Sequencing:Article Title: Spindle-Length-Dependent HURP Localization Allows Centrosomes to Control Kinetochore-Fiber Plus-End Dynamics.
Article Snippet: Live-cell imaging experiments were performed using 8-well ibidi chambers (Vitaris, .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting sequences (pool): Kif15: GGACAU AAAUUGCAAAUAC, GCAGAGUGUUGAUCAAGAA, GAGCUUCAGUCUUUGCAAA, GAGAUGGAAUGC CUUAGAA [76] N/A siRNA targeting sequence: Kid-1: CAAGCUCACU CGCCUAUUGTT [77] N/A siRNA targeting sequence: HSET: GAAGCAGCCC UGUCAA [48] N/A siRNA targeting sequence: CLASP-1: CCAUUAUG CCAACUAUCUdTdT [78] N/A siRNA targeting sequence: ch-TOG: GAGCAGUCG CAAAUGAAGCdTdT [79] N/A siRNA: Kif2a GE Healthcare [23] ON-TARGETplus, 3796, siRNA- SMARTpools gRNA targeting sequence: human DLGAP5 (HURP): ACATTTTGCCAGTCGACACAGG This study N/A Recombinant DNA Vector: pCMV-Cas9-RFP (encoding the Cas9 and the designed guide RNA) Sigma-Aldrich N/A Vector: pUC57-Kan (encoding the repair template) GENEWIZ N/A Software and Algorithms NIS-Elements software (version 4.3) Nikon N/A Imaris software (versions 7.7; 8.2 and 9.3 were used in this study) BitPlane N/A Softworx software (version 6.5.2) GE Healthcare N/A MATLAB software (versions 2013b; 2016a and 2017b were used in this study) MathWorks N/A SnapGene software GSL Biotech LLC N/A Kinetochore microtubule depolymerization assay code [75] https://github.com/Bioimaging/ -Microtubule-Stability Kinetochore tracking assay code [30] https://github.com/cmcb-warwick HURP line profiling code This study https://github.com/Bioimaging/ 3DLineProfile FRAP analysis code This study https://github.com/Bioimaging/ FRAP-of-HURP Other 8-well ibidi chambers Vitaris Cat#80826 e2 Current Biology 29, 1–16.e1–e6, November 4, 2019 Switzerland; 80826) and imaging Leibovitz L-15 medium, (Thermofisher, Switzerland; 21083), supplemented with 10% FCS. .. The following drug concentrations were used: centrinone 300 nM (kind gift from A. Shiau and Tocris Bioscience; 5687), MG132 10 mM (Sigma-Aldrich; C2211), RO-3306 9 mM (Sigma-Aldrich; SML0569), SiR-tubulin 25-50 nM (Spirochrome; SC002), nocodazole 200 ng ml-1 (Sigma-Aldrich; M1404), SiR-DNA 25 nM (Spirochrome; SC007), MLN8237 100nM (Selleckchem; S1133), taxol 15 nM (Sigma-Aldrich; T7402).
Recombinant:Article Title: Spindle-Length-Dependent HURP Localization Allows Centrosomes to Control Kinetochore-Fiber Plus-End Dynamics.
Article Snippet: Live-cell imaging experiments were performed using 8-well ibidi chambers (Vitaris, .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting sequences (pool): Kif15: GGACAU AAAUUGCAAAUAC, GCAGAGUGUUGAUCAAGAA, GAGCUUCAGUCUUUGCAAA, GAGAUGGAAUGC CUUAGAA [76] N/A siRNA targeting sequence: Kid-1: CAAGCUCACU CGCCUAUUGTT [77] N/A siRNA targeting sequence: HSET: GAAGCAGCCC UGUCAA [48] N/A siRNA targeting sequence: CLASP-1: CCAUUAUG CCAACUAUCUdTdT [78] N/A siRNA targeting sequence: ch-TOG: GAGCAGUCG CAAAUGAAGCdTdT [79] N/A siRNA: Kif2a GE Healthcare [23] ON-TARGETplus, 3796, siRNA- SMARTpools gRNA targeting sequence: human DLGAP5 (HURP): ACATTTTGCCAGTCGACACAGG This study N/A Recombinant DNA Vector: pCMV-Cas9-RFP (encoding the Cas9 and the designed guide RNA) Sigma-Aldrich N/A Vector: pUC57-Kan (encoding the repair template) GENEWIZ N/A Software and Algorithms NIS-Elements software (version 4.3) Nikon N/A Imaris software (versions 7.7; 8.2 and 9.3 were used in this study) BitPlane N/A Softworx software (version 6.5.2) GE Healthcare N/A MATLAB software (versions 2013b; 2016a and 2017b were used in this study) MathWorks N/A SnapGene software GSL Biotech LLC N/A Kinetochore microtubule depolymerization assay code [75] https://github.com/Bioimaging/ -Microtubule-Stability Kinetochore tracking assay code [30] https://github.com/cmcb-warwick HURP line profiling code This study https://github.com/Bioimaging/ 3DLineProfile FRAP analysis code This study https://github.com/Bioimaging/ FRAP-of-HURP Other 8-well ibidi chambers Vitaris Cat#80826 e2 Current Biology 29, 1–16.e1–e6, November 4, 2019 Switzerland; 80826) and imaging Leibovitz L-15 medium, (Thermofisher, Switzerland; 21083), supplemented with 10% FCS. .. The following drug concentrations were used: centrinone 300 nM (kind gift from A. Shiau and Tocris Bioscience; 5687), MG132 10 mM (Sigma-Aldrich; C2211), RO-3306 9 mM (Sigma-Aldrich; SML0569), SiR-tubulin 25-50 nM (Spirochrome; SC002), nocodazole 200 ng ml-1 (Sigma-Aldrich; M1404), SiR-DNA 25 nM (Spirochrome; SC007), MLN8237 100nM (Selleckchem; S1133), taxol 15 nM (Sigma-Aldrich; T7402).
Software:Article Title: Spindle-Length-Dependent HURP Localization Allows Centrosomes to Control Kinetochore-Fiber Plus-End Dynamics.
Article Snippet: Live-cell imaging experiments were performed using 8-well ibidi chambers (Vitaris, .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting sequences (pool): Kif15: GGACAU AAAUUGCAAAUAC, GCAGAGUGUUGAUCAAGAA, GAGCUUCAGUCUUUGCAAA, GAGAUGGAAUGC CUUAGAA [76] N/A siRNA targeting sequence: Kid-1: CAAGCUCACU CGCCUAUUGTT [77] N/A siRNA targeting sequence: HSET: GAAGCAGCCC UGUCAA [48] N/A siRNA targeting sequence: CLASP-1: CCAUUAUG CCAACUAUCUdTdT [78] N/A siRNA targeting sequence: ch-TOG: GAGCAGUCG CAAAUGAAGCdTdT [79] N/A siRNA: Kif2a GE Healthcare [23] ON-TARGETplus, 3796, siRNA- SMARTpools gRNA targeting sequence: human DLGAP5 (HURP): ACATTTTGCCAGTCGACACAGG This study N/A Recombinant DNA Vector: pCMV-Cas9-RFP (encoding the Cas9 and the designed guide RNA) Sigma-Aldrich N/A Vector: pUC57-Kan (encoding the repair template) GENEWIZ N/A Software and Algorithms NIS-Elements software (version 4.3) Nikon N/A Imaris software (versions 7.7; 8.2 and 9.3 were used in this study) BitPlane N/A Softworx software (version 6.5.2) GE Healthcare N/A MATLAB software (versions 2013b; 2016a and 2017b were used in this study) MathWorks N/A SnapGene software GSL Biotech LLC N/A Kinetochore microtubule depolymerization assay code [75] https://github.com/Bioimaging/ -Microtubule-Stability Kinetochore tracking assay code [30] https://github.com/cmcb-warwick HURP line profiling code This study https://github.com/Bioimaging/ 3DLineProfile FRAP analysis code This study https://github.com/Bioimaging/ FRAP-of-HURP Other 8-well ibidi chambers Vitaris Cat#80826 e2 Current Biology 29, 1–16.e1–e6, November 4, 2019 Switzerland; 80826) and imaging Leibovitz L-15 medium, (Thermofisher, Switzerland; 21083), supplemented with 10% FCS. .. The following drug concentrations were used: centrinone 300 nM (kind gift from A. Shiau and Tocris Bioscience; 5687), MG132 10 mM (Sigma-Aldrich; C2211), RO-3306 9 mM (Sigma-Aldrich; SML0569), SiR-tubulin 25-50 nM (Spirochrome; SC002), nocodazole 200 ng ml-1 (Sigma-Aldrich; M1404), SiR-DNA 25 nM (Spirochrome; SC007), MLN8237 100nM (Selleckchem; S1133), taxol 15 nM (Sigma-Aldrich; T7402).
Article Title: Targeting immune cells in the aged brain reveals that engineered cytokine IL-10 enhances neurogenesis and improves cognition.
Article Snippet: BV2 cell line Female BV2 microglia cells were a kind gift from Tony Wyss-Coray (Stanford University) and were expanded in DMEM (Gibco, 11965092) supplemented with 10% fetal bovine serum (FBS, Millipore Sigma, F2442) and penicillin-streptomycin-glutamine (Gibco, .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms NIS-Elements software (AR 4.30.02, 64-bit) Nikon https://www.microscope.healthcare. nikon.com/products/software/nis-elements ZEN Blue 3.0 software N/A https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Fiji ImageJ https://imagej.net/software/fiji/downloads FlowJo Tree Star https://www.flowjo.com/ Cell Ranger (version 3.0.2) 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest R (version 4.2.2) R https://www.r-project.org/ GraphPad Prism (version 10.2.0) GraphPad https://www.graphpad.com/features SMART Video Tracking System (Panlab) Harvard Apparatus https://www.harvardapparatus.com/ smart-video-tracking-system.html Motor Monitor Kinder Scientific https://kinderscientific.com/ software/motor-monitor/ BioRender BioRender https://www.biorender.com Other BD FACSAria II Cell Sorter BD Biosciences RRID: SCR_018934 BD Symphony Flow Cytometer BD Biosciences RRDI: SCR_022674 BD LSRII Flow Cytometer BD Biosciences RRID: SCR_002159 CM3050 S Cryostat Leica RRID: SCR_016844 Zeiss LSM 900 confocal microscope Zeiss RRID: SCR_022263 Nikon Eclipse Ti microscope Nikon RRID: SCR_021242 Zyla sCMOS camera Andor RRID: SCR_023610 Enviro-dri® natural brown material Shepherd Specialty Papers N/A ALZET Brain Infusion Kit 3 ALZET Cat# 0008851 ALZET Mini osmotic pump 1007D ALZET Cat# 0000290 Small Animal Stereotaxic Instrument with Digital Display Console Kopf Model 940 Immunity 59, 1–19.e1–e13, February 10, 2026 e4 10378-016). ..
Imaging:Article Title: Spindle-Length-Dependent HURP Localization Allows Centrosomes to Control Kinetochore-Fiber Plus-End Dynamics.
Article Snippet: Live-cell imaging experiments were performed using 8-well ibidi chambers (Vitaris, .. REAGENT or RESOURCE SOURCE IDENTIFIER siRNA targeting sequences (pool): Kif15: GGACAU AAAUUGCAAAUAC, GCAGAGUGUUGAUCAAGAA, GAGCUUCAGUCUUUGCAAA, GAGAUGGAAUGC CUUAGAA [76] N/A siRNA targeting sequence: Kid-1: CAAGCUCACU CGCCUAUUGTT [77] N/A siRNA targeting sequence: HSET: GAAGCAGCCC UGUCAA [48] N/A siRNA targeting sequence: CLASP-1: CCAUUAUG CCAACUAUCUdTdT [78] N/A siRNA targeting sequence: ch-TOG: GAGCAGUCG CAAAUGAAGCdTdT [79] N/A siRNA: Kif2a GE Healthcare [23] ON-TARGETplus, 3796, siRNA- SMARTpools gRNA targeting sequence: human DLGAP5 (HURP): ACATTTTGCCAGTCGACACAGG This study N/A Recombinant DNA Vector: pCMV-Cas9-RFP (encoding the Cas9 and the designed guide RNA) Sigma-Aldrich N/A Vector: pUC57-Kan (encoding the repair template) GENEWIZ N/A Software and Algorithms NIS-Elements software (version 4.3) Nikon N/A Imaris software (versions 7.7; 8.2 and 9.3 were used in this study) BitPlane N/A Softworx software (version 6.5.2) GE Healthcare N/A MATLAB software (versions 2013b; 2016a and 2017b were used in this study) MathWorks N/A SnapGene software GSL Biotech LLC N/A Kinetochore microtubule depolymerization assay code [75] https://github.com/Bioimaging/ -Microtubule-Stability Kinetochore tracking assay code [30] https://github.com/cmcb-warwick HURP line profiling code This study https://github.com/Bioimaging/ 3DLineProfile FRAP analysis code This study https://github.com/Bioimaging/ FRAP-of-HURP Other 8-well ibidi chambers Vitaris Cat#80826 e2 Current Biology 29, 1–16.e1–e6, November 4, 2019 Switzerland; 80826) and imaging Leibovitz L-15 medium, (Thermofisher, Switzerland; 21083), supplemented with 10% FCS. .. The following drug concentrations were used: centrinone 300 nM (kind gift from A. Shiau and Tocris Bioscience; 5687), MG132 10 mM (Sigma-Aldrich; C2211), RO-3306 9 mM (Sigma-Aldrich; SML0569), SiR-tubulin 25-50 nM (Spirochrome; SC002), nocodazole 200 ng ml-1 (Sigma-Aldrich; M1404), SiR-DNA 25 nM (Spirochrome; SC007), MLN8237 100nM (Selleckchem; S1133), taxol 15 nM (Sigma-Aldrich; T7402).
Flow Cytometry:Article Title: Targeting immune cells in the aged brain reveals that engineered cytokine IL-10 enhances neurogenesis and improves cognition.
Article Snippet: BV2 cell line Female BV2 microglia cells were a kind gift from Tony Wyss-Coray (Stanford University) and were expanded in DMEM (Gibco, 11965092) supplemented with 10% fetal bovine serum (FBS, Millipore Sigma, F2442) and penicillin-streptomycin-glutamine (Gibco, .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms NIS-Elements software (AR 4.30.02, 64-bit) Nikon https://www.microscope.healthcare. nikon.com/products/software/nis-elements ZEN Blue 3.0 software N/A https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Fiji ImageJ https://imagej.net/software/fiji/downloads FlowJo Tree Star https://www.flowjo.com/ Cell Ranger (version 3.0.2) 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest R (version 4.2.2) R https://www.r-project.org/ GraphPad Prism (version 10.2.0) GraphPad https://www.graphpad.com/features SMART Video Tracking System (Panlab) Harvard Apparatus https://www.harvardapparatus.com/ smart-video-tracking-system.html Motor Monitor Kinder Scientific https://kinderscientific.com/ software/motor-monitor/ BioRender BioRender https://www.biorender.com Other BD FACSAria II Cell Sorter BD Biosciences RRID: SCR_018934 BD Symphony Flow Cytometer BD Biosciences RRDI: SCR_022674 BD LSRII Flow Cytometer BD Biosciences RRID: SCR_002159 CM3050 S Cryostat Leica RRID: SCR_016844 Zeiss LSM 900 confocal microscope Zeiss RRID: SCR_022263 Nikon Eclipse Ti microscope Nikon RRID: SCR_021242 Zyla sCMOS camera Andor RRID: SCR_023610 Enviro-dri® natural brown material Shepherd Specialty Papers N/A ALZET Brain Infusion Kit 3 ALZET Cat# 0008851 ALZET Mini osmotic pump 1007D ALZET Cat# 0000290 Small Animal Stereotaxic Instrument with Digital Display Console Kopf Model 940 Immunity 59, 1–19.e1–e13, February 10, 2026 e4 10378-016). ..
Microscopy:Article Title: Targeting immune cells in the aged brain reveals that engineered cytokine IL-10 enhances neurogenesis and improves cognition.
Article Snippet: BV2 cell line Female BV2 microglia cells were a kind gift from Tony Wyss-Coray (Stanford University) and were expanded in DMEM (Gibco, 11965092) supplemented with 10% fetal bovine serum (FBS, Millipore Sigma, F2442) and penicillin-streptomycin-glutamine (Gibco, .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms NIS-Elements software (AR 4.30.02, 64-bit) Nikon https://www.microscope.healthcare. nikon.com/products/software/nis-elements ZEN Blue 3.0 software N/A https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Fiji ImageJ https://imagej.net/software/fiji/downloads FlowJo Tree Star https://www.flowjo.com/ Cell Ranger (version 3.0.2) 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest R (version 4.2.2) R https://www.r-project.org/ GraphPad Prism (version 10.2.0) GraphPad https://www.graphpad.com/features SMART Video Tracking System (Panlab) Harvard Apparatus https://www.harvardapparatus.com/ smart-video-tracking-system.html Motor Monitor Kinder Scientific https://kinderscientific.com/ software/motor-monitor/ BioRender BioRender https://www.biorender.com Other BD FACSAria II Cell Sorter BD Biosciences RRID: SCR_018934 BD Symphony Flow Cytometer BD Biosciences RRDI: SCR_022674 BD LSRII Flow Cytometer BD Biosciences RRID: SCR_002159 CM3050 S Cryostat Leica RRID: SCR_016844 Zeiss LSM 900 confocal microscope Zeiss RRID: SCR_022263 Nikon Eclipse Ti microscope Nikon RRID: SCR_021242 Zyla sCMOS camera Andor RRID: SCR_023610 Enviro-dri® natural brown material Shepherd Specialty Papers N/A ALZET Brain Infusion Kit 3 ALZET Cat# 0008851 ALZET Mini osmotic pump 1007D ALZET Cat# 0000290 Small Animal Stereotaxic Instrument with Digital Display Console Kopf Model 940 Immunity 59, 1–19.e1–e13, February 10, 2026 e4 10378-016). ..
|
Nikon is a verified supplier 