vx 745 (Selleck Chemicals)
Structured Review
Vx 745, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 93/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vx-745/VX-745/us12370180-100-68-73
Average 93 stars, based on 21 article reviews
Images
Related Articles
Phospho-proteomics:Article Title: Butyrate regulates the blood-brain barrier transport and intra-endothelial accumulation of Alzheimer’s disease Amyloid-beta peptides Article Snippet: .. A separate experiment was conducted for each of these kinase phosphorylation inhibitors: 10 μM MK2206 (AKT), 100 nM Rapamycin (mTOR), 0.5 μM trametinib (MEK), 10 nM other:Article Title: Opposing roles of p38α-mediated phosphorylation and PRMT1-mediated arginine methylation in driving TDP-43 proteinopathy. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER QuikChange Site-Directed Mutagenesis Kit Agilent Cat # 200519 CellTiter-Glo kit Promega Cat #G9241 CyQUANTTM LDH Cytotoxicity Assay ThermoFisher Scientific Cat #C20300 Experimental models: Cell lines Human neuroblastoma cell line SH-SY5Y ATCC Cat # CRL-2266 Mouse Motor Neuron-Like Hybrid Cell Line (NSC-34) TebuBio Cat # CLU140-A Mouse primary cortical neurons This paper N/A Human male XCL-1 iPSCs XCell Science XCL-1 iPSC NINDS human female iPSC line NH50305 NINDS NH50305 NINDS human female iPSC line NH50306 NINDS NH50306 Human female iPSC line CS06iCTR-n2 Cedars-Sinai iPSC Core CS06iCTR-n2 Human male iPSC line CS15iCTR-5 Cedars-Sinai iPSC Core CS15iCTR-5 Human male iPSC line CS52iALS-n6A Cedars-Sinai iPSC Core CS52iALS-n6A Human female iPSC line JH034 Zhang et al.159 Oligonucleotides siRNA targeting sequence: p38a ThermoFisher Scientific Cat #s3585 siRNA targeting sequence: p38a ThermoFisher Scientific Cat #s3586 siRNA targeting sequence: PRMT1 ThermoFisher Scientific Cat #s6917 siRNA targeting sequence: PRMT1 ThermoFisher Scientific Cat #s6919 siRNA targeting sequence: negative control ThermoFisher Scientific Cat # 4390846 siRNA targeting sequence: negative control ThermoFisher Scientific Cat # 4390843 Sequencing primer: T7 promoter Forward: TAATACGACTCACTATAGGG Tufts university sequencing core N/A Sequencing primer: M13 Reverse: CAGGAAACAGCTATGAC Tufts university sequencing core N/A Sequencing primer: TDP-43 1: TAATACGACTCACTATAGGGGAATTG Eurofins Genomics N/A Sequencing primer: TDP-43 2: CGGTGAGGTGCTGATGGTCC Eurofins Genomics N/A Sequencing primer: TDP-43 3: GGCTTTGGCAATTCGCGTGG Eurofins Genomics N/A Recombinant DNA Myc- TDP-43M337V Wobst et al.53 N/A Myc- TDP-43WT Wobst et al.53 N/A TDP-43WT-FLAG GenScript Clone ID: OHu19093 TDP-43S409:S410A-FLAG This paper N/A TDP-43S409:S410E-FLAG This paper N/A TDP-43S292A-FLAG This paper N/A TDP-43S292E-FLAG This paper N/A TDP-43S292N-FLAG This paper N/A TDP-43S409:S410A:S292A-FLAG This paper N/A TDP-43R293K-FLAG This paper N/A TDP-43G308R-FLAG This paper N/A TDP-43WT-MBP Addgene Plasmid # 104480 TDP-43S292E-MBP This paper N/A TDP-43S409:S410E-MBP This paper N/A TDP-43S292:S409:S410E-MBP This paper N/A TDP-43R293F-MBP This paper N/A (Continued on next page) 24 Cell Reports 44, 115205, January 28, 2025 |

