Review



vx 745  (Selleck Chemicals)


Bioz Verified Symbol Selleck Chemicals is a verified supplier
Bioz Manufacturer Symbol Selleck Chemicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Selleck Chemicals vx 745
    Vx 745, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/VX-745/us12370180-100-68-73
    Average 93 stars, based on 21 article reviews
    vx 745 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Phospho-proteomics:

    Article Title: Butyrate regulates the blood-brain barrier transport and intra-endothelial accumulation of Alzheimer’s disease Amyloid-beta peptides
    Article Snippet: .. A separate experiment was conducted for each of these kinase phosphorylation inhibitors: 10 μM MK2206 (AKT), 100 nM Rapamycin (mTOR), 0.5 μM trametinib (MEK), 10 nM VX-745 (p38), obtained from Selleckchem, TX. ..

    other:

    Article Title: Opposing roles of p38α-mediated phosphorylation and PRMT1-mediated arginine methylation in driving TDP-43 proteinopathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER QuikChange Site-Directed Mutagenesis Kit Agilent Cat # 200519 CellTiter-Glo kit Promega Cat #G9241 CyQUANTTM LDH Cytotoxicity Assay ThermoFisher Scientific Cat #C20300 Experimental models: Cell lines Human neuroblastoma cell line SH-SY5Y ATCC Cat # CRL-2266 Mouse Motor Neuron-Like Hybrid Cell Line (NSC-34) TebuBio Cat # CLU140-A Mouse primary cortical neurons This paper N/A Human male XCL-1 iPSCs XCell Science XCL-1 iPSC NINDS human female iPSC line NH50305 NINDS NH50305 NINDS human female iPSC line NH50306 NINDS NH50306 Human female iPSC line CS06iCTR-n2 Cedars-Sinai iPSC Core CS06iCTR-n2 Human male iPSC line CS15iCTR-5 Cedars-Sinai iPSC Core CS15iCTR-5 Human male iPSC line CS52iALS-n6A Cedars-Sinai iPSC Core CS52iALS-n6A Human female iPSC line JH034 Zhang et al.159 Oligonucleotides siRNA targeting sequence: p38a ThermoFisher Scientific Cat #s3585 siRNA targeting sequence: p38a ThermoFisher Scientific Cat #s3586 siRNA targeting sequence: PRMT1 ThermoFisher Scientific Cat #s6917 siRNA targeting sequence: PRMT1 ThermoFisher Scientific Cat #s6919 siRNA targeting sequence: negative control ThermoFisher Scientific Cat # 4390846 siRNA targeting sequence: negative control ThermoFisher Scientific Cat # 4390843 Sequencing primer: T7 promoter Forward: TAATACGACTCACTATAGGG Tufts university sequencing core N/A Sequencing primer: M13 Reverse: CAGGAAACAGCTATGAC Tufts university sequencing core N/A Sequencing primer: TDP-43 1: TAATACGACTCACTATAGGGGAATTG Eurofins Genomics N/A Sequencing primer: TDP-43 2: CGGTGAGGTGCTGATGGTCC Eurofins Genomics N/A Sequencing primer: TDP-43 3: GGCTTTGGCAATTCGCGTGG Eurofins Genomics N/A Recombinant DNA Myc- TDP-43M337V Wobst et al.53 N/A Myc- TDP-43WT Wobst et al.53 N/A TDP-43WT-FLAG GenScript Clone ID: OHu19093 TDP-43S409:S410A-FLAG This paper N/A TDP-43S409:S410E-FLAG This paper N/A TDP-43S292A-FLAG This paper N/A TDP-43S292E-FLAG This paper N/A TDP-43S292N-FLAG This paper N/A TDP-43S409:S410A:S292A-FLAG This paper N/A TDP-43R293K-FLAG This paper N/A TDP-43G308R-FLAG This paper N/A TDP-43WT-MBP Addgene Plasmid # 104480 TDP-43S292E-MBP This paper N/A TDP-43S409:S410E-MBP This paper N/A TDP-43S292:S409:S410E-MBP This paper N/A TDP-43R293F-MBP This paper N/A (Continued on next page) 24 Cell Reports 44, 115205, January 28, 2025



    Similar Products

    94
    MedChemExpress vx 745
    Vx 745, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/Neflamapimod/pm42552375-56-26-28
    Average 94 stars, based on 1 article reviews
    vx 745 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Selleck Chemicals vx 745 p38
    Cells were incubated for 6 h under the following conditions: control (no treatment), butyrate alone (10 nM), butyrate + inhibitor, or inhibitor alone. In the last 30 minutes of each treatment, all groups received F-Aβ42 (1 μM) and insulin (50 nM). A & B. Butyrate reduced F-Aβ42 accumulation compared to control. Butyrate co-incubation with 0.5 µM trametinib (MEK inhibitor) increased F-Aβ42 accumulation compared to the butyrate alone group, as shown in the histogram of intracellular MFI (A) and bar chart (B) showing fold change of median fluorescence ± standard deviation. C & D. In another experiment, butyrate decreased F-Aβ42 accumulation compared to control, and co-incubation with 10 nM VX-745 <t>(p38</t> inhibitor) did not alter F-Aβ42 accumulation, as shown in the histogram of intracellular fluorescence (C) and bar chart (D) representing fold change of median fluorescence ± standard deviation. One-way ANOVA followed by Bonferroni post-test; *p-value<0.05, **p-value<0.01.
    Vx 745 P38, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/VX-745/bio_rxiv__2025__10__24__684335-68-26-30
    Average 93 stars, based on 1 article reviews
    vx 745 p38 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Selleck Chemicals vx 745
    Cells were incubated for 6 h under the following conditions: control (no treatment), butyrate alone (10 nM), butyrate + inhibitor, or inhibitor alone. In the last 30 minutes of each treatment, all groups received F-Aβ42 (1 μM) and insulin (50 nM). A & B. Butyrate reduced F-Aβ42 accumulation compared to control. Butyrate co-incubation with 0.5 µM trametinib (MEK inhibitor) increased F-Aβ42 accumulation compared to the butyrate alone group, as shown in the histogram of intracellular MFI (A) and bar chart (B) showing fold change of median fluorescence ± standard deviation. C & D. In another experiment, butyrate decreased F-Aβ42 accumulation compared to control, and co-incubation with 10 nM VX-745 <t>(p38</t> inhibitor) did not alter F-Aβ42 accumulation, as shown in the histogram of intracellular fluorescence (C) and bar chart (D) representing fold change of median fluorescence ± standard deviation. One-way ANOVA followed by Bonferroni post-test; *p-value<0.05, **p-value<0.01.
    Vx 745, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/VX-745/us12370180-100-68-73
    Average 93 stars, based on 1 article reviews
    vx 745 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Tocris neflamapimod
    Cells were incubated for 6 h under the following conditions: control (no treatment), butyrate alone (10 nM), butyrate + inhibitor, or inhibitor alone. In the last 30 minutes of each treatment, all groups received F-Aβ42 (1 μM) and insulin (50 nM). A & B. Butyrate reduced F-Aβ42 accumulation compared to control. Butyrate co-incubation with 0.5 µM trametinib (MEK inhibitor) increased F-Aβ42 accumulation compared to the butyrate alone group, as shown in the histogram of intracellular MFI (A) and bar chart (B) showing fold change of median fluorescence ± standard deviation. C & D. In another experiment, butyrate decreased F-Aβ42 accumulation compared to control, and co-incubation with 10 nM VX-745 <t>(p38</t> inhibitor) did not alter F-Aβ42 accumulation, as shown in the histogram of intracellular fluorescence (C) and bar chart (D) representing fold change of median fluorescence ± standard deviation. One-way ANOVA followed by Bonferroni post-test; *p-value<0.05, **p-value<0.01.
    Neflamapimod, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/VX+745/pmc12209929-33-0-5
    Average 93 stars, based on 1 article reviews
    neflamapimod - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    EIP Pharma neflamapimod vx 745
    Cells were incubated for 6 h under the following conditions: control (no treatment), butyrate alone (10 nM), butyrate + inhibitor, or inhibitor alone. In the last 30 minutes of each treatment, all groups received F-Aβ42 (1 μM) and insulin (50 nM). A & B. Butyrate reduced F-Aβ42 accumulation compared to control. Butyrate co-incubation with 0.5 µM trametinib (MEK inhibitor) increased F-Aβ42 accumulation compared to the butyrate alone group, as shown in the histogram of intracellular MFI (A) and bar chart (B) showing fold change of median fluorescence ± standard deviation. C & D. In another experiment, butyrate decreased F-Aβ42 accumulation compared to control, and co-incubation with 10 nM VX-745 <t>(p38</t> inhibitor) did not alter F-Aβ42 accumulation, as shown in the histogram of intracellular fluorescence (C) and bar chart (D) representing fold change of median fluorescence ± standard deviation. One-way ANOVA followed by Bonferroni post-test; *p-value<0.05, **p-value<0.01.
    Neflamapimod Vx 745, supplied by EIP Pharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/neflamapimod++vx+745+/pmc12135284-11-8-5
    Average 90 stars, based on 1 article reviews
    neflamapimod vx 745 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Biomol GmbH p38 inhibitor vx-745
    Reagents and tools table
    P38 Inhibitor Vx 745, supplied by Biomol GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/p38+inhibitor+vx+745/pmc11914300-50-0-4
    Average 90 stars, based on 1 article reviews
    p38 inhibitor vx-745 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Selleck Chemicals compound vx 745
    Reagents and tools table
    Compound Vx 745, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/Compound/pmc11831926-547-12-14
    Average 96 stars, based on 1 article reviews
    compound vx 745 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Tocris vx 745
    Reagents and tools table
    Vx 745, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/VX+745/pmc11831926-27-0-2
    Average 93 stars, based on 1 article reviews
    vx 745 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    AstraZeneca ltd p38a inhibitor vx-745
    Reagents and tools table
    P38a Inhibitor Vx 745, supplied by AstraZeneca ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vx-745/p38+inhibitors/pmc11831926-533-6-9
    Average 90 stars, based on 1 article reviews
    p38a inhibitor vx-745 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Cells were incubated for 6 h under the following conditions: control (no treatment), butyrate alone (10 nM), butyrate + inhibitor, or inhibitor alone. In the last 30 minutes of each treatment, all groups received F-Aβ42 (1 μM) and insulin (50 nM). A & B. Butyrate reduced F-Aβ42 accumulation compared to control. Butyrate co-incubation with 0.5 µM trametinib (MEK inhibitor) increased F-Aβ42 accumulation compared to the butyrate alone group, as shown in the histogram of intracellular MFI (A) and bar chart (B) showing fold change of median fluorescence ± standard deviation. C & D. In another experiment, butyrate decreased F-Aβ42 accumulation compared to control, and co-incubation with 10 nM VX-745 (p38 inhibitor) did not alter F-Aβ42 accumulation, as shown in the histogram of intracellular fluorescence (C) and bar chart (D) representing fold change of median fluorescence ± standard deviation. One-way ANOVA followed by Bonferroni post-test; *p-value<0.05, **p-value<0.01.

    Journal: bioRxiv

    Article Title: Butyrate regulates the blood-brain barrier transport and intra-endothelial accumulation of Alzheimer’s disease Amyloid-beta peptides

    doi: 10.1101/2025.10.24.684335

    Figure Lengend Snippet: Cells were incubated for 6 h under the following conditions: control (no treatment), butyrate alone (10 nM), butyrate + inhibitor, or inhibitor alone. In the last 30 minutes of each treatment, all groups received F-Aβ42 (1 μM) and insulin (50 nM). A & B. Butyrate reduced F-Aβ42 accumulation compared to control. Butyrate co-incubation with 0.5 µM trametinib (MEK inhibitor) increased F-Aβ42 accumulation compared to the butyrate alone group, as shown in the histogram of intracellular MFI (A) and bar chart (B) showing fold change of median fluorescence ± standard deviation. C & D. In another experiment, butyrate decreased F-Aβ42 accumulation compared to control, and co-incubation with 10 nM VX-745 (p38 inhibitor) did not alter F-Aβ42 accumulation, as shown in the histogram of intracellular fluorescence (C) and bar chart (D) representing fold change of median fluorescence ± standard deviation. One-way ANOVA followed by Bonferroni post-test; *p-value<0.05, **p-value<0.01.

    Article Snippet: A separate experiment was conducted for each of these kinase phosphorylation inhibitors: 10 μM MK2206 (AKT), 100 nM Rapamycin (mTOR), 0.5 μM trametinib (MEK), 10 nM VX-745 (p38), obtained from Selleckchem, TX.

    Techniques: Incubation, Control, Fluorescence, Standard Deviation

    Reagents and tools table

    Journal: The EMBO Journal

    Article Title: Immediate early splicing controls translation in activated T-cells and is mediated by hnRNPC2 phosphorylation

    doi: 10.1038/s44318-025-00374-8

    Figure Lengend Snippet: Reagents and tools table

    Article Snippet: VX-745 (p38 inhibitor) , Biomol , Cay18075-1.

    Techniques: Recombinant, Construct, Sequencing, Reverse Transcription, SYBR Green Assay, Marker, Western Blot, Software, Electroporation, Blocking Assay, Imaging, Mass Spectrometry