122 effectene transfection reagent qiagen (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher 122 effectene transfection reagent qiagen
122 Effectene Transfection Reagent Qiagen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/v5+custom+microarray+chip/1+AMINO+1+CYCLOPROPANECA+250MG+250MG/pm37951219-765-273-271
Average 94 stars, based on 1 article reviews

122 effectene transfection reagent qiagen - by Bioz Stars, 2026-10

94/100 stars

Images

other:

Article Title: Bacterial extracellular vesicle ssRNA prevents colorectal cancer progression via Piezo1.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Methanol Kanto Chemical Cat# 510Y1195 Acetonitrile Kanto Chemical Cat# 510K1752 Azoxymethane Fujifilm Wako Pure Chemicals Cat# 011-20171 Sodium dextran sulfate MW36000-50000 MP Biomedicals Cat# 160110 G-Nox Genostaff Cat# GN-04 Proteinase K Fujifilm Cat# 161-28701 G-wash Genostaff Cat# GW-01 G-Hybo-L Genostaff Cat# RPD-02 G-block Genostaff Cat# GB-01 Anti-DIG AP conjugate Roche Cat# 11093274910 NBT/BCIP solution Sigma Cat# 72091 Kernechtrot stain solution Muto Cat# 40872 G-mount Genostaff Cat# GM-01 Malinol Muto Cat# 20093 Tris-EDTA buffer Genostaff Cat# ARSE9-01 Avidin/biotin blocking kit Vector Cat# SP-2001 Peroxidase-conjugated streptavidin Nichirei Cat# 326062 Mayer’s hematoxylin Muto Cat# 30142 TRIzol Thermo Fisher Scientific Cat# 15596026 KOD FX neo DNA polymerase Toyobo Cat# KFX-201 KOD One DNA polymerase Toyobo Cat# KMM101 RNaseA Thermo Fisher Scientific Cat# 12091021 Matrigel Corning Cat# 356234 Polyethylenimine Max Polysciences Cat# 24765 Puromycin Invivogen Cat# ant-pr-1 KOD FX DNA polymerase Toyobo Cat# KFX-101 Complete protease inhibitor mixture tablet Roche Cat# 11836170001 Pierce ECL western blotting substrate Thermo Fisher Scientific Cat# 32106 Lipofectamine 3000 Thermo Fisher Scientific Cat# L300000088 Fluo-8 a.m. ATT Bioquest Cat# 21080 Yoda1 Sigma Cat# SML1558 Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Lipofectamine RNAiMAX reagent Thermo Fisher Scientific Cat# 13778100 Critical commercial assays ssRNA40 InvivoGen Cat# tlrl-lrna40 NucleoSpin TriPrep kit Macherey-nagal Cat# NC1205208 Exo Quick-TC Exosome Precipitation Solution System Biosciences Cat# EXOTC50A1 Every EV RNA Isolation Kit System Biosciences Cat# Every100B-1 Total Bile Acid Assay Kit Cell Biolabs Cat# STA-631 ReverTra Ace Toyobo Cat# FSQ201 TaqMan ribosomal RNA control reagents Thermo Fisher Scientific Cat# 4308329 NEB Stable Competent E. coli NEB Cat# C3040I In-Fusion Snap Assembly Takara Bio Cat# 638947 BigDye Terminator v1.1 Thermo Fisher Scientific Cat# 4337452 ExoSAP-IT Express PCR Cleanup Reagents Thermo Fisher Scientific Cat# 75001 Dynabeads Protein G Invitrogen Cat# 10003D CytoSelect BrdU Cell Proliferation ELISA Kit Cell Biolabs Cat# CBA-251 (Continued on next page) 16 Cell Reports 45, 116737, January 27, 2026

Fluorescence:

Article Title: Jub-induced phosphorylation of Warts inhibits its activity and recruitment into biomolecular condensates.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Lambda Protein Phosphatase (Lambda PP) New England Biolabs Cat#P0753S Dako Fluorescence Mounting medium Agilent Cat#S302380-2 Antibiotic-Antimycotic Gibco Cat#15240062 Concanavalin A Sigma Cat#L7647-25 Abemaciclib AdooQ Bioscience Cat#LY835219 cOmplete TM , EDTA-free Protease Inhibitor Cocktail Roche Cat#11873580001 Phosphatase Inhibitor Cocktail II Millipore Cat#524625 Intercept® (TBS) Blocking Buffer LICORbio Cat# 927–60001 2× Laemmli Sample Buffer Bio-Rad Cat# 1610737 Intercept® (PBS) Blocking Buffer LICORbio Cat# 927-70001 4–15% Mini-PROTEAN® TGX TM Precast Protein Gels Bio-Rad Cat#4561086 Anti-V5 Agarose Affinity Gel antibody produced in mouse Millipore Sigma Cat#A7345 Pierce TM Protein A Agarose Thermo Fisher Scientific Cat#20333 SuperSep TM Phos-tag TM FUJIFILM Wako Chemicals Cat#198-17981 Critical commercial assays PrimeSTAR® Max DNA Polymerase Ver.2 Takara Mirus Bio Cat#R047A Monarch® Spin DNA Gel Extraction Kit New England Biolabs Cat#T1120S NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat#E2621L Effectene Transfection Reagent Qiagen Cat#301425 MEGAscript TM T7 Transcription Kit Thermo Fisher Scientific CatAM1333 Experimental models: Cell lines Drosophila Schneider Line2 Irvine Lab N/A Experimental models: Organisms/strains Drosophila: nub-Gal4 Azpiazu and Morata. ..

Protease Inhibitor:

Article Title: Mask protein keeps NF-κB precursor inactive by inducing a closed conformation and isolating it in biomolecular condensates.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-β-Actin Cell Signaling Technology Cat# 4967; RRID: AB_330288 Mouse anti-HA Sigma-Aldrich Cat# H9658; RRID: AB_260092 Rabbit anti-HA Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Mouse anti-Flag Sigma-Aldrich Cat# F1804; RRID: AB_262044 Rabbit anti-Flag Cell Signaling Technology Cat# 14793; RRID: AB_2572291 Rat anti-Flag Biolegend Cat# 637304; RRID: AB_1134267 Mouse anti-c-Myc Sigma-Aldrich Cat# OP10L; RRID: AB_2266865 Rabbit anti-Myc Cell Signaling Technology Cat# 2278; RRID: AB_490778 Rabbit anti-GFP Cell Signaling Technology Cat# 2956; RRID: AB_1196615 Mouse anti-Relish C Developmental Studies Hybridoma Bank Cat# 21F3; RRID: AB_1553772 Rabbit anti-Mask This paper N/A Rabbit anti-p100/p52 Cell Signaling Technology Cat# 4882; RRID: AB_10695537 Rabbit anti-p105/p50 Cell Signaling Technology Cat# 3035; RRID: AB_330564 Rabbit anti-IL-1β Cell Signaling Technology Cat# 12703; RRID: AB_2737350 Mouse anti-GST GNI Cat# GNI4110-GT Mouse anti-His GNI Cat# GNI4110-HS; RRID: AB_3076245 Goat anti-rat IgG HRP Jackson ImmunoResearch Cat# 112-035-003; RRID: AB_2338128 Goat anti-rabbit IgG HRP Jackson ImmunoResearch Cat# 111-035-003; RRID: AB_2313567 Goat anti-mouse IgG HRP Jackson ImmunoResearch Cat# 115-035-003; RRID: AB_10015289 Goat anti-rabbit IgG Cy3 Jackson ImmunoResearch Cat# 111-165-003; RRID: AB_2338000 Goat anti-rabbit IgG FITC Jackson ImmunoResearch Cat# 111-095-003; RRID: AB_2337972 Goat anti-mouse IgG Cy3 Jackson ImmunoResearch Cat# 115-165-003; RRID: AB_2338680 Goat anti-mouse IgG FITC Jackson ImmunoResearch Cat# 115-095-003; RRID: AB_2338589 Bacterial strains Staphylococcus aureus ATCC ATCC 25923 Erwinia carotovoracarotovora 15 Provided by Dr. Neal Silverman Previously described in Basset et al. 61 Enterococcus faecalis ATCC ATCC 29212 Pseudomonas entomophila Provided by Dr. Lei Pan N/A Chemicals, peptides, and recombinant proteins Protease inhibitor cocktail MedChemExpress Cat# HY-K0010 Glutathione reduced Sangon Biotech Cat# A100399 DAPI Sangon Biotech Cat# E607303 LPS Sigma-Aldrich Cat# L2630 Z-VAD-FMK MedChemExpress Cat# HY-16658B Critical commercial assays Effectene Transfection Reagent Qiagen Cat# 301425 MEGAscript T7 Transcription Kit Thermo Fisher Scientific Cat# AM1333 RNAsimple Total RNA Kit TIANGEN Cat# DP419 2X Universal SYBR Green Fast qPCR Mix ABclonal Cat# RK21203 ABScript III RT Master Mix ABclonal Cat# RK20429 Plasmid Midi Kit Qiagen Cat# 12143 Anti-HA Affinity Gel GNI Cat# GNI4510-HA-M (Continued on next page) 18 Cell Reports 44, 116225, September 23, 2025 .. We thank Bloomington Drosophila Stock Center (BDSC), Vienna Drosophila Resource Center (VDRC), Drosophila Genomics Resource Center (DGRC), American Type Culture Collection (ATCC), Addgene, the Core Facility of Drosophila Resource and Technology, CAS, and Developmental Studies Hybridoma Bank (DSHB) for fly strains and reagents.

Blocking Assay:

Produced:

Gel Extraction:

Transfection:

Article Title: KMT5C leverages disorder to optimize cooperation with HP1 for heterochromatin retention.
Article Snippet: A defining feature of constitutive heterochromatin compartments is the heterochromatin protein-1 (HP1) family, whose members display fast internal mobility and rapid exchange with the surrounding nucleoplasm.. Here, we describe a paradoxical state for the lysine methyltransferase KMT5C characterized by rapid internal diffusion but minimal nucleoplasmic exchange.. This retentive behavior is conferred by sparse sequence features that constitute two modules tethered by an intrinsically disordered linker.

Article Title: A non-transcriptional mitotic function of POU/Oct factors ensures spindle assembly and chromosome segregation.
Article Snippet: .. : doi:10.1242/jcs.264165: Supplementary information Jo ur na l o f C el l S ci en ce • S up pl em en ta ry in fo rm at io n Chemicals Heptane Sigma Cat. #H2198 Sodium Hypochlorite VWR Cat. #27900.296 TRIzol reagent Thermo fisher scientific Cat. #15596018 Schneider’s media Thermo Fisher scientific/Gibco Cat. #21720024 DMEM F12 Thermo Fisher scientific/Gibco Cat. #12634010 Penicillin-streptomycin antibiotics Thermo Fisher scientific/Gibco Cat. #15140122 DMEM GlutaMAX Thermo Fisher scientific/Gibco Cat. #31966021 Halocarbon oil (#700) Sigma Cat. # H8898 ViaFluor 488 Biotium Cat. #70062 Fetal Bovine Serum Thermo Fisher/Gibco Cat. #A5670801 NGS Thermo Fisher Scientific Cat. #31873 Formaldehyde 37% Cat. # 47608 or F8775 VECTASHIELD PLUS Antifade BioNordika Cat. #VEH-1900-10 Commercial assay kits Mini-prep kit QIAGEN Cat. #27106 Effectene transfection kit QIAGEN Cat. #301425 LipofectamineTM RNAiMAX transfection reagent Thermo Fisher Scientific Cat. #13778100 LR clonase kit Thermo Fisher Scientific Cat. #11791020 SuperScript IV First-strand Synthesis System Thermo Fisher Scientific Cat. #18091050 T7 RiboMAXTM Express Large Scale RNA Production System Promega Cat. #P1320 pENTRTM/D-TOPOTM Cloning Kit Thermo Fisher Scientific Cat. #K240020SP Real-time PCR assay to detect Mycoplasma spp. .. IDEXX BioAnalytics Primers Nub-PD.HL.Fw atgcacctcgagcacacacccatacactgacaac J.

Article Title: Membrane order regulates clathrin-coated pit dynamics but not initiation
Article Snippet: Clathrin-mediated endocytosis involves the remodeling of membranes via the initiation, maturation, and scission of clathrin-coated pits (CCPs).. How CCP initiation and dynamics are regulated has been addressed primarily from the perspective of the core proteins that mediate endocytosis.. Whether and how the physical properties of the membrane regulate CCP initiation and dynamics is heavily underexplored.

Recombinant:

SYBR Green Assay:

Real-time Polymerase Chain Reaction:

Plasmid Preparation:

Software:

Microscopy:

Imaging:

Next-Generation Sequencing:

Cloning:

Expressing:

Generated:

Selection:

Isolation:

Article Title: Glial cholesterol redistribution in hypoxic injury in vitro influences oligodendrocyte maturation and myelination.
Article Snippet: Hypoxic insult to the fetal brain causes loss of vulnerable premyelinating oligodendrocytes and arrested oligodendrocyte differentiation.. Astrocytes influence oligodendrocyte differentiation and the astrocytic response to hypoxia could affect oligodendrocyte maturation under hypoxia.. To identify pathways by which astrocytes influence oligodendroglial maturation in hypoxic injury, human fetal neural stem cell-derived astrocytes were exposed to 0.2 % oxygen for 48 hours.

Review