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 6 China; E-mail: wangqin0923@163.com 7 Yujuan Kang, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 8 China; E-mail: 991979837@qq.com 9 Jiena Liu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 10 China; E-mail: liujienana@163.com 11 Yanling Yin, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 12 China; E-mail: yinyanling426@163.com 13 Lei Liu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 14 China; E-mail: 13263530798@163.com 15 Hao Wu, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 16 China; E-mail: wh849399985@qq.com 17 Siwei Li, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 18 China; E-mail: lisiwei396469776@163.com 19 Shiyao Sui, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 20 China; E-mail: ssy19881227@126.com 21 Meiying Shen, Department of Breast Surgery, Harbin Medical University Cancer Hospital, Harbin, 22 .. Expressing:Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116 and HeLa cells were stimulated with 2 mg/mL LPS (#L2630, Sigma-Aldrich) and continued to cultivate with the same culture medium for 3 hours. .. Plasmid, lentivirus production, and infection For the knockdown of HCP5 and MIAT expression, two human HCP5-targeted RNAi sequences (RNAi# sense: TGCTGATGAGTAGGACATTT; RNAi# antisense: AAATGTCCTACTCATCAGCA) and Article Title: Long Noncoding RNAs Control the Modulation of Immune Checkpoint Molecules in Cancer Article Snippet: HCT116, HeLa, 4T1, 786-O, Hs578T, BT549, and MCF7 cells obtained from ATCC in 2017 were cultured in RPMI1640 or DMEM and were not authenticated in the past year (Gibco). .. Long noncoding RNAs control the modulation of immune checkpoint molecules in cancer 1 Shouping Xu 1,# , Qin Wang 1,# , Yujuan Kang 1 , Jiena Liu 1 , Yanling Yin 1 , Lei Liu 1 , Hao Wu 1 , Siwei 2 Li 1 , Shiyao Sui 1 , Meiying Shen 1 , Wei Zheng |
