Review



trpml1 acc 081  (Alomone Labs)


Bioz Verified Symbol Alomone Labs is a verified supplier
Bioz Manufacturer Symbol Alomone Labs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Alomone Labs trpml1 acc 081
    Trpml1 Acc 081, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Anti-TRPML1+(Mucolipin+1)+Antibody/pm42218124-94-48-51
    Average 94 stars, based on 28 article reviews
    trpml1 acc 081 - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: CGRP signaling links tumor-associated pain to immune evasion in oral squamous cell carcinoma
    Article Snippet: Guinea Pig Anti-TRPV1 , Alomone , ACC-029; RRID: AB_2040258.

    Article Title: CGRP signaling links tumor-associated pain to immune evasion in oral squamous cell carcinoma
    Article Snippet: Rabbit Anti-TRPV1 , Alomone , ACC-030; RRID: AB_2313819.

    Virus:

    Article Title: Cav3.1 is a neuronal leucine sensor that mediates satiety and weight loss in response to dietary protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-Cav3.1 (C-terminal) mouse monoclonal abcam Cat# ab134269 anti-Cav3.1 (C-terminal) rabbit polyclonal abcam Cat# ab203577 anti-Cav3.1 (N-terminal) rabbit polyclonal Alomone Cat# ACC-021; RRID: AB_2039779 anti-cFos rabbit monolonal Synaptic Systems Cat# 226 008; RRID: AB_2891278 anti-cFos guinea Pig monolonal Synaptic Systems Cat# 226 308; RRID: AB_2905595 anti-Phospho-S6 Ribosomal Protein (Ser240/244) rabbit polyclonal Cell Signaling Technology Cat# 2215; RRID: AB_331682 anti-Phospho-S6 Ribosomal Protein (Ser240/244) (D68F8) rabbit monoclonal – Alexa Fluor 594 Conjugate Cell Signaling Technology Cat# 9468; RRID: AB_2716873 anti-GFP chicken polyclonal abcam Cat# ab13970; RRID: AB_300798 anti-DsRed mouse monoclonal Takara Bio Cat# 632392; RRID: AB_2801258 anti-POMC rabbit polyclonal Phoenix Pharmaceutical Cat# H-029-30; RRID: AB_2307442 anti-TRPC5 rabbit polyclonal Almone Cat# ACC-020; RRID: AB_2040241 anti-GAPDH mouse monoclonal Santa Cruz Cat# sc-32233; RRID: AB_627679 anti-phospho-p70 S6 Kinase (Thr389) rabbit polyclonal Cell Signaling Technology Cat# 9205; RRID: AB_330944 anti-P70 S6 Kinase rabbit monoclonal Cell Signaling Technology Cat# 2708; RRID: AB_390722 anti-HA mouse monoclonal Cell Signaling Technology Cat# 2367; RRID: AB_10691311 Bacterial and virus strains AAV/DJ-U6-anti-Cacna1g gRNA-CMV-SaCas9 This study; AAV produced by Vector Biolabs N/A AAV/DJ-U6-dual anti-Cacna1g gRNA-hSyn-mCherry This study; AAV produced by Vector Biolabs N/A AAV/DJ-CMV-SaCas9 Vector Biolabs Cat# 7121 AAV/DJ-hSyn-mCherry Vector Biolabs Cat# VB4884 Chemicals, peptides, and recombinant proteins L-Leucine Merck Cat# L8912 aCSF Tocris Cat# 3525 TTA-P2 Almone Cat# T-155 L-Valine Merck Cat# V0513 L-Isoleucine Merck Cat# I7403 Torin 1 Tocris Cat# 4247 SAK3 Tocris Cat# 6239 Recombinant Mouse Leptin R&D Systems Cat# 498-OB Lorcaserin.HCl Generon Cat# M2821 Liraglutide Tocris Cat# 6517 Critical commercial assays RNAscope 2.5 LS Probe Mm-Fos Advanced Cell Diagnostics Cat# 316928 RNAscope 2.5 LS Probe Mm-Trpc5 Advanced Cell Diagnostics Cat# 476248 RNAscope 2.5 LS Probe Mm-Cacna1g-C2 Advanced Cell Diagnostics Cat# 459768-C2 RNAscope 2.5 LS Probe Mm-POMC-C3 Advanced Cell Diagnostics Cat# 314088-C3 Deposited data PhosphoTRAP RNAseq data ArrayExpress E-MTAB-16665 Source Data This paper Data S1 (Continued on next page) ll OPEN ACCESS Article e1 Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines hiPSCs FSPS13B A gift from L. Vallier Lab (University of Cambridge) N/A HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 mHypoE-N46 Cedarlane Labs Cat# CLU138; RRID: CVCL_D459 Experimental models: Organisms/strains C57BL/6J-Tg(Pomc-EGFP)1Low/J Jackson Laboratory Strain# 009593; RRID: IMSR_ JAX:009593 STOCK Tg(Pomc1-cre)16Lowl/J Jackson Laboratory Strain# 005965; RRID: IMSR_ JAX:005965 B6J.129(B6N)Gt(ROSA)26Sortm1(CAGcas9*,-EGFP)Fezh/J Jackson Laboratory Strain# 026175; RRID: IMSR_ JAX:026175 FVB-Tg(Pomc1-hrGFP)1Lowl/J Jackson Laboratory Strain# 006421; RRID: IMSR_ JAX:006421 129S1/SvImJ-Trpc5tm1.1Clph/J Jackson Laboratory Strain# 030804; RRID: IMSR_ JAX:030804 B6(129S4)-Cacna1gtm1Stl/J Jackson Laboratory Strain# 021932; RRID: IMSR_ JAX:021932 Oligonucleotides Actb; FP: GCTCTGGCTCCTAGCACCAT; RP: GCCACCGATCCACACAGAGT; Probe: ATCAAGATCATTGCTCCTCCTGAGCGC This study; synthesized by Merck N/A Ano6; FP: AGGAGCGCATCCCATTTACC; RP: CGATCACAGAGGCGATGATGA; Probe: CTGTGTGCGAGCGCCGTCTTCTTCTG This study; synthesized by Merck N/A Atg9bFP: GAAGGACTCCGCGGTTC; RP: CCAGCTGGAAGACATCCTC; Probe: CAGGCAAAGCCATTCCGCTGATGATAGC This study; synthesized by Merck N/A Atp6v0a2 Thermo Fisher Scientific Mm00441846_g1 Atxn3; FP: CCATAAGTCGCCAGGAAATCG; RP: AACTACCTTGCATACTGAGCTG; Probe: GGAGGATGAAGAAGCTGATCTCCGCA This study; synthesized by Merck N/A Barhl; FP: AATACCTGAGCGTGCAAGAC; RP: TTCCATTTAGTCCTGCGGTTC; Probe: GGAGCTAGCCGCCTCGCTCA This study; synthesized by Merck N/A Cacna1g Thermo Fisher Scientific Mm00486572_m1 Calca Thermo Fisher Scientific Mm004801463_m1 Calcr Thermo Fisher Scientific Mm00432282_m1 Ccdc164 Thermo Fisher Scientific Mm01210710_m1 Cd38; FP: AACCATACCATGTAACAAGACTCTC; RP: TCATATCAGAAGTACTAGGGTCTCC; Probe:TGGAGGACACCCTGCTGGGC This study; synthesized by Merck N/A Cep110; FP: GCTCCGGCAAATGGATAAGATG; RP: GCATTCTGTCCTTGGTTTGGC; Probe: AAAAGTCCACGAGTGGCGCTTTCAG This study; synthesized by Merck N/A Chrm1; FP: CCTCCCCTATCCACCTTCAGC; RP: GGCATCACCTTGGCATCCAG; Probe: AGGCTGCTGGCCAGATGGACA This study; synthesized by Merck N/A Cln6 Thermo Fisher Scientific Mm01179411_m1 Coch Thermo Fisher Scientific Mm0000483360_m1 Creb3l1; FP: CTCACTGCCCCTCACAAACT; RP: CCTTCTCCTCAGCCTTGGTG; Probe: CATCAGGGCCACTGCTCTTGACAGAAG This study; synthesized by Merck N/A (Continued on next page) ll OPEN ACCESSArticle Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 e2

    Bioprocessing:

    Article Title: Cav3.1 is a neuronal leucine sensor that mediates satiety and weight loss in response to dietary protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-Cav3.1 (C-terminal) mouse monoclonal abcam Cat# ab134269 anti-Cav3.1 (C-terminal) rabbit polyclonal abcam Cat# ab203577 anti-Cav3.1 (N-terminal) rabbit polyclonal Alomone Cat# ACC-021; RRID: AB_2039779 anti-cFos rabbit monolonal Synaptic Systems Cat# 226 008; RRID: AB_2891278 anti-cFos guinea Pig monolonal Synaptic Systems Cat# 226 308; RRID: AB_2905595 anti-Phospho-S6 Ribosomal Protein (Ser240/244) rabbit polyclonal Cell Signaling Technology Cat# 2215; RRID: AB_331682 anti-Phospho-S6 Ribosomal Protein (Ser240/244) (D68F8) rabbit monoclonal – Alexa Fluor 594 Conjugate Cell Signaling Technology Cat# 9468; RRID: AB_2716873 anti-GFP chicken polyclonal abcam Cat# ab13970; RRID: AB_300798 anti-DsRed mouse monoclonal Takara Bio Cat# 632392; RRID: AB_2801258 anti-POMC rabbit polyclonal Phoenix Pharmaceutical Cat# H-029-30; RRID: AB_2307442 anti-TRPC5 rabbit polyclonal Almone Cat# ACC-020; RRID: AB_2040241 anti-GAPDH mouse monoclonal Santa Cruz Cat# sc-32233; RRID: AB_627679 anti-phospho-p70 S6 Kinase (Thr389) rabbit polyclonal Cell Signaling Technology Cat# 9205; RRID: AB_330944 anti-P70 S6 Kinase rabbit monoclonal Cell Signaling Technology Cat# 2708; RRID: AB_390722 anti-HA mouse monoclonal Cell Signaling Technology Cat# 2367; RRID: AB_10691311 Bacterial and virus strains AAV/DJ-U6-anti-Cacna1g gRNA-CMV-SaCas9 This study; AAV produced by Vector Biolabs N/A AAV/DJ-U6-dual anti-Cacna1g gRNA-hSyn-mCherry This study; AAV produced by Vector Biolabs N/A AAV/DJ-CMV-SaCas9 Vector Biolabs Cat# 7121 AAV/DJ-hSyn-mCherry Vector Biolabs Cat# VB4884 Chemicals, peptides, and recombinant proteins L-Leucine Merck Cat# L8912 aCSF Tocris Cat# 3525 TTA-P2 Almone Cat# T-155 L-Valine Merck Cat# V0513 L-Isoleucine Merck Cat# I7403 Torin 1 Tocris Cat# 4247 SAK3 Tocris Cat# 6239 Recombinant Mouse Leptin R&D Systems Cat# 498-OB Lorcaserin.HCl Generon Cat# M2821 Liraglutide Tocris Cat# 6517 Critical commercial assays RNAscope 2.5 LS Probe Mm-Fos Advanced Cell Diagnostics Cat# 316928 RNAscope 2.5 LS Probe Mm-Trpc5 Advanced Cell Diagnostics Cat# 476248 RNAscope 2.5 LS Probe Mm-Cacna1g-C2 Advanced Cell Diagnostics Cat# 459768-C2 RNAscope 2.5 LS Probe Mm-POMC-C3 Advanced Cell Diagnostics Cat# 314088-C3 Deposited data PhosphoTRAP RNAseq data ArrayExpress E-MTAB-16665 Source Data This paper Data S1 (Continued on next page) ll OPEN ACCESS Article e1 Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines hiPSCs FSPS13B A gift from L. Vallier Lab (University of Cambridge) N/A HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 mHypoE-N46 Cedarlane Labs Cat# CLU138; RRID: CVCL_D459 Experimental models: Organisms/strains C57BL/6J-Tg(Pomc-EGFP)1Low/J Jackson Laboratory Strain# 009593; RRID: IMSR_ JAX:009593 STOCK Tg(Pomc1-cre)16Lowl/J Jackson Laboratory Strain# 005965; RRID: IMSR_ JAX:005965 B6J.129(B6N)Gt(ROSA)26Sortm1(CAGcas9*,-EGFP)Fezh/J Jackson Laboratory Strain# 026175; RRID: IMSR_ JAX:026175 FVB-Tg(Pomc1-hrGFP)1Lowl/J Jackson Laboratory Strain# 006421; RRID: IMSR_ JAX:006421 129S1/SvImJ-Trpc5tm1.1Clph/J Jackson Laboratory Strain# 030804; RRID: IMSR_ JAX:030804 B6(129S4)-Cacna1gtm1Stl/J Jackson Laboratory Strain# 021932; RRID: IMSR_ JAX:021932 Oligonucleotides Actb; FP: GCTCTGGCTCCTAGCACCAT; RP: GCCACCGATCCACACAGAGT; Probe: ATCAAGATCATTGCTCCTCCTGAGCGC This study; synthesized by Merck N/A Ano6; FP: AGGAGCGCATCCCATTTACC; RP: CGATCACAGAGGCGATGATGA; Probe: CTGTGTGCGAGCGCCGTCTTCTTCTG This study; synthesized by Merck N/A Atg9bFP: GAAGGACTCCGCGGTTC; RP: CCAGCTGGAAGACATCCTC; Probe: CAGGCAAAGCCATTCCGCTGATGATAGC This study; synthesized by Merck N/A Atp6v0a2 Thermo Fisher Scientific Mm00441846_g1 Atxn3; FP: CCATAAGTCGCCAGGAAATCG; RP: AACTACCTTGCATACTGAGCTG; Probe: GGAGGATGAAGAAGCTGATCTCCGCA This study; synthesized by Merck N/A Barhl; FP: AATACCTGAGCGTGCAAGAC; RP: TTCCATTTAGTCCTGCGGTTC; Probe: GGAGCTAGCCGCCTCGCTCA This study; synthesized by Merck N/A Cacna1g Thermo Fisher Scientific Mm00486572_m1 Calca Thermo Fisher Scientific Mm004801463_m1 Calcr Thermo Fisher Scientific Mm00432282_m1 Ccdc164 Thermo Fisher Scientific Mm01210710_m1 Cd38; FP: AACCATACCATGTAACAAGACTCTC; RP: TCATATCAGAAGTACTAGGGTCTCC; Probe:TGGAGGACACCCTGCTGGGC This study; synthesized by Merck N/A Cep110; FP: GCTCCGGCAAATGGATAAGATG; RP: GCATTCTGTCCTTGGTTTGGC; Probe: AAAAGTCCACGAGTGGCGCTTTCAG This study; synthesized by Merck N/A Chrm1; FP: CCTCCCCTATCCACCTTCAGC; RP: GGCATCACCTTGGCATCCAG; Probe: AGGCTGCTGGCCAGATGGACA This study; synthesized by Merck N/A Cln6 Thermo Fisher Scientific Mm01179411_m1 Coch Thermo Fisher Scientific Mm0000483360_m1 Creb3l1; FP: CTCACTGCCCCTCACAAACT; RP: CCTTCTCCTCAGCCTTGGTG; Probe: CATCAGGGCCACTGCTCTTGACAGAAG This study; synthesized by Merck N/A (Continued on next page) ll OPEN ACCESSArticle Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 e2

    Produced:

    Article Title: Cav3.1 is a neuronal leucine sensor that mediates satiety and weight loss in response to dietary protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-Cav3.1 (C-terminal) mouse monoclonal abcam Cat# ab134269 anti-Cav3.1 (C-terminal) rabbit polyclonal abcam Cat# ab203577 anti-Cav3.1 (N-terminal) rabbit polyclonal Alomone Cat# ACC-021; RRID: AB_2039779 anti-cFos rabbit monolonal Synaptic Systems Cat# 226 008; RRID: AB_2891278 anti-cFos guinea Pig monolonal Synaptic Systems Cat# 226 308; RRID: AB_2905595 anti-Phospho-S6 Ribosomal Protein (Ser240/244) rabbit polyclonal Cell Signaling Technology Cat# 2215; RRID: AB_331682 anti-Phospho-S6 Ribosomal Protein (Ser240/244) (D68F8) rabbit monoclonal – Alexa Fluor 594 Conjugate Cell Signaling Technology Cat# 9468; RRID: AB_2716873 anti-GFP chicken polyclonal abcam Cat# ab13970; RRID: AB_300798 anti-DsRed mouse monoclonal Takara Bio Cat# 632392; RRID: AB_2801258 anti-POMC rabbit polyclonal Phoenix Pharmaceutical Cat# H-029-30; RRID: AB_2307442 anti-TRPC5 rabbit polyclonal Almone Cat# ACC-020; RRID: AB_2040241 anti-GAPDH mouse monoclonal Santa Cruz Cat# sc-32233; RRID: AB_627679 anti-phospho-p70 S6 Kinase (Thr389) rabbit polyclonal Cell Signaling Technology Cat# 9205; RRID: AB_330944 anti-P70 S6 Kinase rabbit monoclonal Cell Signaling Technology Cat# 2708; RRID: AB_390722 anti-HA mouse monoclonal Cell Signaling Technology Cat# 2367; RRID: AB_10691311 Bacterial and virus strains AAV/DJ-U6-anti-Cacna1g gRNA-CMV-SaCas9 This study; AAV produced by Vector Biolabs N/A AAV/DJ-U6-dual anti-Cacna1g gRNA-hSyn-mCherry This study; AAV produced by Vector Biolabs N/A AAV/DJ-CMV-SaCas9 Vector Biolabs Cat# 7121 AAV/DJ-hSyn-mCherry Vector Biolabs Cat# VB4884 Chemicals, peptides, and recombinant proteins L-Leucine Merck Cat# L8912 aCSF Tocris Cat# 3525 TTA-P2 Almone Cat# T-155 L-Valine Merck Cat# V0513 L-Isoleucine Merck Cat# I7403 Torin 1 Tocris Cat# 4247 SAK3 Tocris Cat# 6239 Recombinant Mouse Leptin R&D Systems Cat# 498-OB Lorcaserin.HCl Generon Cat# M2821 Liraglutide Tocris Cat# 6517 Critical commercial assays RNAscope 2.5 LS Probe Mm-Fos Advanced Cell Diagnostics Cat# 316928 RNAscope 2.5 LS Probe Mm-Trpc5 Advanced Cell Diagnostics Cat# 476248 RNAscope 2.5 LS Probe Mm-Cacna1g-C2 Advanced Cell Diagnostics Cat# 459768-C2 RNAscope 2.5 LS Probe Mm-POMC-C3 Advanced Cell Diagnostics Cat# 314088-C3 Deposited data PhosphoTRAP RNAseq data ArrayExpress E-MTAB-16665 Source Data This paper Data S1 (Continued on next page) ll OPEN ACCESS Article e1 Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines hiPSCs FSPS13B A gift from L. Vallier Lab (University of Cambridge) N/A HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 mHypoE-N46 Cedarlane Labs Cat# CLU138; RRID: CVCL_D459 Experimental models: Organisms/strains C57BL/6J-Tg(Pomc-EGFP)1Low/J Jackson Laboratory Strain# 009593; RRID: IMSR_ JAX:009593 STOCK Tg(Pomc1-cre)16Lowl/J Jackson Laboratory Strain# 005965; RRID: IMSR_ JAX:005965 B6J.129(B6N)Gt(ROSA)26Sortm1(CAGcas9*,-EGFP)Fezh/J Jackson Laboratory Strain# 026175; RRID: IMSR_ JAX:026175 FVB-Tg(Pomc1-hrGFP)1Lowl/J Jackson Laboratory Strain# 006421; RRID: IMSR_ JAX:006421 129S1/SvImJ-Trpc5tm1.1Clph/J Jackson Laboratory Strain# 030804; RRID: IMSR_ JAX:030804 B6(129S4)-Cacna1gtm1Stl/J Jackson Laboratory Strain# 021932; RRID: IMSR_ JAX:021932 Oligonucleotides Actb; FP: GCTCTGGCTCCTAGCACCAT; RP: GCCACCGATCCACACAGAGT; Probe: ATCAAGATCATTGCTCCTCCTGAGCGC This study; synthesized by Merck N/A Ano6; FP: AGGAGCGCATCCCATTTACC; RP: CGATCACAGAGGCGATGATGA; Probe: CTGTGTGCGAGCGCCGTCTTCTTCTG This study; synthesized by Merck N/A Atg9bFP: GAAGGACTCCGCGGTTC; RP: CCAGCTGGAAGACATCCTC; Probe: CAGGCAAAGCCATTCCGCTGATGATAGC This study; synthesized by Merck N/A Atp6v0a2 Thermo Fisher Scientific Mm00441846_g1 Atxn3; FP: CCATAAGTCGCCAGGAAATCG; RP: AACTACCTTGCATACTGAGCTG; Probe: GGAGGATGAAGAAGCTGATCTCCGCA This study; synthesized by Merck N/A Barhl; FP: AATACCTGAGCGTGCAAGAC; RP: TTCCATTTAGTCCTGCGGTTC; Probe: GGAGCTAGCCGCCTCGCTCA This study; synthesized by Merck N/A Cacna1g Thermo Fisher Scientific Mm00486572_m1 Calca Thermo Fisher Scientific Mm004801463_m1 Calcr Thermo Fisher Scientific Mm00432282_m1 Ccdc164 Thermo Fisher Scientific Mm01210710_m1 Cd38; FP: AACCATACCATGTAACAAGACTCTC; RP: TCATATCAGAAGTACTAGGGTCTCC; Probe:TGGAGGACACCCTGCTGGGC This study; synthesized by Merck N/A Cep110; FP: GCTCCGGCAAATGGATAAGATG; RP: GCATTCTGTCCTTGGTTTGGC; Probe: AAAAGTCCACGAGTGGCGCTTTCAG This study; synthesized by Merck N/A Chrm1; FP: CCTCCCCTATCCACCTTCAGC; RP: GGCATCACCTTGGCATCCAG; Probe: AGGCTGCTGGCCAGATGGACA This study; synthesized by Merck N/A Cln6 Thermo Fisher Scientific Mm01179411_m1 Coch Thermo Fisher Scientific Mm0000483360_m1 Creb3l1; FP: CTCACTGCCCCTCACAAACT; RP: CCTTCTCCTCAGCCTTGGTG; Probe: CATCAGGGCCACTGCTCTTGACAGAAG This study; synthesized by Merck N/A (Continued on next page) ll OPEN ACCESSArticle Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 e2

    Recombinant:

    Article Title: Cav3.1 is a neuronal leucine sensor that mediates satiety and weight loss in response to dietary protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-Cav3.1 (C-terminal) mouse monoclonal abcam Cat# ab134269 anti-Cav3.1 (C-terminal) rabbit polyclonal abcam Cat# ab203577 anti-Cav3.1 (N-terminal) rabbit polyclonal Alomone Cat# ACC-021; RRID: AB_2039779 anti-cFos rabbit monolonal Synaptic Systems Cat# 226 008; RRID: AB_2891278 anti-cFos guinea Pig monolonal Synaptic Systems Cat# 226 308; RRID: AB_2905595 anti-Phospho-S6 Ribosomal Protein (Ser240/244) rabbit polyclonal Cell Signaling Technology Cat# 2215; RRID: AB_331682 anti-Phospho-S6 Ribosomal Protein (Ser240/244) (D68F8) rabbit monoclonal – Alexa Fluor 594 Conjugate Cell Signaling Technology Cat# 9468; RRID: AB_2716873 anti-GFP chicken polyclonal abcam Cat# ab13970; RRID: AB_300798 anti-DsRed mouse monoclonal Takara Bio Cat# 632392; RRID: AB_2801258 anti-POMC rabbit polyclonal Phoenix Pharmaceutical Cat# H-029-30; RRID: AB_2307442 anti-TRPC5 rabbit polyclonal Almone Cat# ACC-020; RRID: AB_2040241 anti-GAPDH mouse monoclonal Santa Cruz Cat# sc-32233; RRID: AB_627679 anti-phospho-p70 S6 Kinase (Thr389) rabbit polyclonal Cell Signaling Technology Cat# 9205; RRID: AB_330944 anti-P70 S6 Kinase rabbit monoclonal Cell Signaling Technology Cat# 2708; RRID: AB_390722 anti-HA mouse monoclonal Cell Signaling Technology Cat# 2367; RRID: AB_10691311 Bacterial and virus strains AAV/DJ-U6-anti-Cacna1g gRNA-CMV-SaCas9 This study; AAV produced by Vector Biolabs N/A AAV/DJ-U6-dual anti-Cacna1g gRNA-hSyn-mCherry This study; AAV produced by Vector Biolabs N/A AAV/DJ-CMV-SaCas9 Vector Biolabs Cat# 7121 AAV/DJ-hSyn-mCherry Vector Biolabs Cat# VB4884 Chemicals, peptides, and recombinant proteins L-Leucine Merck Cat# L8912 aCSF Tocris Cat# 3525 TTA-P2 Almone Cat# T-155 L-Valine Merck Cat# V0513 L-Isoleucine Merck Cat# I7403 Torin 1 Tocris Cat# 4247 SAK3 Tocris Cat# 6239 Recombinant Mouse Leptin R&D Systems Cat# 498-OB Lorcaserin.HCl Generon Cat# M2821 Liraglutide Tocris Cat# 6517 Critical commercial assays RNAscope 2.5 LS Probe Mm-Fos Advanced Cell Diagnostics Cat# 316928 RNAscope 2.5 LS Probe Mm-Trpc5 Advanced Cell Diagnostics Cat# 476248 RNAscope 2.5 LS Probe Mm-Cacna1g-C2 Advanced Cell Diagnostics Cat# 459768-C2 RNAscope 2.5 LS Probe Mm-POMC-C3 Advanced Cell Diagnostics Cat# 314088-C3 Deposited data PhosphoTRAP RNAseq data ArrayExpress E-MTAB-16665 Source Data This paper Data S1 (Continued on next page) ll OPEN ACCESS Article e1 Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines hiPSCs FSPS13B A gift from L. Vallier Lab (University of Cambridge) N/A HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 mHypoE-N46 Cedarlane Labs Cat# CLU138; RRID: CVCL_D459 Experimental models: Organisms/strains C57BL/6J-Tg(Pomc-EGFP)1Low/J Jackson Laboratory Strain# 009593; RRID: IMSR_ JAX:009593 STOCK Tg(Pomc1-cre)16Lowl/J Jackson Laboratory Strain# 005965; RRID: IMSR_ JAX:005965 B6J.129(B6N)Gt(ROSA)26Sortm1(CAGcas9*,-EGFP)Fezh/J Jackson Laboratory Strain# 026175; RRID: IMSR_ JAX:026175 FVB-Tg(Pomc1-hrGFP)1Lowl/J Jackson Laboratory Strain# 006421; RRID: IMSR_ JAX:006421 129S1/SvImJ-Trpc5tm1.1Clph/J Jackson Laboratory Strain# 030804; RRID: IMSR_ JAX:030804 B6(129S4)-Cacna1gtm1Stl/J Jackson Laboratory Strain# 021932; RRID: IMSR_ JAX:021932 Oligonucleotides Actb; FP: GCTCTGGCTCCTAGCACCAT; RP: GCCACCGATCCACACAGAGT; Probe: ATCAAGATCATTGCTCCTCCTGAGCGC This study; synthesized by Merck N/A Ano6; FP: AGGAGCGCATCCCATTTACC; RP: CGATCACAGAGGCGATGATGA; Probe: CTGTGTGCGAGCGCCGTCTTCTTCTG This study; synthesized by Merck N/A Atg9bFP: GAAGGACTCCGCGGTTC; RP: CCAGCTGGAAGACATCCTC; Probe: CAGGCAAAGCCATTCCGCTGATGATAGC This study; synthesized by Merck N/A Atp6v0a2 Thermo Fisher Scientific Mm00441846_g1 Atxn3; FP: CCATAAGTCGCCAGGAAATCG; RP: AACTACCTTGCATACTGAGCTG; Probe: GGAGGATGAAGAAGCTGATCTCCGCA This study; synthesized by Merck N/A Barhl; FP: AATACCTGAGCGTGCAAGAC; RP: TTCCATTTAGTCCTGCGGTTC; Probe: GGAGCTAGCCGCCTCGCTCA This study; synthesized by Merck N/A Cacna1g Thermo Fisher Scientific Mm00486572_m1 Calca Thermo Fisher Scientific Mm004801463_m1 Calcr Thermo Fisher Scientific Mm00432282_m1 Ccdc164 Thermo Fisher Scientific Mm01210710_m1 Cd38; FP: AACCATACCATGTAACAAGACTCTC; RP: TCATATCAGAAGTACTAGGGTCTCC; Probe:TGGAGGACACCCTGCTGGGC This study; synthesized by Merck N/A Cep110; FP: GCTCCGGCAAATGGATAAGATG; RP: GCATTCTGTCCTTGGTTTGGC; Probe: AAAAGTCCACGAGTGGCGCTTTCAG This study; synthesized by Merck N/A Chrm1; FP: CCTCCCCTATCCACCTTCAGC; RP: GGCATCACCTTGGCATCCAG; Probe: AGGCTGCTGGCCAGATGGACA This study; synthesized by Merck N/A Cln6 Thermo Fisher Scientific Mm01179411_m1 Coch Thermo Fisher Scientific Mm0000483360_m1 Creb3l1; FP: CTCACTGCCCCTCACAAACT; RP: CCTTCTCCTCAGCCTTGGTG; Probe: CATCAGGGCCACTGCTCTTGACAGAAG This study; synthesized by Merck N/A (Continued on next page) ll OPEN ACCESSArticle Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 e2

    RNAscope:

    Article Title: Cav3.1 is a neuronal leucine sensor that mediates satiety and weight loss in response to dietary protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-Cav3.1 (C-terminal) mouse monoclonal abcam Cat# ab134269 anti-Cav3.1 (C-terminal) rabbit polyclonal abcam Cat# ab203577 anti-Cav3.1 (N-terminal) rabbit polyclonal Alomone Cat# ACC-021; RRID: AB_2039779 anti-cFos rabbit monolonal Synaptic Systems Cat# 226 008; RRID: AB_2891278 anti-cFos guinea Pig monolonal Synaptic Systems Cat# 226 308; RRID: AB_2905595 anti-Phospho-S6 Ribosomal Protein (Ser240/244) rabbit polyclonal Cell Signaling Technology Cat# 2215; RRID: AB_331682 anti-Phospho-S6 Ribosomal Protein (Ser240/244) (D68F8) rabbit monoclonal – Alexa Fluor 594 Conjugate Cell Signaling Technology Cat# 9468; RRID: AB_2716873 anti-GFP chicken polyclonal abcam Cat# ab13970; RRID: AB_300798 anti-DsRed mouse monoclonal Takara Bio Cat# 632392; RRID: AB_2801258 anti-POMC rabbit polyclonal Phoenix Pharmaceutical Cat# H-029-30; RRID: AB_2307442 anti-TRPC5 rabbit polyclonal Almone Cat# ACC-020; RRID: AB_2040241 anti-GAPDH mouse monoclonal Santa Cruz Cat# sc-32233; RRID: AB_627679 anti-phospho-p70 S6 Kinase (Thr389) rabbit polyclonal Cell Signaling Technology Cat# 9205; RRID: AB_330944 anti-P70 S6 Kinase rabbit monoclonal Cell Signaling Technology Cat# 2708; RRID: AB_390722 anti-HA mouse monoclonal Cell Signaling Technology Cat# 2367; RRID: AB_10691311 Bacterial and virus strains AAV/DJ-U6-anti-Cacna1g gRNA-CMV-SaCas9 This study; AAV produced by Vector Biolabs N/A AAV/DJ-U6-dual anti-Cacna1g gRNA-hSyn-mCherry This study; AAV produced by Vector Biolabs N/A AAV/DJ-CMV-SaCas9 Vector Biolabs Cat# 7121 AAV/DJ-hSyn-mCherry Vector Biolabs Cat# VB4884 Chemicals, peptides, and recombinant proteins L-Leucine Merck Cat# L8912 aCSF Tocris Cat# 3525 TTA-P2 Almone Cat# T-155 L-Valine Merck Cat# V0513 L-Isoleucine Merck Cat# I7403 Torin 1 Tocris Cat# 4247 SAK3 Tocris Cat# 6239 Recombinant Mouse Leptin R&D Systems Cat# 498-OB Lorcaserin.HCl Generon Cat# M2821 Liraglutide Tocris Cat# 6517 Critical commercial assays RNAscope 2.5 LS Probe Mm-Fos Advanced Cell Diagnostics Cat# 316928 RNAscope 2.5 LS Probe Mm-Trpc5 Advanced Cell Diagnostics Cat# 476248 RNAscope 2.5 LS Probe Mm-Cacna1g-C2 Advanced Cell Diagnostics Cat# 459768-C2 RNAscope 2.5 LS Probe Mm-POMC-C3 Advanced Cell Diagnostics Cat# 314088-C3 Deposited data PhosphoTRAP RNAseq data ArrayExpress E-MTAB-16665 Source Data This paper Data S1 (Continued on next page) ll OPEN ACCESS Article e1 Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines hiPSCs FSPS13B A gift from L. Vallier Lab (University of Cambridge) N/A HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 mHypoE-N46 Cedarlane Labs Cat# CLU138; RRID: CVCL_D459 Experimental models: Organisms/strains C57BL/6J-Tg(Pomc-EGFP)1Low/J Jackson Laboratory Strain# 009593; RRID: IMSR_ JAX:009593 STOCK Tg(Pomc1-cre)16Lowl/J Jackson Laboratory Strain# 005965; RRID: IMSR_ JAX:005965 B6J.129(B6N)Gt(ROSA)26Sortm1(CAGcas9*,-EGFP)Fezh/J Jackson Laboratory Strain# 026175; RRID: IMSR_ JAX:026175 FVB-Tg(Pomc1-hrGFP)1Lowl/J Jackson Laboratory Strain# 006421; RRID: IMSR_ JAX:006421 129S1/SvImJ-Trpc5tm1.1Clph/J Jackson Laboratory Strain# 030804; RRID: IMSR_ JAX:030804 B6(129S4)-Cacna1gtm1Stl/J Jackson Laboratory Strain# 021932; RRID: IMSR_ JAX:021932 Oligonucleotides Actb; FP: GCTCTGGCTCCTAGCACCAT; RP: GCCACCGATCCACACAGAGT; Probe: ATCAAGATCATTGCTCCTCCTGAGCGC This study; synthesized by Merck N/A Ano6; FP: AGGAGCGCATCCCATTTACC; RP: CGATCACAGAGGCGATGATGA; Probe: CTGTGTGCGAGCGCCGTCTTCTTCTG This study; synthesized by Merck N/A Atg9bFP: GAAGGACTCCGCGGTTC; RP: CCAGCTGGAAGACATCCTC; Probe: CAGGCAAAGCCATTCCGCTGATGATAGC This study; synthesized by Merck N/A Atp6v0a2 Thermo Fisher Scientific Mm00441846_g1 Atxn3; FP: CCATAAGTCGCCAGGAAATCG; RP: AACTACCTTGCATACTGAGCTG; Probe: GGAGGATGAAGAAGCTGATCTCCGCA This study; synthesized by Merck N/A Barhl; FP: AATACCTGAGCGTGCAAGAC; RP: TTCCATTTAGTCCTGCGGTTC; Probe: GGAGCTAGCCGCCTCGCTCA This study; synthesized by Merck N/A Cacna1g Thermo Fisher Scientific Mm00486572_m1 Calca Thermo Fisher Scientific Mm004801463_m1 Calcr Thermo Fisher Scientific Mm00432282_m1 Ccdc164 Thermo Fisher Scientific Mm01210710_m1 Cd38; FP: AACCATACCATGTAACAAGACTCTC; RP: TCATATCAGAAGTACTAGGGTCTCC; Probe:TGGAGGACACCCTGCTGGGC This study; synthesized by Merck N/A Cep110; FP: GCTCCGGCAAATGGATAAGATG; RP: GCATTCTGTCCTTGGTTTGGC; Probe: AAAAGTCCACGAGTGGCGCTTTCAG This study; synthesized by Merck N/A Chrm1; FP: CCTCCCCTATCCACCTTCAGC; RP: GGCATCACCTTGGCATCCAG; Probe: AGGCTGCTGGCCAGATGGACA This study; synthesized by Merck N/A Cln6 Thermo Fisher Scientific Mm01179411_m1 Coch Thermo Fisher Scientific Mm0000483360_m1 Creb3l1; FP: CTCACTGCCCCTCACAAACT; RP: CCTTCTCCTCAGCCTTGGTG; Probe: CATCAGGGCCACTGCTCTTGACAGAAG This study; synthesized by Merck N/A (Continued on next page) ll OPEN ACCESSArticle Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 e2

    RNA sequencing:

    Article Title: Cav3.1 is a neuronal leucine sensor that mediates satiety and weight loss in response to dietary protein.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-Cav3.1 (C-terminal) mouse monoclonal abcam Cat# ab134269 anti-Cav3.1 (C-terminal) rabbit polyclonal abcam Cat# ab203577 anti-Cav3.1 (N-terminal) rabbit polyclonal Alomone Cat# ACC-021; RRID: AB_2039779 anti-cFos rabbit monolonal Synaptic Systems Cat# 226 008; RRID: AB_2891278 anti-cFos guinea Pig monolonal Synaptic Systems Cat# 226 308; RRID: AB_2905595 anti-Phospho-S6 Ribosomal Protein (Ser240/244) rabbit polyclonal Cell Signaling Technology Cat# 2215; RRID: AB_331682 anti-Phospho-S6 Ribosomal Protein (Ser240/244) (D68F8) rabbit monoclonal – Alexa Fluor 594 Conjugate Cell Signaling Technology Cat# 9468; RRID: AB_2716873 anti-GFP chicken polyclonal abcam Cat# ab13970; RRID: AB_300798 anti-DsRed mouse monoclonal Takara Bio Cat# 632392; RRID: AB_2801258 anti-POMC rabbit polyclonal Phoenix Pharmaceutical Cat# H-029-30; RRID: AB_2307442 anti-TRPC5 rabbit polyclonal Almone Cat# ACC-020; RRID: AB_2040241 anti-GAPDH mouse monoclonal Santa Cruz Cat# sc-32233; RRID: AB_627679 anti-phospho-p70 S6 Kinase (Thr389) rabbit polyclonal Cell Signaling Technology Cat# 9205; RRID: AB_330944 anti-P70 S6 Kinase rabbit monoclonal Cell Signaling Technology Cat# 2708; RRID: AB_390722 anti-HA mouse monoclonal Cell Signaling Technology Cat# 2367; RRID: AB_10691311 Bacterial and virus strains AAV/DJ-U6-anti-Cacna1g gRNA-CMV-SaCas9 This study; AAV produced by Vector Biolabs N/A AAV/DJ-U6-dual anti-Cacna1g gRNA-hSyn-mCherry This study; AAV produced by Vector Biolabs N/A AAV/DJ-CMV-SaCas9 Vector Biolabs Cat# 7121 AAV/DJ-hSyn-mCherry Vector Biolabs Cat# VB4884 Chemicals, peptides, and recombinant proteins L-Leucine Merck Cat# L8912 aCSF Tocris Cat# 3525 TTA-P2 Almone Cat# T-155 L-Valine Merck Cat# V0513 L-Isoleucine Merck Cat# I7403 Torin 1 Tocris Cat# 4247 SAK3 Tocris Cat# 6239 Recombinant Mouse Leptin R&D Systems Cat# 498-OB Lorcaserin.HCl Generon Cat# M2821 Liraglutide Tocris Cat# 6517 Critical commercial assays RNAscope 2.5 LS Probe Mm-Fos Advanced Cell Diagnostics Cat# 316928 RNAscope 2.5 LS Probe Mm-Trpc5 Advanced Cell Diagnostics Cat# 476248 RNAscope 2.5 LS Probe Mm-Cacna1g-C2 Advanced Cell Diagnostics Cat# 459768-C2 RNAscope 2.5 LS Probe Mm-POMC-C3 Advanced Cell Diagnostics Cat# 314088-C3 Deposited data PhosphoTRAP RNAseq data ArrayExpress E-MTAB-16665 Source Data This paper Data S1 (Continued on next page) ll OPEN ACCESS Article e1 Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines hiPSCs FSPS13B A gift from L. Vallier Lab (University of Cambridge) N/A HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 mHypoE-N46 Cedarlane Labs Cat# CLU138; RRID: CVCL_D459 Experimental models: Organisms/strains C57BL/6J-Tg(Pomc-EGFP)1Low/J Jackson Laboratory Strain# 009593; RRID: IMSR_ JAX:009593 STOCK Tg(Pomc1-cre)16Lowl/J Jackson Laboratory Strain# 005965; RRID: IMSR_ JAX:005965 B6J.129(B6N)Gt(ROSA)26Sortm1(CAGcas9*,-EGFP)Fezh/J Jackson Laboratory Strain# 026175; RRID: IMSR_ JAX:026175 FVB-Tg(Pomc1-hrGFP)1Lowl/J Jackson Laboratory Strain# 006421; RRID: IMSR_ JAX:006421 129S1/SvImJ-Trpc5tm1.1Clph/J Jackson Laboratory Strain# 030804; RRID: IMSR_ JAX:030804 B6(129S4)-Cacna1gtm1Stl/J Jackson Laboratory Strain# 021932; RRID: IMSR_ JAX:021932 Oligonucleotides Actb; FP: GCTCTGGCTCCTAGCACCAT; RP: GCCACCGATCCACACAGAGT; Probe: ATCAAGATCATTGCTCCTCCTGAGCGC This study; synthesized by Merck N/A Ano6; FP: AGGAGCGCATCCCATTTACC; RP: CGATCACAGAGGCGATGATGA; Probe: CTGTGTGCGAGCGCCGTCTTCTTCTG This study; synthesized by Merck N/A Atg9bFP: GAAGGACTCCGCGGTTC; RP: CCAGCTGGAAGACATCCTC; Probe: CAGGCAAAGCCATTCCGCTGATGATAGC This study; synthesized by Merck N/A Atp6v0a2 Thermo Fisher Scientific Mm00441846_g1 Atxn3; FP: CCATAAGTCGCCAGGAAATCG; RP: AACTACCTTGCATACTGAGCTG; Probe: GGAGGATGAAGAAGCTGATCTCCGCA This study; synthesized by Merck N/A Barhl; FP: AATACCTGAGCGTGCAAGAC; RP: TTCCATTTAGTCCTGCGGTTC; Probe: GGAGCTAGCCGCCTCGCTCA This study; synthesized by Merck N/A Cacna1g Thermo Fisher Scientific Mm00486572_m1 Calca Thermo Fisher Scientific Mm004801463_m1 Calcr Thermo Fisher Scientific Mm00432282_m1 Ccdc164 Thermo Fisher Scientific Mm01210710_m1 Cd38; FP: AACCATACCATGTAACAAGACTCTC; RP: TCATATCAGAAGTACTAGGGTCTCC; Probe:TGGAGGACACCCTGCTGGGC This study; synthesized by Merck N/A Cep110; FP: GCTCCGGCAAATGGATAAGATG; RP: GCATTCTGTCCTTGGTTTGGC; Probe: AAAAGTCCACGAGTGGCGCTTTCAG This study; synthesized by Merck N/A Chrm1; FP: CCTCCCCTATCCACCTTCAGC; RP: GGCATCACCTTGGCATCCAG; Probe: AGGCTGCTGGCCAGATGGACA This study; synthesized by Merck N/A Cln6 Thermo Fisher Scientific Mm01179411_m1 Coch Thermo Fisher Scientific Mm0000483360_m1 Creb3l1; FP: CTCACTGCCCCTCACAAACT; RP: CCTTCTCCTCAGCCTTGGTG; Probe: CATCAGGGCCACTGCTCTTGACAGAAG This study; synthesized by Merck N/A (Continued on next page) ll OPEN ACCESSArticle Cell Metabolism 38, 1–15.e1–e13, May 5, 2026 e2

    Blocking Assay:

    Article Title: Persistent in vitro nociceptor hyperexcitability and axonal retraction produced by repeated paclitaxel doses.
    Article Snippet: After three washes with DPBS, cells were permeabilized using 0.1% Triton X-100 (Sigma-Aldrich) for 5min and then blocked with 5% normal goat serum (NGS, Sigma-Aldrich) for 1 h at approximately 22 °C. .. Following blocking, cells were incubated overnight at 4 °C in DPBS solution with 5% NGS containing primary antibodies against the following targets: NeuN (neuron-specific protein) using a mouse monoclonal antibody at a 1 : 50 dilution (Cat# MAB377C3; Millipore); TRPV1 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-029; Alomone Labs, Jerusalem, Israel); TRPA1 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-037; Alomone Labs); TRPM8 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-049; Alomone Labs). ..

    Incubation:

    Article Title: Persistent in vitro nociceptor hyperexcitability and axonal retraction produced by repeated paclitaxel doses.
    Article Snippet: After three washes with DPBS, cells were permeabilized using 0.1% Triton X-100 (Sigma-Aldrich) for 5min and then blocked with 5% normal goat serum (NGS, Sigma-Aldrich) for 1 h at approximately 22 °C. .. Following blocking, cells were incubated overnight at 4 °C in DPBS solution with 5% NGS containing primary antibodies against the following targets: NeuN (neuron-specific protein) using a mouse monoclonal antibody at a 1 : 50 dilution (Cat# MAB377C3; Millipore); TRPV1 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-029; Alomone Labs, Jerusalem, Israel); TRPA1 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-037; Alomone Labs); TRPM8 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-049; Alomone Labs). ..

    Next-Generation Sequencing:

    Article Title: Persistent in vitro nociceptor hyperexcitability and axonal retraction produced by repeated paclitaxel doses.
    Article Snippet: After three washes with DPBS, cells were permeabilized using 0.1% Triton X-100 (Sigma-Aldrich) for 5min and then blocked with 5% normal goat serum (NGS, Sigma-Aldrich) for 1 h at approximately 22 °C. .. Following blocking, cells were incubated overnight at 4 °C in DPBS solution with 5% NGS containing primary antibodies against the following targets: NeuN (neuron-specific protein) using a mouse monoclonal antibody at a 1 : 50 dilution (Cat# MAB377C3; Millipore); TRPV1 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-029; Alomone Labs, Jerusalem, Israel); TRPA1 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-037; Alomone Labs); TRPM8 with a rabbit polyclonal antibody at a 1 : 100 dilution (Cat# ACC-049; Alomone Labs). ..



    Similar Products

    94
    Alomone Labs trpml1 acc 081
    Trpml1 Acc 081, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Anti-TRPML1+(Mucolipin+1)+Antibody/pm42218124-94-48-51
    Average 94 stars, based on 1 article reviews
    trpml1 acc 081 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Alomone Labs anti-cav2.3 (cacna1e) antibody
    Anti Cav2.3 (Cacna1e) Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Anti-CaV2%2E3+(CACNA1E)+Antibody/custom%40acc-006%4042701130
    Average 93 stars, based on 1 article reviews
    anti-cav2.3 (cacna1e) antibody - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Alomone Labs anti-trpml1 (mucolipin 1) antibody
    Anti Trpml1 (Mucolipin 1) Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Anti-TRPML1+(Mucolipin+1)+Antibody/custom%40acc-081%4042414599
    Average 94 stars, based on 1 article reviews
    anti-trpml1 (mucolipin 1) antibody - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Alomone Labs anti trpm4 antibody
    Generation of <t>Trpm4</t> -knockout mouse line. A. Map of the mouse Trpm4 locus showing exons 15 and 16 targeted for deletion by sgRNAs. Top, WT allele. Bottom, KO allele. The sgRNAs were designed to target introns 14 and 16 flanking exons 15 and 16. Specific primers for amplifying the WT(Fw2/Rv) or KO (Fw1/Rv) allele were used. B. A representative result of genotyping PCR using a mixture of the Fw1, Fw2, and Rv primers. Two fragments were amplified from heterozygote mouse samples, each indicating the WT or KO fragment. The bottom fragment (695 bp) was amplified using the WT primer pair. The top fragment (928 bp) was amplified using the KO primer pair, indicating successful deletion of exons 15 and 16, which was confirmed by direct sequencing. (C and D). The expression patterns of Trpm4 gene in mouse brain (C) or primary microglia (D) using Gapdh as a control. In (C), “M4-plasmid” indicates an amplified fragment using mouse TRPM4 plasmid as a template. E. Western blot analysis of Trpm4 in mouse TRPM4-expressing HEK293T cells (M4-HEK) and mouse colon samples from WT or TRPM4KO mice. The expected molecular weight of Trpm4 is 134 kDa.
    Anti Trpm4 Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Anti-TRPM4+Antibody/pmc12999298-64-22-26
    Average 94 stars, based on 1 article reviews
    anti trpm4 antibody - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Medicago acc synthases
    Generation of <t>Trpm4</t> -knockout mouse line. A. Map of the mouse Trpm4 locus showing exons 15 and 16 targeted for deletion by sgRNAs. Top, WT allele. Bottom, KO allele. The sgRNAs were designed to target introns 14 and 16 flanking exons 15 and 16. Specific primers for amplifying the WT(Fw2/Rv) or KO (Fw1/Rv) allele were used. B. A representative result of genotyping PCR using a mixture of the Fw1, Fw2, and Rv primers. Two fragments were amplified from heterozygote mouse samples, each indicating the WT or KO fragment. The bottom fragment (695 bp) was amplified using the WT primer pair. The top fragment (928 bp) was amplified using the KO primer pair, indicating successful deletion of exons 15 and 16, which was confirmed by direct sequencing. (C and D). The expression patterns of Trpm4 gene in mouse brain (C) or primary microglia (D) using Gapdh as a control. In (C), “M4-plasmid” indicates an amplified fragment using mouse TRPM4 plasmid as a template. E. Western blot analysis of Trpm4 in mouse TRPM4-expressing HEK293T cells (M4-HEK) and mouse colon samples from WT or TRPM4KO mice. The expected molecular weight of Trpm4 is 134 kDa.
    Acc Synthases, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/acc+synthases/pm42267652-58-7-2
    Average 86 stars, based on 1 article reviews
    acc synthases - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Kodak acc 5092 10 fabric
    Generation of <t>Trpm4</t> -knockout mouse line. A. Map of the mouse Trpm4 locus showing exons 15 and 16 targeted for deletion by sgRNAs. Top, WT allele. Bottom, KO allele. The sgRNAs were designed to target introns 14 and 16 flanking exons 15 and 16. Specific primers for amplifying the WT(Fw2/Rv) or KO (Fw1/Rv) allele were used. B. A representative result of genotyping PCR using a mixture of the Fw1, Fw2, and Rv primers. Two fragments were amplified from heterozygote mouse samples, each indicating the WT or KO fragment. The bottom fragment (695 bp) was amplified using the WT primer pair. The top fragment (928 bp) was amplified using the KO primer pair, indicating successful deletion of exons 15 and 16, which was confirmed by direct sequencing. (C and D). The expression patterns of Trpm4 gene in mouse brain (C) or primary microglia (D) using Gapdh as a control. In (C), “M4-plasmid” indicates an amplified fragment using mouse TRPM4 plasmid as a template. E. Western blot analysis of Trpm4 in mouse TRPM4-expressing HEK293T cells (M4-HEK) and mouse colon samples from WT or TRPM4KO mice. The expected molecular weight of Trpm4 is 134 kDa.
    Acc 5092 10 Fabric, supplied by Kodak, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/10+5092+acc+fabric/pm42243468-127-12-7
    Average 86 stars, based on 1 article reviews
    acc 5092 10 fabric - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    96
    Alomone Labs anti-cav1.2 (cacna1c) antibody
    Generation of <t>Trpm4</t> -knockout mouse line. A. Map of the mouse Trpm4 locus showing exons 15 and 16 targeted for deletion by sgRNAs. Top, WT allele. Bottom, KO allele. The sgRNAs were designed to target introns 14 and 16 flanking exons 15 and 16. Specific primers for amplifying the WT(Fw2/Rv) or KO (Fw1/Rv) allele were used. B. A representative result of genotyping PCR using a mixture of the Fw1, Fw2, and Rv primers. Two fragments were amplified from heterozygote mouse samples, each indicating the WT or KO fragment. The bottom fragment (695 bp) was amplified using the WT primer pair. The top fragment (928 bp) was amplified using the KO primer pair, indicating successful deletion of exons 15 and 16, which was confirmed by direct sequencing. (C and D). The expression patterns of Trpm4 gene in mouse brain (C) or primary microglia (D) using Gapdh as a control. In (C), “M4-plasmid” indicates an amplified fragment using mouse TRPM4 plasmid as a template. E. Western blot analysis of Trpm4 in mouse TRPM4-expressing HEK293T cells (M4-HEK) and mouse colon samples from WT or TRPM4KO mice. The expected molecular weight of Trpm4 is 134 kDa.
    Anti Cav1.2 (Cacna1c) Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Anti-CaV1%2E2+(CACNA1C)+Antibody/custom%40acc-003%4042248312
    Average 96 stars, based on 1 article reviews
    anti-cav1.2 (cacna1c) antibody - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    DSMZ s haemolyticus
    Trend of LA MIC changes for S. <t>haemolyticus</t> during sub-inhibitory treatment.
    S Haemolyticus, supplied by DSMZ, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/A-2/pmc12991841-125-6-23
    Average 95 stars, based on 1 article reviews
    s haemolyticus - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    Alomone Labs trpv1
    <t>TRPV1-mediated</t> nociceptive sensitization in the DRG and spinal cord dorsal horn (SC) following CCI and treatment. (A) Schematic illustration of the proposed mechanism: Injury-induced <t>TRPV1</t> ion channel activation triggers calcium influx and downstream CGRP release, which activates adenylate cyclase/PKA signaling to amplify neuropathic pain sensitization. (B) Representative immunofluorescence images of the DRG stained for TRPV1 (red), NeuN (green), and DAPI (blue). The Injury group shows marked up-regulation of TRPV1 in sensory neurons. Dex/Lid@PLX/HA treatment substantially reduces TRPV1 expression, restoring it to near-Naive levels. Scale bars, 200 μm (overview) and 50 μm (inset). (C) Immunofluorescence staining for TRPV1 (red) and NeuN (green) in the spinal dorsal horn. The dashed line indicates the dorsal horn boundary. Dex/Lid@PLX/HA significantly suppresses injury-induced central TRPV1 up-regulation. Scale bar, 200 μm. (D to F) Quantitative analysis of the relative TRPV1 + area in the DRG (top) and spinal cord (middle), and the SGC/neuron ratio. Dex/Lid@PLX/HA shows marked suppression of TRPV1 overexpression relative to the injury group. Data are presented as mean ± SEM. **** P < 0.0001, ** P < 0.01, * P < 0.05, ns: not significant.
    Trpv1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/Guinea+pig+Anti-TRPV1+(VR1)+Antibody/pmc13216820-86-14-15
    Average 93 stars, based on 1 article reviews
    trpv1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    86
    Novogene anterior cingulate cortex acc
    <t>TRPV1-mediated</t> nociceptive sensitization in the DRG and spinal cord dorsal horn (SC) following CCI and treatment. (A) Schematic illustration of the proposed mechanism: Injury-induced <t>TRPV1</t> ion channel activation triggers calcium influx and downstream CGRP release, which activates adenylate cyclase/PKA signaling to amplify neuropathic pain sensitization. (B) Representative immunofluorescence images of the DRG stained for TRPV1 (red), NeuN (green), and DAPI (blue). The Injury group shows marked up-regulation of TRPV1 in sensory neurons. Dex/Lid@PLX/HA treatment substantially reduces TRPV1 expression, restoring it to near-Naive levels. Scale bars, 200 μm (overview) and 50 μm (inset). (C) Immunofluorescence staining for TRPV1 (red) and NeuN (green) in the spinal dorsal horn. The dashed line indicates the dorsal horn boundary. Dex/Lid@PLX/HA significantly suppresses injury-induced central TRPV1 up-regulation. Scale bar, 200 μm. (D to F) Quantitative analysis of the relative TRPV1 + area in the DRG (top) and spinal cord (middle), and the SGC/neuron ratio. Dex/Lid@PLX/HA shows marked suppression of TRPV1 overexpression relative to the injury group. Data are presented as mean ± SEM. **** P < 0.0001, ** P < 0.01, * P < 0.05, ns: not significant.
    Anterior Cingulate Cortex Acc, supplied by Novogene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/acc/acc+anterior+cingulate+cortex/pm42134517-83-13-28
    Average 86 stars, based on 1 article reviews
    anterior cingulate cortex acc - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Generation of Trpm4 -knockout mouse line. A. Map of the mouse Trpm4 locus showing exons 15 and 16 targeted for deletion by sgRNAs. Top, WT allele. Bottom, KO allele. The sgRNAs were designed to target introns 14 and 16 flanking exons 15 and 16. Specific primers for amplifying the WT(Fw2/Rv) or KO (Fw1/Rv) allele were used. B. A representative result of genotyping PCR using a mixture of the Fw1, Fw2, and Rv primers. Two fragments were amplified from heterozygote mouse samples, each indicating the WT or KO fragment. The bottom fragment (695 bp) was amplified using the WT primer pair. The top fragment (928 bp) was amplified using the KO primer pair, indicating successful deletion of exons 15 and 16, which was confirmed by direct sequencing. (C and D). The expression patterns of Trpm4 gene in mouse brain (C) or primary microglia (D) using Gapdh as a control. In (C), “M4-plasmid” indicates an amplified fragment using mouse TRPM4 plasmid as a template. E. Western blot analysis of Trpm4 in mouse TRPM4-expressing HEK293T cells (M4-HEK) and mouse colon samples from WT or TRPM4KO mice. The expected molecular weight of Trpm4 is 134 kDa.

    Journal: The Journal of Physiological Sciences : JPS

    Article Title: Genetic inactivation of TRPM4 does not alter the temperature-dependent movement of mouse microglia

    doi: 10.1016/j.jphyss.2026.100067

    Figure Lengend Snippet: Generation of Trpm4 -knockout mouse line. A. Map of the mouse Trpm4 locus showing exons 15 and 16 targeted for deletion by sgRNAs. Top, WT allele. Bottom, KO allele. The sgRNAs were designed to target introns 14 and 16 flanking exons 15 and 16. Specific primers for amplifying the WT(Fw2/Rv) or KO (Fw1/Rv) allele were used. B. A representative result of genotyping PCR using a mixture of the Fw1, Fw2, and Rv primers. Two fragments were amplified from heterozygote mouse samples, each indicating the WT or KO fragment. The bottom fragment (695 bp) was amplified using the WT primer pair. The top fragment (928 bp) was amplified using the KO primer pair, indicating successful deletion of exons 15 and 16, which was confirmed by direct sequencing. (C and D). The expression patterns of Trpm4 gene in mouse brain (C) or primary microglia (D) using Gapdh as a control. In (C), “M4-plasmid” indicates an amplified fragment using mouse TRPM4 plasmid as a template. E. Western blot analysis of Trpm4 in mouse TRPM4-expressing HEK293T cells (M4-HEK) and mouse colon samples from WT or TRPM4KO mice. The expected molecular weight of Trpm4 is 134 kDa.

    Article Snippet: After transferring the proteins to a nitrocellulose membrane, the membrane was blocked for 1 h at room temperature and then incubated with anti-TRPM4 antibody (1:300, ACC044, Alomone) overnight at 4 °C.

    Techniques: Knock-Out, Amplification, Sequencing, Expressing, Control, Plasmid Preparation, Western Blot, Molecular Weight

    Genetic elimination of Trpm4 does not alter the temperature-dependent microglia movement. A. Trajectories of primary microglia from a representative preparation of WT and TRPM4KO mice recorded for 2 h at 33 °C, 37 °C, and 40 °C. Paths are arranged to show origins at x (horizontal axis) = y (vertical axis) = 0. Each line indicates the trajectory of a single cell. n indicates the number of cells analyzed per preparation. B. The average distances of migrating microglia isolated from WT or TRPM4KO mice exposed to 33 °C (WT, n = 117; TRPM4KO, n = 151), 37 °C (WT, n = 235; TRPM4KO, n = 240), or 40 °C (WT, n = 150; TRPM4KO, n = 175) were measured. Open circles indicate the migration distance of each microglia over 2 h. Horizontal lines indicate means ± SEM. At 33 °C, 37 °C, and 40 °C, WT microglia moved 112.94 ± 6.1 μm, 175.28 ± 5.24 μm, and 204.31 ± 7.27 μm, respectively, whereas TRPM4KO microglia moved 113.46 ± 5.1 μm, 175.28 ± 4.13 μm, and 201.35 ± 5.61 μm, respectively. **P < 0.01 (two-way ANOVA followed by post hoc Bonferroni test for multiple comparisons).

    Journal: The Journal of Physiological Sciences : JPS

    Article Title: Genetic inactivation of TRPM4 does not alter the temperature-dependent movement of mouse microglia

    doi: 10.1016/j.jphyss.2026.100067

    Figure Lengend Snippet: Genetic elimination of Trpm4 does not alter the temperature-dependent microglia movement. A. Trajectories of primary microglia from a representative preparation of WT and TRPM4KO mice recorded for 2 h at 33 °C, 37 °C, and 40 °C. Paths are arranged to show origins at x (horizontal axis) = y (vertical axis) = 0. Each line indicates the trajectory of a single cell. n indicates the number of cells analyzed per preparation. B. The average distances of migrating microglia isolated from WT or TRPM4KO mice exposed to 33 °C (WT, n = 117; TRPM4KO, n = 151), 37 °C (WT, n = 235; TRPM4KO, n = 240), or 40 °C (WT, n = 150; TRPM4KO, n = 175) were measured. Open circles indicate the migration distance of each microglia over 2 h. Horizontal lines indicate means ± SEM. At 33 °C, 37 °C, and 40 °C, WT microglia moved 112.94 ± 6.1 μm, 175.28 ± 5.24 μm, and 204.31 ± 7.27 μm, respectively, whereas TRPM4KO microglia moved 113.46 ± 5.1 μm, 175.28 ± 4.13 μm, and 201.35 ± 5.61 μm, respectively. **P < 0.01 (two-way ANOVA followed by post hoc Bonferroni test for multiple comparisons).

    Article Snippet: After transferring the proteins to a nitrocellulose membrane, the membrane was blocked for 1 h at room temperature and then incubated with anti-TRPM4 antibody (1:300, ACC044, Alomone) overnight at 4 °C.

    Techniques: Single Cell, Isolation, Migration

    Trend of LA MIC changes for S. haemolyticus during sub-inhibitory treatment.

    Journal: Veterinary and Animal Science

    Article Title: Aerococcus viridans, Staphylococcus haemolyticus and Corynebacterium bovis : sub-inhibitory exposure of lactic acid and cross-resistance to β-lactams antibiotics

    doi: 10.1016/j.vas.2026.100620

    Figure Lengend Snippet: Trend of LA MIC changes for S. haemolyticus during sub-inhibitory treatment.

    Article Snippet: Fig 5 dummy alt text While S. haemolyticus displayed a 2-fold rise of cefoperazon for 2 field isolates (4137SH and 3934SH) plus the DSMZ reference astrain, there was also a 1 step decrease for 1 isolate (3958SH).

    Techniques:

    Correlation of LA and ꞵ-lactam antibiotic* tolerance between pre- and post-exposure in S. haemolyticus . Tolerance compared in measured MIC steps (+1). ▼ = 1 step decrease from the initial MIC. One MIC-step equals to a 2-fold change in antibiotic MICs and a 1.3-fold change in LA MICs. *Cefquinome, penicillin + novobiocin, and amoxicillin + clavulanic acid showed no changes at all.

    Journal: Veterinary and Animal Science

    Article Title: Aerococcus viridans, Staphylococcus haemolyticus and Corynebacterium bovis : sub-inhibitory exposure of lactic acid and cross-resistance to β-lactams antibiotics

    doi: 10.1016/j.vas.2026.100620

    Figure Lengend Snippet: Correlation of LA and ꞵ-lactam antibiotic* tolerance between pre- and post-exposure in S. haemolyticus . Tolerance compared in measured MIC steps (+1). ▼ = 1 step decrease from the initial MIC. One MIC-step equals to a 2-fold change in antibiotic MICs and a 1.3-fold change in LA MICs. *Cefquinome, penicillin + novobiocin, and amoxicillin + clavulanic acid showed no changes at all.

    Article Snippet: Fig 5 dummy alt text While S. haemolyticus displayed a 2-fold rise of cefoperazon for 2 field isolates (4137SH and 3934SH) plus the DSMZ reference astrain, there was also a 1 step decrease for 1 isolate (3958SH).

    Techniques:

    TRPV1-mediated nociceptive sensitization in the DRG and spinal cord dorsal horn (SC) following CCI and treatment. (A) Schematic illustration of the proposed mechanism: Injury-induced TRPV1 ion channel activation triggers calcium influx and downstream CGRP release, which activates adenylate cyclase/PKA signaling to amplify neuropathic pain sensitization. (B) Representative immunofluorescence images of the DRG stained for TRPV1 (red), NeuN (green), and DAPI (blue). The Injury group shows marked up-regulation of TRPV1 in sensory neurons. Dex/Lid@PLX/HA treatment substantially reduces TRPV1 expression, restoring it to near-Naive levels. Scale bars, 200 μm (overview) and 50 μm (inset). (C) Immunofluorescence staining for TRPV1 (red) and NeuN (green) in the spinal dorsal horn. The dashed line indicates the dorsal horn boundary. Dex/Lid@PLX/HA significantly suppresses injury-induced central TRPV1 up-regulation. Scale bar, 200 μm. (D to F) Quantitative analysis of the relative TRPV1 + area in the DRG (top) and spinal cord (middle), and the SGC/neuron ratio. Dex/Lid@PLX/HA shows marked suppression of TRPV1 overexpression relative to the injury group. Data are presented as mean ± SEM. **** P < 0.0001, ** P < 0.01, * P < 0.05, ns: not significant.

    Journal: Biomaterials Research

    Article Title: Injectable Poloxamer and Hyaluronic Acid Hydrogel for Sustained Co-Delivery of Dexamethasone and Lidocaine Ameliorates Neuropathic Pain

    doi: 10.34133/bmr.0373

    Figure Lengend Snippet: TRPV1-mediated nociceptive sensitization in the DRG and spinal cord dorsal horn (SC) following CCI and treatment. (A) Schematic illustration of the proposed mechanism: Injury-induced TRPV1 ion channel activation triggers calcium influx and downstream CGRP release, which activates adenylate cyclase/PKA signaling to amplify neuropathic pain sensitization. (B) Representative immunofluorescence images of the DRG stained for TRPV1 (red), NeuN (green), and DAPI (blue). The Injury group shows marked up-regulation of TRPV1 in sensory neurons. Dex/Lid@PLX/HA treatment substantially reduces TRPV1 expression, restoring it to near-Naive levels. Scale bars, 200 μm (overview) and 50 μm (inset). (C) Immunofluorescence staining for TRPV1 (red) and NeuN (green) in the spinal dorsal horn. The dashed line indicates the dorsal horn boundary. Dex/Lid@PLX/HA significantly suppresses injury-induced central TRPV1 up-regulation. Scale bar, 200 μm. (D to F) Quantitative analysis of the relative TRPV1 + area in the DRG (top) and spinal cord (middle), and the SGC/neuron ratio. Dex/Lid@PLX/HA shows marked suppression of TRPV1 overexpression relative to the injury group. Data are presented as mean ± SEM. **** P < 0.0001, ** P < 0.01, * P < 0.05, ns: not significant.

    Article Snippet: The sections were then incubated overnight at 4 °C with the following primary antibodies: TRPV1 (Alomone Labs, catalog number ACC-030-GP), Iba-1 (Abcam, catalog number ab5076), NeuN (Abcam, catalog number ab104224), CD68 (Abcam, catalog number ab31630), CD163 (Abcam, catalog number ab182422), CGRP (Abcam, catalog number ab47027), GFAP (Millipore, catalog number MAB360), and NF200 (Abcam, catalog number ab8135).

    Techniques: Activation Assay, Immunofluorescence, Staining, Expressing, Over Expression