Review




Structured Review

Proteintech ampk
Ampk, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/CDO1+Antibody/pmc12933830-167-36-37
Average 93 stars, based on 30 article reviews
ampk - by Bioz Stars, 2026-09
93/100 stars

Images

Related Articles

Virus:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HRP-conjugated affinipure rabbit anti-goat IgG Proteintech Cat# SA00001-2; RRID:AB_2722564 HRP-conjugated affinipure mouse anti-goat IgG Proteintech Cat# PR30012; RRID:AB_3096948 MCM3 Proteintech Cat# 15597-1-AP; RRID:AB_2141973 β-actin Proteintech Cat# 66009-1-Ig; RRID:AB_2687938 USP1 Proteintech Cat# 66069-1-Ig; RRID:AB_11043340 P62 Proteintech Cat# 18420-1-AP; RRID:AB_10694431 FUNDC1 Proteintech Cat# 28519-1-AP; RRID:AB_2935469 Pink1 Proteintech Cat# 23274-1-AP; RRID:AB_2879244 Parkin Proteintech Cat# 14060-1-AP; RRID:AB_2878005 TOMM20 Proteintech Cat# 11802-1-AP; RRID:AB_2207530 LC3B Proteintech Cat# 14600-1-AP; RRID:AB_2137737 NQO1 Proteintech Cat# 11451-1-AP; RRID:AB_2298729 HMOX-1 Proteintech Cat# 10701-1-AP; RRID:AB_2118685 Ki-67 Proteintech Cat# 27309-1-AP; RRID:AB_2756525 Bax Proteintech Cat# 60267-1-Ig; RRID:AB_2848213 Bcl-2 Proteintech Cat# 60178-1-Ig; RRID:AB_10734459 PCNA Proteintech Cat# 10205-2-AP; RRID:AB_2160330 Histione Proteintech Cat# 10445-1-AP; RRID:AB_2116701 Nrf-2 Proteintech Cat# 16396-1-AP; RRID:AB_2782956 HA Proteintech Cat# 51064-2-AP; RRID:AB_11042321 E-cadherin Proteintech Cat# 20874-1-AP; RRID:AB_10697811 N-cadherin Proteintech Cat# 22018-1-AP; RRID:AB_2813891 Snail Proteintech Cat# 13099-1-AP; RRID:AB_2191756 Vimentin Proteintech Cat# 60330-1-Ig; RRID:AB_2881439 MMP9 Proteintech Cat# 10375-2-AP; RRID:AB_10897178 Bacterial and virus strains USP1-knockdown PSLenti-U6-CMV-EGFP-F2A-puro-WPRE OBiO N/A USP1-overexperssion H17223 pSLenti-CMV-MCS-6xHis-PGK-PuroWPRE OBiO N/A MCM3-Knockdown PSLenti-U6-CMV-EGFP-F2A-puro-WPRE OBiO N/A .. This work was supported by Department of Science and Technology of Guizhou Province (no: Qian-KH-[2024]-Youth-009), Guizhou Provincial Health Commission Science and Technology fund project (no: gzwkj2025-033), Project of Science and Technology of Guiyang (no: Zhuke Contract [2023] 48-27), Eighth Batch of Guizhou High-level Innovative Talents Cultivated by Guiyang Municipality (no: Qianke Contract-GCC-[2024] 005), and Science and Technology Program Project of Guiyang Municipal Health Bureau (no: [2023] Zhuweijian Science and Technology Contract No.008).

Article Title: HSPA2 modulates antiviral immunity by inhibiting TBK1 activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-phospho-TBK1/NAK (Ser172) Cell Signaling Technology Cat# 5483S; RRID: AB_10693472 anti-TBK1/NAK Cell Signaling Technology Cat# 3504; RRID: AB_2255663 anti-phospho-IRF3 (Ser396) Cell Signaling Technology Cat# 29047S; RRID: AB_2773013 anti-IRF3 Cell Signaling Technology Cat# 4302; RRID: AB_1904036 anti-phospho-NF-кB p65 (Ser536) Cell Signaling Technology Cat# 3033S; RRID: AB_331284 anti-NF-кB p65 Cell Signaling Technology Cat# 8242; RRID: AB_10859369 anti-His Cell Signaling Technology Cat# 2366; RRID: AB_2115719 anti-GST ABclonal Cat# AE077; RRID: AB_3674395 anti-HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 anti-FLAG Proteintech Cat# 20543-1-AP; RRID: AB_11232216 anti-Myc Proteintech Cat# AE070; RRID: AB_2863795 anti-LaminB1 Proteintech Cat# 12987-1-AP; RRID: AB_2136290 anti-GAPDH Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 anti-HSPA2 Abclonal Cat# A6652; RRID: AB_2863532 anti-HSPA2 Abmart Cat# T55968 anti-HSV1 + HSV2 VP16 Abcam Cat# ab110226; RRID: AB_10863640 anti-VSV-G Bioss Cat# bs-2110R; RRID: AB_10885940 Bacterial and virus strains HSV-1 Li et al.50 N/A VSV Li et al.50 N/A E.coli BL21(DE3) Tiangen Biotech Cat# CB105 Chemicals, peptides, and recombinant proteins HT-DNA Sigma Aldrich Cat# D1626 RNA isolater Vazyme Cat# R401-01 Poly(I:C) MedChemExpress Cat# HY-107202 anti-GST beads MedChemExpress Cat# HY-K0222 Protein A/G agarose MedChemExpress Cat# HY-K0202 anti-FLAG beads MedChemExpress Cat# HY-K0207 anti-HA beads MedChemExpress Cat# HY-K0201 (Continued on next page) 18 Cell Reports 45, 117222, April 28, 2026 ..

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

Isolation:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Recombinant:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: HSPA2 modulates antiviral immunity by inhibiting TBK1 activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-phospho-TBK1/NAK (Ser172) Cell Signaling Technology Cat# 5483S; RRID: AB_10693472 anti-TBK1/NAK Cell Signaling Technology Cat# 3504; RRID: AB_2255663 anti-phospho-IRF3 (Ser396) Cell Signaling Technology Cat# 29047S; RRID: AB_2773013 anti-IRF3 Cell Signaling Technology Cat# 4302; RRID: AB_1904036 anti-phospho-NF-кB p65 (Ser536) Cell Signaling Technology Cat# 3033S; RRID: AB_331284 anti-NF-кB p65 Cell Signaling Technology Cat# 8242; RRID: AB_10859369 anti-His Cell Signaling Technology Cat# 2366; RRID: AB_2115719 anti-GST ABclonal Cat# AE077; RRID: AB_3674395 anti-HA Proteintech Cat# 51064-2-AP; RRID: AB_11042321 anti-FLAG Proteintech Cat# 20543-1-AP; RRID: AB_11232216 anti-Myc Proteintech Cat# AE070; RRID: AB_2863795 anti-LaminB1 Proteintech Cat# 12987-1-AP; RRID: AB_2136290 anti-GAPDH Proteintech Cat# 60004-1-Ig; RRID: AB_2107436 anti-HSPA2 Abclonal Cat# A6652; RRID: AB_2863532 anti-HSPA2 Abmart Cat# T55968 anti-HSV1 + HSV2 VP16 Abcam Cat# ab110226; RRID: AB_10863640 anti-VSV-G Bioss Cat# bs-2110R; RRID: AB_10885940 Bacterial and virus strains HSV-1 Li et al.50 N/A VSV Li et al.50 N/A E.coli BL21(DE3) Tiangen Biotech Cat# CB105 Chemicals, peptides, and recombinant proteins HT-DNA Sigma Aldrich Cat# D1626 RNA isolater Vazyme Cat# R401-01 Poly(I:C) MedChemExpress Cat# HY-107202 anti-GST beads MedChemExpress Cat# HY-K0222 Protein A/G agarose MedChemExpress Cat# HY-K0202 anti-FLAG beads MedChemExpress Cat# HY-K0207 anti-HA beads MedChemExpress Cat# HY-K0201 (Continued on next page) 18 Cell Reports 45, 117222, April 28, 2026 ..

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

Lysis:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

CCK-8 Assay:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Cell Counting:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Staining:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

Magnetic Beads:

Article Title: LIFUS-driven engineered bacteria reprogram immunosuppressive niches via mechano-NOTCH signaling.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-CD45 Proteintech Cat# 98035-1-RR; RRID: AB_3672181 Mouse anti-CD3 Proteintech Cat# 17617-1-AP; RRID: AB_1939430 Mouse anti-CD4 Proteintech Cat# 67786-1-Ig; RRID: AB_2918550 Mouse anti-CD8 Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-FOXP3 antibody Proteintech Cat# 22228-1-AP; RRID: AB_11182376 Anti-Ki67 antibody Proteintech Cat# 28074-1-AP; RRID: AB_2918145 Anti-Collagen I antibody Proteintech Cat# 66786-1-Ig; RRID: AB_2882131 Anti-Notch1 antibody Proteintech Cat# 10062-2-AP; RRID: AB_2153338 Anti-Jagged1 antibody Proteintech Cat# 66890-1-Ig; RRID: AB_2882220 Anti-PD-1 antibody Proteintech Cat# 98080-1-RR; RRID: AB_3672227 Anti-Tim-3 antibody Proteintech Cat# 82836-1-RR; RRID: AB_3670571 Anti-mouse IFN-γ antibody Proteintech Cat# 30293-1-AP; RRID: AB_3669709 Anti-mouse TNF- α antibody Proteintech Cat# 17590-1-AP; RRID: AB_2271853 Anti-mouse Granzyme B antibody Proteintech Cat# 13588-1-AP; RRID: AB_2114429 Bacterial and virus strains Salmonella enterica serovar Typhimurium VNP20009 (attenuated) Shanghai YuanChuang Biotechnology N/A Lentiviral/retroviral vector pRVKM-FMC63-CD28-RFP Shanghai Jiman Biotechnology N/A Biological samples 4T1 tumor tissue BALB/c Isolated from mice raised in SPF environment Blood sample of mice BALB/c Isolated from mice raised in SPF environment Main organs of mice BALB/c Isolated from mice raised in SPF environment Chemicals, peptides, and recombinant proteins L-arabinose Aladdin Cat# A106196 LB broth Beyotime Biotechnology Co.(Shanghai, China) Cat# ST156 Chloramphenicol Beyotime Cat# ST1150 Kanamycin Beyotime Cat# ST102 RPMI-1640 medium Gibco C11875500BT RIPA lysis buffer Beyotime Cat# C90204 Lysozyme Beyotime Cat# ST206 D-luciferin (potassium salt) Aladdin Cat# L120798 CCK-8 Cell Counting Kit Beyotime Cat# C0042 SYTO 9/Propidium Iodide Live/Dead stain Beyotime Cat# C1399S Tumor Dissociation Kit Beyotime Cat# C3702 ACK Lysing Buffer Gibco Cat# A1049201 DNase I Roche Cat# 10104159001 Dynabeads Human T-Activator CD3/CD28 Gibco Cat# 11161D Streptavidin Magnetic Beads Selleck Cat# B90011 Recombinant mouse IL-2 Proteintech Cat# CK24-10UG Paraformaldehyde (4%) Beyotime Cat# P0099-3L Triton X-100 Beyotime Cat# D7046S BSA (bovine serum albumin) Beyotime Cat# AD1461 (Continued on next page) Cell Reports Medicine 7, 102658, March 17, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DAB substrate kit Beyotime Cat# C0085S Critical commercial assays Chromium Single Cell 3′ Library & Gel Bead Kit 10x Genomics Cat# PN-120237 Chromium Single Cell A Chip Kit 10x Genomics Cat# 1000265 Cell Ranger software package 10x Genomics N/A Deposited data scRNA-seq data from 4T1 tumors This paper GSA: CRA033977 Experimental models: Cell lines 4T1 murine breast carcinoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A 4T1-Luc (luciferase-expressing 4T1) cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A B16-OVA melanoma cells Shanghai Tenth People’s Clinical and Translational Research Center) N/A Primary mouse CAFs (tumor-derived fibroblasts) BALB/c Isolated from mice raised in SPF environment Primary mouse CD8+ T cells (tumor and splenic) BALB/c Isolated from mice raised in SPF environment OT-1 CD8+ T cells C57BL/6 N/A CAR-T cells (FMC63-CD28-RFP) Shanghai Jiman Biotechnology N/A Experimental models: Organisms/strains Mouse: BALB/c, female, 5–6 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: C57BL/6, female, 6–7 weeks Shanghai Jihui Experimental Animal Breeding Center N/A Mouse: CD45.1+ wild-type recipients Shanghai Jihui Experimental Animal Breeding Center N/A Oligonucleotides For genetic construct validation, see Table S1 This paper N/A Recombinant DNA Plasmid: pBAD-bARGSer-axe-txe Shapiro et al.18 Addgene Cat#192473 Software and algorithms GraphPad Prism GraphPad Software Version 10.2 https://www.graphpad.com/; RRID: SCR_002798 Seurat Seurat Version 4.0 https://satijalab.org/ seurat/articles/get_started.html; RRID:SCR_016341 Cell Ranger 10x Genomics Version 6.0 https://support.10xgenomics. com/single-cell-gene-expression/ software/pipelines/latest/; RRID:SCR_017344 CellChat (R package) 10x Genomics Version 6.0 https://github.com/ sqjin/CellChat; RRID:SCR_021946 ImageJ Image, Java Version 1.8 https://imagej.net/ij/; RRID:SCR_003070 Flow cytometry analysis software (e.g., FlowJo) BD Bioscience Version 10 https://www.flowjo.com/; RRID:SCR_008520 Ultrasound imaging and therapy system Mindray (China) Resona R9 Shear Wave Elastography module (SWTQ) Mindray (China) Resona R9 Small animal in vivo imaging system PerkinElmer AniView100 e2 Cell Reports Medicine 7, 102658, March 17, 2026

Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-rabbit METTL3 Abcam Cat#ab195352; RRID: AB_2721254 Anti-rabbit Collagen II Abcam Cat#ab307674; RRID: AB_731688 Anti-rabbit Collagen X Abcam Cat#ab260040; RRID: AB_3083555 Anti-rabbit SOX9 Abcam Cat#ab185966; RRID: AB_2728660 Anti-rabbit MMP3 Abcam Cat#ab52915; RRID: AB_881243 Anti-rabbit MMP13 Abcam Cat#ab39012; RRID: AB_776416 Anti-rabbit METTL14 Proteintech Cat# 26158-1-AP; RRID: AB_2800447 Anti-rabbit β-actin Proteintech Cat#81115-1-R; RRID: AB_2923704 Anti-rabbit ACAN Proteintech Cat#13880-1-AP; RRID: AB_2722780 Anti-rabbit Beclin 1 Proteintech Cat#11306-1-AP; RRID: AB_2259061 Anti-rabbit ATG5 Proteintech Cat10181-2-AP; RRID: AB_2062045 Anti-rabbit P21 Proteintech Cat#110355-1-AP; RRID: AB_2077682 Anti-rabbit P53 Proteintech Cat# 10442-1-AP; RRID: AB_2206609 Anti-rabbit HSC70 Proteintech Cat# 10654-1-AP; RRID: AB_2120153 Anti-rabbit EIF3A Proteintech Cat# 26178-1-AP; RRID: AB_2880413 Anti-rabbit EIF3B Proteintech Cat# 10319-1-AP; RRID: AB_2096732 Anti-rabbit RPS6 Proteintech Cat# 80208-1-RR; RRID: AB_2918876 Anti-rabbit FLAG tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Anti-rabbit HA-tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Anti-rabbit IgG Cell Signaling Technology Cat# 7074; RRID: AB_2099233 Anti-mouse IgG Cell Signaling Technology Cat# 7076; RRID: AB_330924 Anti-mouse puromycin Sigma-Aldrich Cat# MABE343; RRID: AB_2566826 Anti-rabbit ZDHHC24 Invitrogen Cat# PA5-53461; RRID: AB_2649860 Anti-rabbit Fluorescein Invitrogen Cat# A-889; RRID: AB_221561 Alexa Fluor 488 goat anti-mouse Invitrogen Cat# A11029; RRID: AB_2534088 Alexa Fluor 488 goat anti-rabbit Invitrogen Cat# A11034; RRID: AB_2576217 Alexa Fluor 568 goat anti-mouse Invitrogen Cat# A11031; RRID: AB_144696 Alexa Fluor 568 goat anti-rabbit Invitrogen Cat# A11036; RRID: AB_10563566 Chemicals, peptides, and recombinant proteins D-PBS Stemcell Cat#37350 mTeSR TM 1 Basal Medium Stemcell Cat#354240 mTeSR TM 1 5X Supplement Stemcell Cat#354240 STEMdiff TM Trilineage Differentiation Kit Stemcell Cat# 05230 Gentle Cell Dissociation Reagent Stemcell Cat#100-0485 DMEM/F-12 Stemcell Cat#36254 Dispase Stemcell Cat#07913 Human IL-1 beta Protein MedChemExpress Cat#HY-P73149 Anti-Flag Magnetic Beads MedChemExpress Cat# HY-K0207 Anti-HA Magnetic Beads MedChemExpress Cat# HY-K0201 3-Methyladenine MedChemExpress Cat# 5142-23-4 Cycloheximide MedChemExpress Cat# HY-12320 Copper sulfate anhydrous MedChemExpress Cat# HY-Y1878C Carfilzomib MedChemExpress Cat# HY-10455 (Continued on next page) 18 Cell Reports 45, 116993, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Palmitic acid MedChemExpress Cat# HY-N0830 Chloroquine MedChemExpress Cat#HY-17589A IA-Alkyne MedChemExpress Cat#HY-136205 IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Triton X-100 Sigma-Aldrich Cat# T9284 Polybrene Sigma-Aldrich Cat# H9268 Puromycin Sigma-Aldrich Cat# P9620 Hydroxylamine Sigma-Aldrich Cat# 467804 DTT Sigma-Aldrich Cat# 43815 NH 4 Cl Sigma-Aldrich Cat# A9434 Duolink® In Situ PLA® Probe Anti-Rabbit PLUS, Affinity purified Donkey anti-Rabbit IgG (H + L) Sigma-Aldrich Cat# DUO92002 Duolink® In Situ PLA® Probe Anti-Mouse MINUS, Affinity purified Donkey anti-Mouse IgG (H + L) Sigma-Aldrich Cat# DUO92004 Duolink® In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink® In Situ Wash Buffers, Fluorescence Sigma-Aldrich Cat# DUO82049 Duolink® In Situ Mounting Medium with DAPI Sigma-Aldrich Cat# DUO82040 Tris(2-carboxyethyl) phosphine hydrochloride solution (TCEP) Sigma-Aldrich Cat# 646547 Human TNF-a Protein Sigma-Aldrich Cat# SRP3177 N-Ethylmaleimide Sigma-Aldrich Cat# 04260 Dexamethasone Sigma-Aldrich Cat# D4902 2-Bromohexadecanoic acid Sigma-Aldrich Cat# 21604 Iodoacetamide Sigma-Aldrich Cat# I6125 MMTS Sigma-Aldrich Cat# 208795 DNase I Sigma-Aldrich Cat# 11284932001 Collagenase Type 1 Sigma-Aldrich Cat# LS004197 Insulin-transferrin-selenium (ITS) Invitrogen Cat# 41400045 EDTA Invitrogen Cat# AM9260G NaCl Invitrogen Cat# AM9759 HEPES Invitrogen Cat# 15630130 EDTA decalcifying solution Solarbio Cat# E1171 Toluidine Blue Stain Solution Solarbio Cat# G3660 Ascorbic acid Solarbio Cat#A8100 Corning® Matrigel® hESC-Qualified Matrix Corning Cat# 354277 High Capacity Thiol Reactive Resin Nanocs Cat# AR-SS-2 Alk-16 Click Chemistry Tools Cat# CCT-1165 OG488 Azide Click Chemistry Tools Cat# 1264–1 Biotin BMCC Sangon Biotech Cat# C100222 Nuclease-Free Water Promega Cat# P1199 Critical commercial assays CoraLite®488 Plus TUNELApoptosis Detection Kit I Proteintech Cat# PF00006 Alcian blue Stain Kit Solarbio Cat# G1565 Modified Saffron-O and Fast Green Stain Kit Solarbio Cat# G1371 QuikCyto® Mouse KC/IL-8 ELISA kit Neobioscience Cat# EMC104QT.96 QuikCyto® Mouse IL-6 ELISA kit Neobioscience Cat# EMC004QT.96 QuikCyto® Mouse TNF-α ELISA kit Neobioscience Cat# EMC102aQT.96 m 6 A RNA Methylation Assay Kit Abcam Cat#ab185912 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat# R323-01 (Continued on next page) Cell Reports 45, 116993, March 24, 2026 19

Western Blot:

Article Title: A conserved eIF1A + luminal cell-centered hypoxic and "cold" tumor microenvironment promotes pan-subtype prostate cancer progression.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibody Anti-CD44 (IMC) Abcam Cat# ab6124; RRID: AB_305297 Anti-AR (IMC) Boster Cat# A00542; RRID: AB_3081165 Anti-IDH1 (IMC) Abcam Cat# ab242078 Anti-HLA I (IMC) Abcam Cat# ab239788; RRID: AB_3665873 Anti-TP53 (IMC) Boster Cat# PB9008; RRID: AB_3082963 Anti-CK5 (IMC) Boster Cat# M00398-7; RRID: AB_3081774 Anti-Collagen I (IMC) abcam Cat# ab215969; RRID: AB_2909621 Anti-CASP3 (IMC) Cell Signaling Technology Cat# 94530; RRID: AB_3076239 Anti-CD31 (IMC) Cell Signaling Technology Cat# 85873SF Anti-E-cadherin (IMC) Abcam Cat# ab256580 Anti-HIF-1a (IMC) Abcam Cat# ab210073 Anti-CD45 (IMC) Cell Signaling Technology Cat# 47937; RRID: AB_2922773 Anti-IDH2 (IMC) Abcam Cat# ab230796 Anti-CD163 (IMC) Abcam Cat# ab215976; RRID: AB_3717832 Anti-IDO-1 (IMC) Proteintech Cat# 66528-1-Ig; RRID: AB_2881891 Anti-PD-L1 (IMC) Abcam Cat# ab226766; RRID: AB_3073663 Anti-VEGFA (IMC) Abcam Cat# ab185238 Anti-CD68 (IMC) Biolegend Cat# 916104; RRID: AB_2616797 Anti-PSMA (IMC) Sino biological Cat# 201427-T10 Anti-CD20 (IMC) Abcam Cat# ab213033 Anti-PTEN (IMC) Sino biological Cat# 100729-T08 Anti-CK8 (IMC) Boster Cat# M01421-3 Anti-SF3B1 (IMC) Abcam Cat# ab249538 Anti-PD-1 (IMC) Cell Signaling Technology Cat# 63815; RRID: AB_3675993 Anti-Ki-67 (IMC) BD Cat# 550609; RRID: AB_393778 Anti-FBP1 (IMC) Abcam Cat# ab247749 Anti-HLA-DR (IMC) Abcam Cat# NB600-989 Anti-eIF1A (IMC) Abcam Cat# ab243919 Anti-CD3 (IMC) Cell Signaling Technology Cat# 24581SF Anti-FAP (IMC) Abcam Cat# ab271976; RRID: AB_3676372 Anti-c-MYC (IMC) Abcam Cat# ab264603 Anti-CD29/Integrin beta 1 (IMC) Abcam Cat# ab271931 Anti-HMGCR (IMC) Boster Cat# A00643-3 Anti-ACC (IMC) Abcam Cat# ab173584 Anti-Pan-cytokeratin (IMC) Biolegend Cat# 914204, RRID: AB_2616960 Anti-aSMA (IMC) Biolegend Cat# 904601, RRID: AB_2565041 Anti-BRCA1 (IMC) Boster Cat# PB9015, RRID: AB_3082969 Anti-Vimentin (IMC) Abcam Cat# ab193555, RRID: AB_2814713 Anti-eIF1A (WB and IF) Proteintech Cat# 11649-2-AP; RRID: AB_2097803 Anti-HIF-1α (WB and IF) Cell Signaling Technology Cat# 14179, RRID: AB_2622225 Anti-β-actin (WB) Proteintech Cat# 66009-1-Ig; RRID: AB_2687938 Anti-CA9 (IF) Proteintech Cat# 11071-1-AP; RRID: AB_2066528 Anti-CD3 (IF) Abcam Cat# ab16669; RRID: AB_443425 (Continued on next page) e1 Cell Reports Medicine 7, 102619, February 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-CD68 (IF) Affinity biosciences Cat# DF7518; RRID: AB_2841017 Anti-human CD8A (IF) Proteintech Cat# 66868-1-Ig; RRID: AB_2882205 Anti-human CD31 (IF) Proteintech Cat# 11265-1-AP; RRID: AB_2299349 Anti-p63 (IF) Proteintech Cat# 12143-1-AP, RRID:AB_10597397 Anti-collagen-I (IF) Proteintech Cat# 67288-1-Ig, RRID:AB_2882554 InVivoMAb mouse IgG1 isotype control Bio X cell Cat# BE0083 InVivoPlus Anti-mouse CD3ε Bio X cell Cat# BP0001-1 Gene primer Sense Antisense human-EIF1A CCGCTACCCGGAAAGAAGT AGCTTTGTTATCCTGGTAGTCTCG human-HIF1A CTGAGGGGACAGGAGGA CACACGCGGAGAAGAGA human-β actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT mouse-EIF1A TGCGGATTATTACCCGATTCAGT GAAGATCCACAGGCAGCAAACA mouse-HIF1A AACCCATTCCTCATCCGTCAA CCGGCTCATAACCCATCAACT mouse-β actin GTGACGTTGACATCCGTAAAGA GTAACAGTCCGCCTAGAAGCAC siRNA and shRNA si-EIF1A GAGGUUAUGUCACAUCAGATT UCUGAUGUGACAUAACCUCTT si-HIF1A GGGAUUAACUCAGUUUGAATT UUCAAACUGAGUUAAUCCCTT si-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT sh-EIF1A GATCCGATGTTGAGTTATCATCTTAACTCGAG TTAAGATGATAACTCAACATCTTTTTT AATTAAAAAAGATGTTGAGTTAT CATCTTAACTCGAGTTAAGATG ATAACTCAACATCG sh-NC GATCTGTTCTCCGAACGTGTCACGTTTCAAGA GAACGTGACACGTTCGGAGAATTTTTTC AATTGAAAAAATTCTCCGAACG TGTCACGTTCTCTTGAAACGTG ACACGTTCGGAGAACA Critical Reagent RNA extraction kit Takara Kusatsu Cat# 9767 Hiscript II First-Strand cDNA Synthesis Kit Vazyme Biotech Cat# R211 MonAmp SYBR Green qPCR Mix Monad Biotech Cat# MQ10101S RIPA lysis buffer KeyGene Biotech Cat# KGB5203-100 BCA Protein Assay Kit Thermo Scientific Cat# 23225 SYBR Green Thermo Scientific Cat# 4368577 RPMI 1640 medium Thermo Scientific Cat# C11875500BT DMEM medium Thermo Scientific Cat# C11995500BT Fetal bovine serum Suzhou Shuangru Biotechnology CO.td Cat# LONSERA/S711-001S MACS Tissue Storage Solution Miltenyi Cat# 130-100-008 Phosphate buffered saline (PBS) Hyclone Cat# SH30256.01 Collagenase Type II Sigma Cat# V900892 Collagenase Type IV Sigma Cat# C5138 Dispase II Roche Cat# 4942078001 Fetal bovine serum (FBS) Gibco Cat# 10100147C 6-Colour IHC kit for human Absin Cat# abs50014 6-Colour IHC kit for mouse Absin Cat# abs50030 CoCl 2 Macklin Cat# C885204 Cell Counting Kit-8 TargetMol Cat# C0005 Degarelix Acetate TargetMol Cat# 934016-19-0 Homoharringtonine TargetMol Cat# 26833-87-4 Experimental models 293T cell American Type Culture Collection (ATCC, USA) N/A (Continued on next page) Cell Reports Medicine 7, 102619, February 17, 2026 e2

Subcloning:

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

Protease Inhibitor:

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

Transfection:

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

Reverse Transcription:

Article Title: TMEM145 is a principal component of outer hair cell stereocilia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TMEM145 polyclonal antibody Atlas Antibodies Cat# HPA060462; RRID:AB_2684285 TUB antibody Proteintech Cat# 17928-1-AP; RRID:AB_2212236 Anti-STRC polyclonal antibody Eurogentec N/A ARL13B antibody Proteintech Cat# 17711-1-AP; RRID:AB_2060867 Anti-KCNQ4 Antibody Alomone Labs Cat# APC-164; RRID:AB_2341042 Mouse Anti-Eps8 Monoclonal Antibody, Unconjugated, Clone 15 BD Biosciences Cat# 610144; RRID:AB_397545 Recombinant Anti-LHFPL5 antibody [EPR16285] - C-terminal Abcam Cat# ab192242; RRID:AB_2942040 Anti-CDH23 Antibody Prof. Ulrich Müller, John Hopkins University55 N/A DYKDDDDK tag antibody Proteintech Cat# 80801-2-RR; RRID: AB_3670488 V5-tag antibody Proteintech Cat# 81775-4-RR; RRID:AB_3670504 HA tag antibody Proteintech Cat# 51064-2-AP; RRID:AB_11042321 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 488 Conjugated Thermo Fisher Scientific Cat# A-11008; RRID:AB_143165 Goat Anti-Rabbit IgG (H+L) Antibody, Alexa Fluor® 568 Conjugated Thermo Fisher Scientific Cat# A-11011; RRID:AB_143157 Goat Anti-Mouse IgG (H+L) Highly Crossadsorbed Antibody, Alexa Fluor® 647 Conjugated Thermo Fisher Scientific Cat# A-21236; RRID:AB_2535805 IRDye® 800CW Goat anti-Rabbit IgG LI-COR Biosciences Cat#926-32211; RRID: AB_621843 StarBright® Blue 700 Goat Anti-Mouse IgG Bio-Rad Cat# 12004159; RRID:AB_2884948 FluoTag®-X2 anti-ALFA AbberiorStar635P NanoTag Biotechnologies Cat# N1502-AB635P-L; RRID:AB_3075979 Bacterial and virus strains Subcloning EfficiencyTM DH5α Competent Cells Thermo Fisher Scientific Cat#18265017 Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail Sigma-Aldrich Cat#P8349 PMSF solution Merck Cat#10837091001 Triton® X-100 ROTH Cat#3051.3 jetPRIME® Polyplus Cat#101000046 Polyethylenimine (PEI) Custom-made N/A LipofectamineTM 2000 Transfection Reagent Thermo Fisher Scientific Cat#11668030 FM1-43 dye solution MedChemExpress Cat#HY-D1434 GSK-A1 SYNkinase Cat#SYN-1219-M001 DAPI Nucleic Acid Stain Thermo Fisher Scientific Cat#D1306 Phalloidin-iFluor 633 Reagent Abcam Cat#ab176758 Phalloidin-iFluor 405 Reagent Abcam Cat#ab176752 1,2-Bis(2-Aminophenoxy)ethaneN,N,N′,N′-tetraacetic acid (BAPTA) Sigma-Aldrich Cat#A4926 Poly-D-lysine Thermo Fisher Scientific Cat#A3890401 Critical commercial assays SuperScript IV Reverse Transcriptase Thermo Fisher Scientific Cat#18090010 (Continued on next page) ll OPEN ACCESS Article e1 Neuron 114, 1–15.e1–e7, August 5, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse brain total extracted RNA Ambion N/A Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat#F530S PfuUltra II Hotstart PCR Master Mix Agilent Cat#600852 EZviewTM Red ANTI-FLAG® M2 Affinity Gel Millipore Cat#F2426 Experimental models: Cell lines HEK293, Human Thermo Fisher Scientific Cat#11625019 HeLa, Human Prof. Ralf Jakob, Marburg56 N/A LLC-PK1-CL4, Pig James R. Bartles57 N/A Experimental models: Organisms/strains C57BL/6NCrl Charles River N/A C57BL/6NCrlTmem145em1(IMPC)Mbp/Mmucd MMRRC RRID:MMRRC_065589-UCD Tmem145mandolin/mandolin Potter et al.26 N/A STRC-KO Shubina-Oleinik et al.15 N/A Oligonucleotides See Table S1 N/A Recombinant DNA mTmem145-pEGFP-N1 This paper NM_183311.2 mTmem145ΔC-pEGFP-N1 This paper NM_183311.2 mTmem145-HA-pCDNA3.1(+) Genescript NM_183311.2 mTmem145-alfatag-pCDNA3.1(-) Genescript NM_183311.2 mTmem145-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔGOLD-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mTmem145ΔC-3xFLAG-pCDNA3.1(+) This paper NM_183311.2 mSTRC-Myc-pCDNA3.1(+) This paper NM_021885.4; Subcloning from Shubina-Oleinik et al.15 TagBFP2-CAAX This paper N/A pcDNA3.1-MYO10-HMM-Nanotrap Bird et al.25 Addgene; Cat#87255 pEGFP-MYO10-HMM Bird et al.25 Addgene; Cat#87256 mTubby-DsREDmono-pEGFP-C1 Thallmair et al.42 NM_021885.4; mTubby-pRFP-C1 Thallmair et al.42 NM_021885.4; mTubby-V5-pCDNA3.1(+) Genescript NM_021885.4 Software and algorithms Graphpad Prism v5.0 GraphPad Software https://www.graphpad.com Igor Pro v8.0.4.2 Wavemetrics https://www.wavemetrics.com/ Fiji v2.14.0 Schneider et al.58 https://fiji.sc/ PYMOL v2.1.0 Schrodinger https://www.pymol.org/ Biorender Biorender https://www.biorender.com/ Adobe Illustrator v30.0 Adobe Inc. https://www.adobe.com/ Snapgene Dotmatics https://www.snapgene.com/ RStudio v4.4.0 Posit https://posit.co/ Superplot package Lord et al.59 N/A Interface Residues script SB Grid Consortium https://pymolwiki.org/InterfaceResidues NanoSPD ImageJ macro This paper DOI:10.5281/zenodo.18840150 Other AlphaFold Jumper et al.32 https://alphafoldserver.com ll OPEN ACCESSArticle Neuron 114, 1–15.e1–e7, August 5, 2026 e2

FLAG-tag:

Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-rabbit METTL3 Abcam Cat#ab195352; RRID: AB_2721254 Anti-rabbit Collagen II Abcam Cat#ab307674; RRID: AB_731688 Anti-rabbit Collagen X Abcam Cat#ab260040; RRID: AB_3083555 Anti-rabbit SOX9 Abcam Cat#ab185966; RRID: AB_2728660 Anti-rabbit MMP3 Abcam Cat#ab52915; RRID: AB_881243 Anti-rabbit MMP13 Abcam Cat#ab39012; RRID: AB_776416 Anti-rabbit METTL14 Proteintech Cat# 26158-1-AP; RRID: AB_2800447 Anti-rabbit β-actin Proteintech Cat#81115-1-R; RRID: AB_2923704 Anti-rabbit ACAN Proteintech Cat#13880-1-AP; RRID: AB_2722780 Anti-rabbit Beclin 1 Proteintech Cat#11306-1-AP; RRID: AB_2259061 Anti-rabbit ATG5 Proteintech Cat10181-2-AP; RRID: AB_2062045 Anti-rabbit P21 Proteintech Cat#110355-1-AP; RRID: AB_2077682 Anti-rabbit P53 Proteintech Cat# 10442-1-AP; RRID: AB_2206609 Anti-rabbit HSC70 Proteintech Cat# 10654-1-AP; RRID: AB_2120153 Anti-rabbit EIF3A Proteintech Cat# 26178-1-AP; RRID: AB_2880413 Anti-rabbit EIF3B Proteintech Cat# 10319-1-AP; RRID: AB_2096732 Anti-rabbit RPS6 Proteintech Cat# 80208-1-RR; RRID: AB_2918876 Anti-rabbit FLAG tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Anti-rabbit HA-tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Anti-rabbit IgG Cell Signaling Technology Cat# 7074; RRID: AB_2099233 Anti-mouse IgG Cell Signaling Technology Cat# 7076; RRID: AB_330924 Anti-mouse puromycin Sigma-Aldrich Cat# MABE343; RRID: AB_2566826 Anti-rabbit ZDHHC24 Invitrogen Cat# PA5-53461; RRID: AB_2649860 Anti-rabbit Fluorescein Invitrogen Cat# A-889; RRID: AB_221561 Alexa Fluor 488 goat anti-mouse Invitrogen Cat# A11029; RRID: AB_2534088 Alexa Fluor 488 goat anti-rabbit Invitrogen Cat# A11034; RRID: AB_2576217 Alexa Fluor 568 goat anti-mouse Invitrogen Cat# A11031; RRID: AB_144696 Alexa Fluor 568 goat anti-rabbit Invitrogen Cat# A11036; RRID: AB_10563566 Chemicals, peptides, and recombinant proteins D-PBS Stemcell Cat#37350 mTeSR TM 1 Basal Medium Stemcell Cat#354240 mTeSR TM 1 5X Supplement Stemcell Cat#354240 STEMdiff TM Trilineage Differentiation Kit Stemcell Cat# 05230 Gentle Cell Dissociation Reagent Stemcell Cat#100-0485 DMEM/F-12 Stemcell Cat#36254 Dispase Stemcell Cat#07913 Human IL-1 beta Protein MedChemExpress Cat#HY-P73149 Anti-Flag Magnetic Beads MedChemExpress Cat# HY-K0207 Anti-HA Magnetic Beads MedChemExpress Cat# HY-K0201 3-Methyladenine MedChemExpress Cat# 5142-23-4 Cycloheximide MedChemExpress Cat# HY-12320 Copper sulfate anhydrous MedChemExpress Cat# HY-Y1878C Carfilzomib MedChemExpress Cat# HY-10455 (Continued on next page) 18 Cell Reports 45, 116993, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Palmitic acid MedChemExpress Cat# HY-N0830 Chloroquine MedChemExpress Cat#HY-17589A IA-Alkyne MedChemExpress Cat#HY-136205 IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Triton X-100 Sigma-Aldrich Cat# T9284 Polybrene Sigma-Aldrich Cat# H9268 Puromycin Sigma-Aldrich Cat# P9620 Hydroxylamine Sigma-Aldrich Cat# 467804 DTT Sigma-Aldrich Cat# 43815 NH 4 Cl Sigma-Aldrich Cat# A9434 Duolink® In Situ PLA® Probe Anti-Rabbit PLUS, Affinity purified Donkey anti-Rabbit IgG (H + L) Sigma-Aldrich Cat# DUO92002 Duolink® In Situ PLA® Probe Anti-Mouse MINUS, Affinity purified Donkey anti-Mouse IgG (H + L) Sigma-Aldrich Cat# DUO92004 Duolink® In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink® In Situ Wash Buffers, Fluorescence Sigma-Aldrich Cat# DUO82049 Duolink® In Situ Mounting Medium with DAPI Sigma-Aldrich Cat# DUO82040 Tris(2-carboxyethyl) phosphine hydrochloride solution (TCEP) Sigma-Aldrich Cat# 646547 Human TNF-a Protein Sigma-Aldrich Cat# SRP3177 N-Ethylmaleimide Sigma-Aldrich Cat# 04260 Dexamethasone Sigma-Aldrich Cat# D4902 2-Bromohexadecanoic acid Sigma-Aldrich Cat# 21604 Iodoacetamide Sigma-Aldrich Cat# I6125 MMTS Sigma-Aldrich Cat# 208795 DNase I Sigma-Aldrich Cat# 11284932001 Collagenase Type 1 Sigma-Aldrich Cat# LS004197 Insulin-transferrin-selenium (ITS) Invitrogen Cat# 41400045 EDTA Invitrogen Cat# AM9260G NaCl Invitrogen Cat# AM9759 HEPES Invitrogen Cat# 15630130 EDTA decalcifying solution Solarbio Cat# E1171 Toluidine Blue Stain Solution Solarbio Cat# G3660 Ascorbic acid Solarbio Cat#A8100 Corning® Matrigel® hESC-Qualified Matrix Corning Cat# 354277 High Capacity Thiol Reactive Resin Nanocs Cat# AR-SS-2 Alk-16 Click Chemistry Tools Cat# CCT-1165 OG488 Azide Click Chemistry Tools Cat# 1264–1 Biotin BMCC Sangon Biotech Cat# C100222 Nuclease-Free Water Promega Cat# P1199 Critical commercial assays CoraLite®488 Plus TUNELApoptosis Detection Kit I Proteintech Cat# PF00006 Alcian blue Stain Kit Solarbio Cat# G1565 Modified Saffron-O and Fast Green Stain Kit Solarbio Cat# G1371 QuikCyto® Mouse KC/IL-8 ELISA kit Neobioscience Cat# EMC104QT.96 QuikCyto® Mouse IL-6 ELISA kit Neobioscience Cat# EMC004QT.96 QuikCyto® Mouse TNF-α ELISA kit Neobioscience Cat# EMC102aQT.96 m 6 A RNA Methylation Assay Kit Abcam Cat#ab185912 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat# R323-01 (Continued on next page) Cell Reports 45, 116993, March 24, 2026 19

Gentle:

Article Title: Small-molecule enhancement of METTL3 S-palmitoylation as a therapeutic strategy for osteoarthritis.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-rabbit METTL3 Abcam Cat#ab195352; RRID: AB_2721254 Anti-rabbit Collagen II Abcam Cat#ab307674; RRID: AB_731688 Anti-rabbit Collagen X Abcam Cat#ab260040; RRID: AB_3083555 Anti-rabbit SOX9 Abcam Cat#ab185966; RRID: AB_2728660 Anti-rabbit MMP3 Abcam Cat#ab52915; RRID: AB_881243 Anti-rabbit MMP13 Abcam Cat#ab39012; RRID: AB_776416 Anti-rabbit METTL14 Proteintech Cat# 26158-1-AP; RRID: AB_2800447 Anti-rabbit β-actin Proteintech Cat#81115-1-R; RRID: AB_2923704 Anti-rabbit ACAN Proteintech Cat#13880-1-AP; RRID: AB_2722780 Anti-rabbit Beclin 1 Proteintech Cat#11306-1-AP; RRID: AB_2259061 Anti-rabbit ATG5 Proteintech Cat10181-2-AP; RRID: AB_2062045 Anti-rabbit P21 Proteintech Cat#110355-1-AP; RRID: AB_2077682 Anti-rabbit P53 Proteintech Cat# 10442-1-AP; RRID: AB_2206609 Anti-rabbit HSC70 Proteintech Cat# 10654-1-AP; RRID: AB_2120153 Anti-rabbit EIF3A Proteintech Cat# 26178-1-AP; RRID: AB_2880413 Anti-rabbit EIF3B Proteintech Cat# 10319-1-AP; RRID: AB_2096732 Anti-rabbit RPS6 Proteintech Cat# 80208-1-RR; RRID: AB_2918876 Anti-rabbit FLAG tag Proteintech Cat# 20543-1-AP; RRID: AB_11232216 Anti-rabbit HA-tag Proteintech Cat# 51064-2-AP; RRID: AB_11042321 Anti-rabbit IgG Cell Signaling Technology Cat# 7074; RRID: AB_2099233 Anti-mouse IgG Cell Signaling Technology Cat# 7076; RRID: AB_330924 Anti-mouse puromycin Sigma-Aldrich Cat# MABE343; RRID: AB_2566826 Anti-rabbit ZDHHC24 Invitrogen Cat# PA5-53461; RRID: AB_2649860 Anti-rabbit Fluorescein Invitrogen Cat# A-889; RRID: AB_221561 Alexa Fluor 488 goat anti-mouse Invitrogen Cat# A11029; RRID: AB_2534088 Alexa Fluor 488 goat anti-rabbit Invitrogen Cat# A11034; RRID: AB_2576217 Alexa Fluor 568 goat anti-mouse Invitrogen Cat# A11031; RRID: AB_144696 Alexa Fluor 568 goat anti-rabbit Invitrogen Cat# A11036; RRID: AB_10563566 Chemicals, peptides, and recombinant proteins D-PBS Stemcell Cat#37350 mTeSR TM 1 Basal Medium Stemcell Cat#354240 mTeSR TM 1 5X Supplement Stemcell Cat#354240 STEMdiff TM Trilineage Differentiation Kit Stemcell Cat# 05230 Gentle Cell Dissociation Reagent Stemcell Cat#100-0485 DMEM/F-12 Stemcell Cat#36254 Dispase Stemcell Cat#07913 Human IL-1 beta Protein MedChemExpress Cat#HY-P73149 Anti-Flag Magnetic Beads MedChemExpress Cat# HY-K0207 Anti-HA Magnetic Beads MedChemExpress Cat# HY-K0201 3-Methyladenine MedChemExpress Cat# 5142-23-4 Cycloheximide MedChemExpress Cat# HY-12320 Copper sulfate anhydrous MedChemExpress Cat# HY-Y1878C Carfilzomib MedChemExpress Cat# HY-10455 (Continued on next page) 18 Cell Reports 45, 116993, March 24, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Palmitic acid MedChemExpress Cat# HY-N0830 Chloroquine MedChemExpress Cat#HY-17589A IA-Alkyne MedChemExpress Cat#HY-136205 IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Triton X-100 Sigma-Aldrich Cat# T9284 Polybrene Sigma-Aldrich Cat# H9268 Puromycin Sigma-Aldrich Cat# P9620 Hydroxylamine Sigma-Aldrich Cat# 467804 DTT Sigma-Aldrich Cat# 43815 NH 4 Cl Sigma-Aldrich Cat# A9434 Duolink® In Situ PLA® Probe Anti-Rabbit PLUS, Affinity purified Donkey anti-Rabbit IgG (H + L) Sigma-Aldrich Cat# DUO92002 Duolink® In Situ PLA® Probe Anti-Mouse MINUS, Affinity purified Donkey anti-Mouse IgG (H + L) Sigma-Aldrich Cat# DUO92004 Duolink® In Situ Detection Reagents Red Sigma-Aldrich Cat# DUO92008 Duolink® In Situ Wash Buffers, Fluorescence Sigma-Aldrich Cat# DUO82049 Duolink® In Situ Mounting Medium with DAPI Sigma-Aldrich Cat# DUO82040 Tris(2-carboxyethyl) phosphine hydrochloride solution (TCEP) Sigma-Aldrich Cat# 646547 Human TNF-a Protein Sigma-Aldrich Cat# SRP3177 N-Ethylmaleimide Sigma-Aldrich Cat# 04260 Dexamethasone Sigma-Aldrich Cat# D4902 2-Bromohexadecanoic acid Sigma-Aldrich Cat# 21604 Iodoacetamide Sigma-Aldrich Cat# I6125 MMTS Sigma-Aldrich Cat# 208795 DNase I Sigma-Aldrich Cat# 11284932001 Collagenase Type 1 Sigma-Aldrich Cat# LS004197 Insulin-transferrin-selenium (ITS) Invitrogen Cat# 41400045 EDTA Invitrogen Cat# AM9260G NaCl Invitrogen Cat# AM9759 HEPES Invitrogen Cat# 15630130 EDTA decalcifying solution Solarbio Cat# E1171 Toluidine Blue Stain Solution Solarbio Cat# G3660 Ascorbic acid Solarbio Cat#A8100 Corning® Matrigel® hESC-Qualified Matrix Corning Cat# 354277 High Capacity Thiol Reactive Resin Nanocs Cat# AR-SS-2 Alk-16 Click Chemistry Tools Cat# CCT-1165 OG488 Azide Click Chemistry Tools Cat# 1264–1 Biotin BMCC Sangon Biotech Cat# C100222 Nuclease-Free Water Promega Cat# P1199 Critical commercial assays CoraLite®488 Plus TUNELApoptosis Detection Kit I Proteintech Cat# PF00006 Alcian blue Stain Kit Solarbio Cat# G1565 Modified Saffron-O and Fast Green Stain Kit Solarbio Cat# G1371 QuikCyto® Mouse KC/IL-8 ELISA kit Neobioscience Cat# EMC104QT.96 QuikCyto® Mouse IL-6 ELISA kit Neobioscience Cat# EMC004QT.96 QuikCyto® Mouse TNF-α ELISA kit Neobioscience Cat# EMC102aQT.96 m 6 A RNA Methylation Assay Kit Abcam Cat#ab185912 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat# R323-01 (Continued on next page) Cell Reports 45, 116993, March 24, 2026 19



Similar Products

94
Thermo Fisher n 2 hydroxyethylpiperazine n 2 ethane sulfonic acid
N 2 Hydroxyethylpiperazine N 2 Ethane Sulfonic Acid, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/HEPES%2C+1%2E0M+buffer+soln%2E%2C+pH+6%2E5/pmc13240773-188-19-23
Average 94 stars, based on 1 article reviews
n 2 hydroxyethylpiperazine n 2 ethane sulfonic acid - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Proteintech ampk
Ampk, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/CDO1+Antibody/pmc12933830-167-36-37
Average 93 stars, based on 1 article reviews
ampk - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Proteintech calnexin
Senescent Microenvironment-Educated Mesenchymal Stem Cells Release High-Affinity Senescent NPC Domesticated Extracellular Vesicles. (A) Schematic diagram of the experimental setup for educating MSCs with SASP-CM to generate D-EVs versus N-EVs. (B) Confocal microscopy images showing different EVs internalization by senescent NPCs after 12 h in vitro. (C) Flow cytometry and quantification analysis of different EVs uptake by senescent NPCs. (D) In vivo validation of the senescent niche. Representative fluorescence images following injection of senescence-tracer (Red). (E) In vivo PKH26-labeled D-EVs tracking. (F) Representative SA-β-Gal images and quantification of MSCs treated with SASP-CM or not. (G) Gene Ontology (GO) analysis confirming enrichment of external encapsulating structure organization and cytokine production in Biological Process (BP) categories. (H) Heatmap indicating gene expression associated with EVs biogenesis within D-MSCs and N-MSCs. (I) Heatmap indicating gene expression associated with cytokine production within D-MSCs and N-MSCs. (J and L) Gene Ontology (GO) analysis confirming enrichment of terms related to vesicle organization and transport in the Cellular Component (CC) categories. (K) Western blot analysis confirmed core senescence markers p16 and p21 and DNA damage marker γ-H2AX in N-MSC and D-MSC. (M) Western blot analysis confirmed the expression of CD9, <t>CD63,</t> <t>TSG101,</t> <t>Calnexin,</t> and GM130 in MSC-EVs, N-EVs, or D-EVs. (N) TEM images showing the morphology and size of MSC-derived EVs, N-EVs, and D-EVs. (O) NTA shows size distribution in MSC-EVs, N-EVs, or D-EVs. The data were presented as mean ± SD. n = 3, ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Calnexin, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/Calnexin+Antibody/pmc12963922-502-36-39
Average 96 stars, based on 1 article reviews
calnexin - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
Thermo Fisher sodium chromate vi
Senescent Microenvironment-Educated Mesenchymal Stem Cells Release High-Affinity Senescent NPC Domesticated Extracellular Vesicles. (A) Schematic diagram of the experimental setup for educating MSCs with SASP-CM to generate D-EVs versus N-EVs. (B) Confocal microscopy images showing different EVs internalization by senescent NPCs after 12 h in vitro. (C) Flow cytometry and quantification analysis of different EVs uptake by senescent NPCs. (D) In vivo validation of the senescent niche. Representative fluorescence images following injection of senescence-tracer (Red). (E) In vivo PKH26-labeled D-EVs tracking. (F) Representative SA-β-Gal images and quantification of MSCs treated with SASP-CM or not. (G) Gene Ontology (GO) analysis confirming enrichment of external encapsulating structure organization and cytokine production in Biological Process (BP) categories. (H) Heatmap indicating gene expression associated with EVs biogenesis within D-MSCs and N-MSCs. (I) Heatmap indicating gene expression associated with cytokine production within D-MSCs and N-MSCs. (J and L) Gene Ontology (GO) analysis confirming enrichment of terms related to vesicle organization and transport in the Cellular Component (CC) categories. (K) Western blot analysis confirmed core senescence markers p16 and p21 and DNA damage marker γ-H2AX in N-MSC and D-MSC. (M) Western blot analysis confirmed the expression of CD9, <t>CD63,</t> <t>TSG101,</t> <t>Calnexin,</t> and GM130 in MSC-EVs, N-EVs, or D-EVs. (N) TEM images showing the morphology and size of MSC-derived EVs, N-EVs, and D-EVs. (O) NTA shows size distribution in MSC-EVs, N-EVs, or D-EVs. The data were presented as mean ± SD. n = 3, ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Sodium Chromate Vi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/Chromate%2C+Ion+chromatography+standard+solution%2C+Specpure+CrO4%26mid%3B-2/pm42365975-38-30-35
Average 94 stars, based on 1 article reviews
sodium chromate vi - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Thermo Fisher methylbutane
Senescent Microenvironment-Educated Mesenchymal Stem Cells Release High-Affinity Senescent NPC Domesticated Extracellular Vesicles. (A) Schematic diagram of the experimental setup for educating MSCs with SASP-CM to generate D-EVs versus N-EVs. (B) Confocal microscopy images showing different EVs internalization by senescent NPCs after 12 h in vitro. (C) Flow cytometry and quantification analysis of different EVs uptake by senescent NPCs. (D) In vivo validation of the senescent niche. Representative fluorescence images following injection of senescence-tracer (Red). (E) In vivo PKH26-labeled D-EVs tracking. (F) Representative SA-β-Gal images and quantification of MSCs treated with SASP-CM or not. (G) Gene Ontology (GO) analysis confirming enrichment of external encapsulating structure organization and cytokine production in Biological Process (BP) categories. (H) Heatmap indicating gene expression associated with EVs biogenesis within D-MSCs and N-MSCs. (I) Heatmap indicating gene expression associated with cytokine production within D-MSCs and N-MSCs. (J and L) Gene Ontology (GO) analysis confirming enrichment of terms related to vesicle organization and transport in the Cellular Component (CC) categories. (K) Western blot analysis confirmed core senescence markers p16 and p21 and DNA damage marker γ-H2AX in N-MSC and D-MSC. (M) Western blot analysis confirmed the expression of CD9, <t>CD63,</t> <t>TSG101,</t> <t>Calnexin,</t> and GM130 in MSC-EVs, N-EVs, or D-EVs. (N) TEM images showing the morphology and size of MSC-derived EVs, N-EVs, and D-EVs. (O) NTA shows size distribution in MSC-EVs, N-EVs, or D-EVs. The data were presented as mean ± SD. n = 3, ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Methylbutane, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/2-Methylbutane%2C+99%2B%25/pm42360227-63-17-10
Average 94 stars, based on 1 article reviews
methylbutane - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

99
Thermo Fisher methylbutane thermo scientific 019387 triton x 100 sigma x100 prolong gold antifade mountant
Senescent Microenvironment-Educated Mesenchymal Stem Cells Release High-Affinity Senescent NPC Domesticated Extracellular Vesicles. (A) Schematic diagram of the experimental setup for educating MSCs with SASP-CM to generate D-EVs versus N-EVs. (B) Confocal microscopy images showing different EVs internalization by senescent NPCs after 12 h in vitro. (C) Flow cytometry and quantification analysis of different EVs uptake by senescent NPCs. (D) In vivo validation of the senescent niche. Representative fluorescence images following injection of senescence-tracer (Red). (E) In vivo PKH26-labeled D-EVs tracking. (F) Representative SA-β-Gal images and quantification of MSCs treated with SASP-CM or not. (G) Gene Ontology (GO) analysis confirming enrichment of external encapsulating structure organization and cytokine production in Biological Process (BP) categories. (H) Heatmap indicating gene expression associated with EVs biogenesis within D-MSCs and N-MSCs. (I) Heatmap indicating gene expression associated with cytokine production within D-MSCs and N-MSCs. (J and L) Gene Ontology (GO) analysis confirming enrichment of terms related to vesicle organization and transport in the Cellular Component (CC) categories. (K) Western blot analysis confirmed core senescence markers p16 and p21 and DNA damage marker γ-H2AX in N-MSC and D-MSC. (M) Western blot analysis confirmed the expression of CD9, <t>CD63,</t> <t>TSG101,</t> <t>Calnexin,</t> and GM130 in MSC-EVs, N-EVs, or D-EVs. (N) TEM images showing the morphology and size of MSC-derived EVs, N-EVs, and D-EVs. (O) NTA shows size distribution in MSC-EVs, N-EVs, or D-EVs. The data were presented as mean ± SD. n = 3, ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Methylbutane Thermo Scientific 019387 Triton X 100 Sigma X100 Prolong Gold Antifade Mountant, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/Triton+X-100/pm42349424-137-31-32
Average 99 stars, based on 1 article reviews
methylbutane thermo scientific 019387 triton x 100 sigma x100 prolong gold antifade mountant - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Thermo Fisher dulbecco s phosphate buffered saline without ca 2 and mg 2
Propagation of calcium signal within microglia after ATP stimulation (A) Baseline GCaMP8s expression. (B) Regions of interest (ROIs): one somatic (ROI 1) and two distal regions (ROI <t>2</t> <t>and</t> 3) were chosen. (C) Snapshots showing propagation of the fluorescence signal within the cell following ATP stimulation. (D) Normalized fluorescence traces (ΔF/F0, F0 = mean fluorescence intensity over 10 s prior to stimuli) recorded from ROIs in B. The period shaded in green indicates when ATP was present in the recording chamber. ROI 3 (most distal) exhibits spontaneous activity prior to stimulation, indicated by asterisks. Dashed vertical lines indicate time points (t0-t3) corresponding to images in C.
Dulbecco S Phosphate Buffered Saline Without Ca 2 And Mg 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/Phosphate-buffered+saline+(DPBS%2C+10X)%2C+Dulbecco's+formula%2C+without+calcium%2C+without+magnesium/pmc13068558-20-0-14
Average 96 stars, based on 1 article reviews
dulbecco s phosphate buffered saline without ca 2 and mg 2 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
Thermo Fisher phosphate buffered saline
Propagation of calcium signal within microglia after ATP stimulation (A) Baseline GCaMP8s expression. (B) Regions of interest (ROIs): one somatic (ROI 1) and two distal regions (ROI <t>2</t> <t>and</t> 3) were chosen. (C) Snapshots showing propagation of the fluorescence signal within the cell following ATP stimulation. (D) Normalized fluorescence traces (ΔF/F0, F0 = mean fluorescence intensity over 10 s prior to stimuli) recorded from ROIs in B. The period shaded in green indicates when ATP was present in the recording chamber. ROI 3 (most distal) exhibits spontaneous activity prior to stimulation, indicated by asterisks. Dashed vertical lines indicate time points (t0-t3) corresponding to images in C.
Phosphate Buffered Saline, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/Phosphate%2C+0%2E2M+buffer+soln%2E%2C+pH+7%2E2/pm42274909-129-7-13
Average 94 stars, based on 1 article reviews
phosphate buffered saline - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Thermo Fisher tris hcl
Propagation of calcium signal within microglia after ATP stimulation (A) Baseline GCaMP8s expression. (B) Regions of interest (ROIs): one somatic (ROI 1) and two distal regions (ROI <t>2</t> <t>and</t> 3) were chosen. (C) Snapshots showing propagation of the fluorescence signal within the cell following ATP stimulation. (D) Normalized fluorescence traces (ΔF/F0, F0 = mean fluorescence intensity over 10 s prior to stimuli) recorded from ROIs in B. The period shaded in green indicates when ATP was present in the recording chamber. ROI 3 (most distal) exhibits spontaneous activity prior to stimulation, indicated by asterisks. Dashed vertical lines indicate time points (t0-t3) corresponding to images in C.
Tris Hcl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/TRIS%2C+1%2E0M+buffer+soln%2E%2C+pH+7%2E5%2C+0%2E2+micron+filtered/bio_rxiv__64898__2026__06__05__730395-391-53-58
Average 94 stars, based on 1 article reviews
tris hcl - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
Thermo Fisher pb 0 2 m na 2 hpo 4 acros organics 448150010 54 mm nah 2 po 4 acros organics 447760010 dissolved in ddh 2 o ph 7 4
Propagation of calcium signal within microglia after ATP stimulation (A) Baseline GCaMP8s expression. (B) Regions of interest (ROIs): one somatic (ROI 1) and two distal regions (ROI <t>2</t> <t>and</t> 3) were chosen. (C) Snapshots showing propagation of the fluorescence signal within the cell following ATP stimulation. (D) Normalized fluorescence traces (ΔF/F0, F0 = mean fluorescence intensity over 10 s prior to stimuli) recorded from ROIs in B. The period shaded in green indicates when ATP was present in the recording chamber. ROI 3 (most distal) exhibits spontaneous activity prior to stimulation, indicated by asterisks. Dashed vertical lines indicate time points (t0-t3) corresponding to images in C.
Pb 0 2 M Na 2 Hpo 4 Acros Organics 448150010 54 Mm Nah 2 Po 4 Acros Organics 447760010 Dissolved In Ddh 2 O Ph 7 4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/2+ap/Sodium+phosphate%2C+0%2E2M+buffer+soln%2E%2C+pH+7%2E4/bio_rxiv__64898__2026__06__07__730560-281-45-53
Average 95 stars, based on 1 article reviews
pb 0 2 m na 2 hpo 4 acros organics 448150010 54 mm nah 2 po 4 acros organics 447760010 dissolved in ddh 2 o ph 7 4 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


Senescent Microenvironment-Educated Mesenchymal Stem Cells Release High-Affinity Senescent NPC Domesticated Extracellular Vesicles. (A) Schematic diagram of the experimental setup for educating MSCs with SASP-CM to generate D-EVs versus N-EVs. (B) Confocal microscopy images showing different EVs internalization by senescent NPCs after 12 h in vitro. (C) Flow cytometry and quantification analysis of different EVs uptake by senescent NPCs. (D) In vivo validation of the senescent niche. Representative fluorescence images following injection of senescence-tracer (Red). (E) In vivo PKH26-labeled D-EVs tracking. (F) Representative SA-β-Gal images and quantification of MSCs treated with SASP-CM or not. (G) Gene Ontology (GO) analysis confirming enrichment of external encapsulating structure organization and cytokine production in Biological Process (BP) categories. (H) Heatmap indicating gene expression associated with EVs biogenesis within D-MSCs and N-MSCs. (I) Heatmap indicating gene expression associated with cytokine production within D-MSCs and N-MSCs. (J and L) Gene Ontology (GO) analysis confirming enrichment of terms related to vesicle organization and transport in the Cellular Component (CC) categories. (K) Western blot analysis confirmed core senescence markers p16 and p21 and DNA damage marker γ-H2AX in N-MSC and D-MSC. (M) Western blot analysis confirmed the expression of CD9, CD63, TSG101, Calnexin, and GM130 in MSC-EVs, N-EVs, or D-EVs. (N) TEM images showing the morphology and size of MSC-derived EVs, N-EVs, and D-EVs. (O) NTA shows size distribution in MSC-EVs, N-EVs, or D-EVs. The data were presented as mean ± SD. n = 3, ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

Journal: Bioactive Materials

Article Title: Microenvironment-educated MSC-EVs loaded injectable smart hydrogel for targeting senescent nucleus pulposus cells and inhibiting ferroptosis against intervertebral disc degeneration

doi: 10.1016/j.bioactmat.2026.02.030

Figure Lengend Snippet: Senescent Microenvironment-Educated Mesenchymal Stem Cells Release High-Affinity Senescent NPC Domesticated Extracellular Vesicles. (A) Schematic diagram of the experimental setup for educating MSCs with SASP-CM to generate D-EVs versus N-EVs. (B) Confocal microscopy images showing different EVs internalization by senescent NPCs after 12 h in vitro. (C) Flow cytometry and quantification analysis of different EVs uptake by senescent NPCs. (D) In vivo validation of the senescent niche. Representative fluorescence images following injection of senescence-tracer (Red). (E) In vivo PKH26-labeled D-EVs tracking. (F) Representative SA-β-Gal images and quantification of MSCs treated with SASP-CM or not. (G) Gene Ontology (GO) analysis confirming enrichment of external encapsulating structure organization and cytokine production in Biological Process (BP) categories. (H) Heatmap indicating gene expression associated with EVs biogenesis within D-MSCs and N-MSCs. (I) Heatmap indicating gene expression associated with cytokine production within D-MSCs and N-MSCs. (J and L) Gene Ontology (GO) analysis confirming enrichment of terms related to vesicle organization and transport in the Cellular Component (CC) categories. (K) Western blot analysis confirmed core senescence markers p16 and p21 and DNA damage marker γ-H2AX in N-MSC and D-MSC. (M) Western blot analysis confirmed the expression of CD9, CD63, TSG101, Calnexin, and GM130 in MSC-EVs, N-EVs, or D-EVs. (N) TEM images showing the morphology and size of MSC-derived EVs, N-EVs, and D-EVs. (O) NTA shows size distribution in MSC-EVs, N-EVs, or D-EVs. The data were presented as mean ± SD. n = 3, ns, not significant; ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

Article Snippet: After blocked with 5% non-fat milk for 2 h at room temperature, the membranes were incubated with primary antibodies against GAPDH (1:5000, 104941-AP, Proteintech), TSG101 (1:1000, DF8427, Affinity), CD9 (1:1000, AF5139, Affinity), CD63 (1:2000, 25682-1-AP, Proteintech), Calnexin (1:5000, 10427-2-AP, Proteintech), GM130 (1:20000, 11308-1-AP, Proteintech), CXCR3 (1:5000, 26756-1-AP, Proteintech), CXCL10 (1:2000, 10937-1-AP, Proteintech), MMP3 (1:2000, 17873-1-AP, Proteintech), ADAMTS5 (DF13268, Affinity), P16 (AF5484, Affinity), P21 (10355-1-AP, Proteintech), GPX4 (1:1000, 381958, Zen-bio), SLC7A11 (1:1000, 26864-1-AP, Proteintech), ACSL4 (1:5000, 22401-1-AP, Proteintech) and Tubulin (1:10000, T40103 , Abmart) overnight at 4 °C.

Techniques: Confocal Microscopy, In Vitro, Flow Cytometry, In Vivo, Biomarker Discovery, Fluorescence, Injection, Labeling, Gene Expression, Western Blot, Marker, Expressing, Derivative Assay

Propagation of calcium signal within microglia after ATP stimulation (A) Baseline GCaMP8s expression. (B) Regions of interest (ROIs): one somatic (ROI 1) and two distal regions (ROI 2 and 3) were chosen. (C) Snapshots showing propagation of the fluorescence signal within the cell following ATP stimulation. (D) Normalized fluorescence traces (ΔF/F0, F0 = mean fluorescence intensity over 10 s prior to stimuli) recorded from ROIs in B. The period shaded in green indicates when ATP was present in the recording chamber. ROI 3 (most distal) exhibits spontaneous activity prior to stimulation, indicated by asterisks. Dashed vertical lines indicate time points (t0-t3) corresponding to images in C.

Journal: STAR Protocols

Article Title: Protocol for differentiation and efficient AAV-mediated gene delivery to hiPSC-derived microglia for functional studies

doi: 10.1016/j.xpro.2026.104455

Figure Lengend Snippet: Propagation of calcium signal within microglia after ATP stimulation (A) Baseline GCaMP8s expression. (B) Regions of interest (ROIs): one somatic (ROI 1) and two distal regions (ROI 2 and 3) were chosen. (C) Snapshots showing propagation of the fluorescence signal within the cell following ATP stimulation. (D) Normalized fluorescence traces (ΔF/F0, F0 = mean fluorescence intensity over 10 s prior to stimuli) recorded from ROIs in B. The period shaded in green indicates when ATP was present in the recording chamber. ROI 3 (most distal) exhibits spontaneous activity prior to stimulation, indicated by asterisks. Dashed vertical lines indicate time points (t0-t3) corresponding to images in C.

Article Snippet: Dulbecco’s phosphate buffered saline without Ca 2+ and Mg 2+ , DPBS (−/−) , Thermo Fisher Scientific , 14190–086.

Techniques: Expressing, Fluorescence, Activity Assay

Journal: STAR Protocols

Article Title: Protocol for differentiation and efficient AAV-mediated gene delivery to hiPSC-derived microglia for functional studies

doi: 10.1016/j.xpro.2026.104455

Figure Lengend Snippet:

Article Snippet: Dulbecco’s phosphate buffered saline without Ca 2+ and Mg 2+ , DPBS (−/−) , Thermo Fisher Scientific , 14190–086.

Techniques: Virus, Recombinant, Saline, Plasmid Preparation, Expressing, Software, Hood, Sterility, Electron Microscopy, Inverted Microscopy, Flow Cytometry, Microscopy, Cell Culture, Fluorescence, Imaging, Dispersion