cas9 rna (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc cas9 rna

<t>CRISPR/Cas9‐based</t> genome editing allows for the generation of a Tollip‐deficient zebrafish line. (A) Schemes of the zebrafish tollip transcript variants 1 and 2 (v1 and v2), based on the Ensembl database, showing exons (E), translated sequences (gray), and UTR regions (white). (B) Schematic illustration of the structure of Tollip protein isoforms with the C2 and CUE domains indicated. (C) Partial DNA sequence of the target site within exon 2 of the tollip gene in wild‐type tollip +/+ fish (left) and homozygous tollip −/− knockout fish (right). Deletion of eight nucleotides observed in the mutant line is shadowed in dark gray. There is an additional nucleotide change flanking the deletion (double peak marked R in the chromatogram, corresponding to A or G, with a predicted amino acid change D to G in the truncated protein product), indicating mosaicism of the generated line. (D) Schematic illustration of the predicted structure of Tollip protein isoforms synthesized from the mutated tollip gene. (E) Western blot of the 5 dpf protein lysates from the wild‐type ( tollip +/+ ) line and tollip −/− siblings. Top panel shows Tollip (~ 35 kDa) and a bottom panel shows α‐tubulin (~ 55 kDa) signal. (F) qPCR analysis of the expression of tollip transcripts during early zebrafish development (1–5 dpf). Bars represent the means ± SEM from 3–4 independent experiments (encompassing a pool of 10 larvae/condition). Mann–Whitney U test, * P < 0.05, ****P < 0.0001.

Cas9 Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zebrafish+codon+optimized+cas9+coding+sequence/PCS2%2B+Cas9+(Plasmid+%23122948)/pmc09340867-157-1-12
Average 93 stars, based on 49 article reviews

cas9 rna - by Bioz Stars, 2026-09

93/100 stars

Images

1) Product Images from "Tollip‐deficient zebrafish display no abnormalities in development, organ morphology or gene expression in response to lipopolysaccharide"

Article Title: Tollip‐deficient zebrafish display no abnormalities in development, organ morphology or gene expression in response to lipopolysaccharide

Journal: FEBS Open Bio

doi: 10.1002/2211-5463.13423

CRISPR/Cas9‐based genome editing allows for the generation of a Tollip‐deficient zebrafish line. (A) Schemes of the zebrafish tollip transcript variants 1 and 2 (v1 and v2), based on the Ensembl database, showing exons (E), translated sequences (gray), and UTR regions (white). (B) Schematic illustration of the structure of Tollip protein isoforms with the C2 and CUE domains indicated. (C) Partial DNA sequence of the target site within exon 2 of the tollip gene in wild‐type tollip +/+ fish (left) and homozygous tollip −/− knockout fish (right). Deletion of eight nucleotides observed in the mutant line is shadowed in dark gray. There is an additional nucleotide change flanking the deletion (double peak marked R in the chromatogram, corresponding to A or G, with a predicted amino acid change D to G in the truncated protein product), indicating mosaicism of the generated line. (D) Schematic illustration of the predicted structure of Tollip protein isoforms synthesized from the mutated tollip gene. (E) Western blot of the 5 dpf protein lysates from the wild‐type ( tollip +/+ ) line and tollip −/− siblings. Top panel shows Tollip (~ 35 kDa) and a bottom panel shows α‐tubulin (~ 55 kDa) signal. (F) qPCR analysis of the expression of tollip transcripts during early zebrafish development (1–5 dpf). Bars represent the means ± SEM from 3–4 independent experiments (encompassing a pool of 10 larvae/condition). Mann–Whitney U test, * P < 0.05, ****P < 0.0001.

Figure Legend Snippet: CRISPR/Cas9‐based genome editing allows for the generation of a Tollip‐deficient zebrafish line. (A) Schemes of the zebrafish tollip transcript variants 1 and 2 (v1 and v2), based on the Ensembl database, showing exons (E), translated sequences (gray), and UTR regions (white). (B) Schematic illustration of the structure of Tollip protein isoforms with the C2 and CUE domains indicated. (C) Partial DNA sequence of the target site within exon 2 of the tollip gene in wild‐type tollip +/+ fish (left) and homozygous tollip −/− knockout fish (right). Deletion of eight nucleotides observed in the mutant line is shadowed in dark gray. There is an additional nucleotide change flanking the deletion (double peak marked R in the chromatogram, corresponding to A or G, with a predicted amino acid change D to G in the truncated protein product), indicating mosaicism of the generated line. (D) Schematic illustration of the predicted structure of Tollip protein isoforms synthesized from the mutated tollip gene. (E) Western blot of the 5 dpf protein lysates from the wild‐type ( tollip +/+ ) line and tollip −/− siblings. Top panel shows Tollip (~ 35 kDa) and a bottom panel shows α‐tubulin (~ 55 kDa) signal. (F) qPCR analysis of the expression of tollip transcripts during early zebrafish development (1–5 dpf). Bars represent the means ± SEM from 3–4 independent experiments (encompassing a pool of 10 larvae/condition). Mann–Whitney U test, * P < 0.05, ****P < 0.0001.

Techniques Used: CRISPR, Sequencing, Knock-Out, Mutagenesis, Generated, Synthesized, Western Blot, Expressing, MANN-WHITNEY

Synthesized:

Article Title: Live imaging endogenous transcription factor dynamics reveals mechanisms of epiblast and primitive endoderm fate segregation.
Article Snippet: Article Live imaging endogenous transcription factor dynamics reveals mechanisms of epiblast and primitive endoderm fate segregation

Article Title: Generative model for the first cell fate bifurcation in mammalian development
Article Snippet: .. Briefly, pCS2-H2B-miRFP720 plasmid (cloned into pCS2 vector using miRFP720 sequence obtained from Addgene plasmid #136560) or pCS2-Cas9 plasmid (Addgene 122948) was linearized with NotI (New England Biolabs, R3189L) digestion and mRNA was synthesized using an mMessage mMachine SP6 intro transcription kit (Thermo Fisher Scientific, AM1340). mRNA was purified using an RNeasy Cleanup kit (Qiagen, 74104). mRNA was eluted into RNAse-free water and stored at −80°C. ..

Plasmid Preparation:

Article Title: Assessment of hepatitis C virus permissiveness in iteratively genetically humanized mice
Article Snippet: .. Briefly, pCS2-Cas9 plasmid (Addgene 122948) was linearized with NotI restriction digestion (New England Biolabs, Ipswich, MA, R3189L) and used as a template for in vitro transcription using a mMESSAGE mMACHINE SP6 Transcription Kit (Thermo Fisher Scientific, Waltham, MA, AM1340). .. Cas9 mRNA was purified with the RNeasy Mini Kit (Qiagen, Germantown, MD, 74104) using the cleanup protocol according to manufacturer’s instructions.

Article Title: Assessment of hepatitis C virus permissiveness in iteratively genetically humanized mice.
Article Snippet: .. Briefly, pCS2-Cas9 plasmid (Addgene 122948) was linearized with NotI restriction digestion (New England Biolabs, Ipswich, MA, R3189L) and used as a template for in vitro transcription using a mMESSAGE mMACHINE SP6 Transcription Kit (Thermo Fisher Scientific, Waltham, MA, AM1340). .. Cas9 mRNA was purified with the RNeasy Mini Kit (Qiagen, Germantown, MD, 74104) using the cleanup protocol according to manufacturer’s instructions.

Article Title: Live imaging endogenous transcription factor dynamics reveals mechanisms of epiblast and primitive endoderm fate segregation
Article Snippet: .. Plasmid: pCS2+ Cas9 , Gu et al. , , Addgene Plasmid #122948. .. sgRNA: Nanog C-term knock-in: TATGAGACTTACGCAACATCTGG , This paper , N/A.

Article Title: PIWIL3-piRNA Pathway Is Essential for Rabbit Oogenesis and Embryogenesis via Broad Regulation of the Transcriptome and Proteome
Article Snippet: Briefly, the gRNA sequences were cloned into pUC57-Simple-gRNA (Addgene ID 51306) vector and transcribed in vitro . .. To produce SpCas9 mRNA, the PCS2+Cas9 (Addgene ID 122,948) plasmid was linearized with NotI restriction digestion and used as a template for in vitro transcription. ..

Review

cas9 rna (Addgene inc)

Structured Review

Images

1) Product Images from "Tollip‐deficient zebrafish display no abnormalities in development, organ morphology or gene expression in response to lipopolysaccharide"

Related Articles

Synthesized:

Plasmid Preparation:

In Vitro:

Recombinant:

Knock-In:

Software:

Blocking Assay:

Sequencing:

Purification:

Similar Products

Image Search Results