Review



vectashield with dapi  (Avantor)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Avantor vectashield with dapi
    Vectashield With Dapi, supplied by Avantor, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/vectashield+with+dapi/pm35134346-313-22-23
    Average 90 stars, based on 1 article reviews
    vectashield with dapi - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Fluorescence:

    Article Title: Temporal analyses of postnatal liver development and maturation by single-cell transcriptomics.
    Article Snippet: Compound Sakura Cat# 4583 Paraformaldehyde (PFA) Sigma-Aldrich Cat# P6148 Triton X-100 Sigma-Aldrich Cat# X100 Bovine Serum Albumin Spectrum Cat# A3611 VECTASHIELD with DAPI Avantor Cat# H-1200 Anti-Fade Fluorescence Mounting Medium - Aqueous, Fluoroshield Abcam Cat# ab104135 Critical commercial assays gentleMACS Dissociator Miltenyi Cat# 130-093-235 gentleMACS C Tubes Miltenyi Cat# 130-093-237 MidiMACS separator Miltenyi Cat# 130-042-302 LS columns Miltenyi Cat# 130-042-401 Dead cell removal kit Miltenyi Cat# 130-090-101 Chromium Single Cell 3’ Reagent Kits (v2 Chemistry) Miltenyi Cat# CG00052 Oligonucleotides Scd1 – qPCR FWD Eton Bioscience GCGATACACTCTGGTGCTCA Scd1 – qPCR REV Eton Bioscience CCCAGGGAAACCAGGATATT Scd2 – qPCR FWD Eton Bioscience GCTCTCGGGAGAACATCTTG Scd2 – qPCR REV Eton Bioscience CAGCCCTGGACACTCTCTTC F4/80 – qPCR FWD Eton Bioscience CTTTGGCTATGGGCTTCCAGTC (Continued on next page) Developmental Cell 57, 398–414.e1–e5, February 7, 2022 e1

    Real-time Polymerase Chain Reaction:

    Article Title: Temporal analyses of postnatal liver development and maturation by single-cell transcriptomics.
    Article Snippet: Compound Sakura Cat# 4583 Paraformaldehyde (PFA) Sigma-Aldrich Cat# P6148 Triton X-100 Sigma-Aldrich Cat# X100 Bovine Serum Albumin Spectrum Cat# A3611 VECTASHIELD with DAPI Avantor Cat# H-1200 Anti-Fade Fluorescence Mounting Medium - Aqueous, Fluoroshield Abcam Cat# ab104135 Critical commercial assays gentleMACS Dissociator Miltenyi Cat# 130-093-235 gentleMACS C Tubes Miltenyi Cat# 130-093-237 MidiMACS separator Miltenyi Cat# 130-042-302 LS columns Miltenyi Cat# 130-042-401 Dead cell removal kit Miltenyi Cat# 130-090-101 Chromium Single Cell 3’ Reagent Kits (v2 Chemistry) Miltenyi Cat# CG00052 Oligonucleotides Scd1 – qPCR FWD Eton Bioscience GCGATACACTCTGGTGCTCA Scd1 – qPCR REV Eton Bioscience CCCAGGGAAACCAGGATATT Scd2 – qPCR FWD Eton Bioscience GCTCTCGGGAGAACATCTTG Scd2 – qPCR REV Eton Bioscience CAGCCCTGGACACTCTCTTC F4/80 – qPCR FWD Eton Bioscience CTTTGGCTATGGGCTTCCAGTC (Continued on next page) Developmental Cell 57, 398–414.e1–e5, February 7, 2022 e1



    Similar Products

    vectashield antifade mounting medium with dapi  (Vector Laboratories)
    98
    Vector Laboratories vectashield antifade mounting medium with dapi
    Vectashield Antifade Mounting Medium With Dapi, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/VECTASHIELD+Antifade+Mounting+Medium+with+DAPI/custom%40h-1200%4042755103
    Average 98 stars, based on 1 article reviews
    vectashield antifade mounting medium with dapi - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    vectashield vibrance antifade mounting medium with dapi  (Vector Laboratories)
    96
    Vector Laboratories vectashield vibrance antifade mounting medium with dapi
    Vectashield Vibrance Antifade Mounting Medium With Dapi, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/VECTASHIELD+Vibrance+Antifade+Mounting+Medium+with+DAPI/custom%40h-1800%4042560613
    Average 96 stars, based on 1 article reviews
    vectashield vibrance antifade mounting medium with dapi - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    dapi  (Vector Laboratories)
    96
    Vector Laboratories dapi
    Dapi, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/VECTASHIELD+Vibrance+Antifade+Mounting+Medium+with+DAPI/pmc12969341-277-131-134
    Average 96 stars, based on 1 article reviews
    dapi - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    6 diamidino 2 phenylindole dapi  (Vector Laboratories)
    98
    Vector Laboratories 6 diamidino 2 phenylindole dapi
    6 Diamidino 2 Phenylindole Dapi, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/VECTASHIELD+Antifade+Mounting+Medium+with+DAPI/pmc13053801-371-24-27
    Average 98 stars, based on 1 article reviews
    6 diamidino 2 phenylindole dapi - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    vectashield plus antifade mounting medium with dapi  (Vector Laboratories)
    98
    Vector Laboratories vectashield plus antifade mounting medium with dapi
    Vectashield Plus Antifade Mounting Medium With Dapi, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/VECTASHIELD+Antifade+Mounting+Medium+with+DAPI/pmc12856636-82-21-28
    Average 98 stars, based on 1 article reviews
    vectashield plus antifade mounting medium with dapi - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    vectashield vibrance antifade mounting media with dapi  (Vector Laboratories)
    96
    Vector Laboratories vectashield vibrance antifade mounting media with dapi
    Citrullinated and Homocitrullinated Proteins/Peptides are Present in DBA/1J Metatarsophalangeal Joints. A) Representative hematoxylin + eosin (H&E) at 80× magnification and immunofluorescent micrographs at 20× magnification of joints from DBA/1J mice immunized with bovine type II collagen (arthritic: N = 9; non-arthritic: N = 10) or PBS (N = 9). Scale bars represent 500 μm. Max projections of Z-stacks show nuclei <t>(DAPI;</t> blue), citrullinated proteins/peptides (CitP; green), and homocitrullinated proteins/peptides (HomoCitP; red). Corrected total fluorescence intensity for B) CitP and C) HomoCitP in three joint structures: bone marrow, synovium, and cartilage. Graphs show the median [IQR], with each symbol representing an individual mouse. Statistical analysis was performed using Kruskal-Wallis with Dunn's multiple comparisons test, and the resulting p-values were p = 0.0046, p = 0.0084, p = 0.4076, p = 0.0143, p = 0.0136, and p = 0.1733 respectively, with p-values for pairwise comparisons indicated on the graphs. ns: not significant.
    Vectashield Vibrance Antifade Mounting Media With Dapi, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/Vector%C2%AE+TrueVIEW%C2%AE+Autofluorescence+Quenching+Kit+with+DAPI/pmc12810342-56-10-18
    Average 96 stars, based on 1 article reviews
    vectashield vibrance antifade mounting media with dapi - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    H-1200  (vector laboratories)
    98
    vector laboratories H-1200
    Citrullinated and Homocitrullinated Proteins/Peptides are Present in DBA/1J Metatarsophalangeal Joints. A) Representative hematoxylin + eosin (H&E) at 80× magnification and immunofluorescent micrographs at 20× magnification of joints from DBA/1J mice immunized with bovine type II collagen (arthritic: N = 9; non-arthritic: N = 10) or PBS (N = 9). Scale bars represent 500 μm. Max projections of Z-stacks show nuclei <t>(DAPI;</t> blue), citrullinated proteins/peptides (CitP; green), and homocitrullinated proteins/peptides (HomoCitP; red). Corrected total fluorescence intensity for B) CitP and C) HomoCitP in three joint structures: bone marrow, synovium, and cartilage. Graphs show the median [IQR], with each symbol representing an individual mouse. Statistical analysis was performed using Kruskal-Wallis with Dunn's multiple comparisons test, and the resulting p-values were p = 0.0046, p = 0.0084, p = 0.4076, p = 0.0143, p = 0.0136, and p = 0.1733 respectively, with p-values for pairwise comparisons indicated on the graphs. ns: not significant.
    H 1200, supplied by vector laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vectashield+with+dapi/VECTASHIELD+Antifade+Mounting+Medium+with+DAPI/pmc13127484-31-0-7
    Average 98 stars, based on 1 article reviews
    H-1200 - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier

    Image Search Results


    Citrullinated and Homocitrullinated Proteins/Peptides are Present in DBA/1J Metatarsophalangeal Joints. A) Representative hematoxylin + eosin (H&E) at 80× magnification and immunofluorescent micrographs at 20× magnification of joints from DBA/1J mice immunized with bovine type II collagen (arthritic: N = 9; non-arthritic: N = 10) or PBS (N = 9). Scale bars represent 500 μm. Max projections of Z-stacks show nuclei (DAPI; blue), citrullinated proteins/peptides (CitP; green), and homocitrullinated proteins/peptides (HomoCitP; red). Corrected total fluorescence intensity for B) CitP and C) HomoCitP in three joint structures: bone marrow, synovium, and cartilage. Graphs show the median [IQR], with each symbol representing an individual mouse. Statistical analysis was performed using Kruskal-Wallis with Dunn's multiple comparisons test, and the resulting p-values were p = 0.0046, p = 0.0084, p = 0.4076, p = 0.0143, p = 0.0136, and p = 0.1733 respectively, with p-values for pairwise comparisons indicated on the graphs. ns: not significant.

    Journal: Journal of Translational Autoimmunity

    Article Title: T cell proliferative response to a homocitrullinated peptide correlates with joint pathology in collagen induced arthritis

    doi: 10.1016/j.jtauto.2025.100345

    Figure Lengend Snippet: Citrullinated and Homocitrullinated Proteins/Peptides are Present in DBA/1J Metatarsophalangeal Joints. A) Representative hematoxylin + eosin (H&E) at 80× magnification and immunofluorescent micrographs at 20× magnification of joints from DBA/1J mice immunized with bovine type II collagen (arthritic: N = 9; non-arthritic: N = 10) or PBS (N = 9). Scale bars represent 500 μm. Max projections of Z-stacks show nuclei (DAPI; blue), citrullinated proteins/peptides (CitP; green), and homocitrullinated proteins/peptides (HomoCitP; red). Corrected total fluorescence intensity for B) CitP and C) HomoCitP in three joint structures: bone marrow, synovium, and cartilage. Graphs show the median [IQR], with each symbol representing an individual mouse. Statistical analysis was performed using Kruskal-Wallis with Dunn's multiple comparisons test, and the resulting p-values were p = 0.0046, p = 0.0084, p = 0.4076, p = 0.0143, p = 0.0136, and p = 0.1733 respectively, with p-values for pairwise comparisons indicated on the graphs. ns: not significant.

    Article Snippet: Following application of TrueView autofluorescence quencher, slides were mounted using Vectashield Vibrance Antifade mounting media with DAPI (SP-8500-15; Vector Laboratories; USA) and air dried for 2 h before imaging on the Nikon Ti2-E microscope.

    Techniques: Fluorescence