Review



s protein-streptavidin-binding peptide-flag (sfb)-tagged usp7 construct  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc s protein-streptavidin-binding peptide-flag (sfb)-tagged usp7 construct
    S Protein Streptavidin Binding Peptide Flag (Sfb) Tagged Usp7 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/usp18+plasmid/pmc11922642-587-12-18
    Average 90 stars, based on 1 article reviews
    s protein-streptavidin-binding peptide-flag (sfb)-tagged usp7 construct - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Inhibition of USP7 upregulates USP22 and activates its downstream cancer-related signaling pathways in human cancer cells.
    Article Snippet: Human USP7 specific siRNA (sc-41,521) was purchased from Santa Cruz Biology. pQFlag-USP7 WT puroR (Addgene plasmids #46,751) and pQFlag-USP7 CS puroR (and #46,752) encoding human USP7 deubiquitinase and catalytically inactive form of USP7 bearing C223S mutation were gifts from Gordon Peters [40].

    Article Title: Synergistic regulation of DACH1 stability by acetylation and deubiquitination promotes colorectal cancer progression.
    Article Snippet: GST-USP7 plasmids were generated using pGEX-4T-1 (129567, Addgene).

    Article Title: The Ufd1 cofactor determines the linkage specificity of polyubiquitin chain engagement by the AAA+ ATPase Cdc48.
    Article Snippet: Purification of Ube1, SENP2, Cdc34, USP2, PreScission protease, and TEV protease Mouse E1 (Ube1), SENP2, Cdc34, USP2, PreScission protease, and TEV protease were expressed and purified as previously described.10,29–31 pET28-mE1 was a gift from Jorge Eduardo Azevedo (Addgene plasmid # 32534), pET28a-SENP2 (catalytic domain) was a gift from Guy Salvesen (Addgene plasmid # 16357), and USP2 was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894).

    Article Title: Inhibition of USP7 upregulates USP22 and activates its downstream cancer-related signaling pathways in human cancer cells
    Article Snippet: Human USP7 specific siRNA (sc-41,521) was purchased from Santa Cruz Biology. pQFlag-USP7 WT puroR (Addgene plasmids #46,751) and pQFlag-USP7 CS puroR (and #46,752) encoding human USP7 deubiquitinase and catalytically inactive form of USP7 bearing C223S mutation were gifts from Gordon Peters [ ].

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway
    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Expressing:

    Article Title: A versatile fluorescence polarization-based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim)
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI ) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894 ; RRID: Addgene 36,894). .. The active site cysteine USP2 C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Article Title: A versatile fluorescence polarization based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim).
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894; RRID: Addgene 36894). .. The active site cysteine USP2C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Construct:

    Article Title: A versatile fluorescence polarization-based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim)
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI ) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894 ; RRID: Addgene 36,894). .. The active site cysteine USP2 C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Article Title: A versatile fluorescence polarization based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim).
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894; RRID: Addgene 36894). .. The active site cysteine USP2C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Ubiquitin Proteomics:

    Article Title: A versatile fluorescence polarization-based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim)
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI ) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894 ; RRID: Addgene 36,894). .. The active site cysteine USP2 C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Article Title: A versatile fluorescence polarization based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim).
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894; RRID: Addgene 36894). .. The active site cysteine USP2C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Plasmid Preparation:

    Article Title: A versatile fluorescence polarization-based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim)
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI ) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894 ; RRID: Addgene 36,894). .. The active site cysteine USP2 C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Article Title: USP7 inhibition perturbs proteostasis and tumorigenesis in triple negative breast cancer
    Article Snippet: .. USP7 gRNA (gRNA1 sequence: AGATGTATGATCCCAAAACG and gRNA2 sequence: GTGTACATGATGCCAACCGA) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360; Addgene). pLenti PGK V5-LUC Neo (21471; Addgene) was used for bioluminescence imaging. .. All lentiviruses were produced by calcium phosphate transfection using HEK293T cells and the lentiviral TLCV2 transfer vector, lentiviral envelope plasmid pCMV-VSV-G (8454; Addgene), and lentiviral packaging plasmid pCMV-dr8.2-dvpr (8455; Addgene).

    Article Title: A versatile fluorescence polarization based deubiquitination assay using an isopeptide bond substrate mimetic (IsoMim).
    Article Snippet: .. The USP2 catalytic domain expression construct as used for the structure determination of a covalent Ubiquitin-USP2 complex (PDB code: 2IBI) was a gift from Cheryl Arrowsmith (Addgene plasmid # 36894; http://n2t.net/addgene:36894; RRID: Addgene 36894). .. The active site cysteine USP2C276A mutation was generated by the QuickChange site directed mutagenesis kit (Qiagen).

    Sequencing:

    Article Title: USP7 inhibition perturbs proteostasis and tumorigenesis in triple negative breast cancer
    Article Snippet: .. USP7 gRNA (gRNA1 sequence: AGATGTATGATCCCAAAACG and gRNA2 sequence: GTGTACATGATGCCAACCGA) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360; Addgene). pLenti PGK V5-LUC Neo (21471; Addgene) was used for bioluminescence imaging. .. All lentiviruses were produced by calcium phosphate transfection using HEK293T cells and the lentiviral TLCV2 transfer vector, lentiviral envelope plasmid pCMV-VSV-G (8454; Addgene), and lentiviral packaging plasmid pCMV-dr8.2-dvpr (8455; Addgene).

    Clone Assay:

    Article Title: USP7 inhibition perturbs proteostasis and tumorigenesis in triple negative breast cancer
    Article Snippet: .. USP7 gRNA (gRNA1 sequence: AGATGTATGATCCCAAAACG and gRNA2 sequence: GTGTACATGATGCCAACCGA) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360; Addgene). pLenti PGK V5-LUC Neo (21471; Addgene) was used for bioluminescence imaging. .. All lentiviruses were produced by calcium phosphate transfection using HEK293T cells and the lentiviral TLCV2 transfer vector, lentiviral envelope plasmid pCMV-VSV-G (8454; Addgene), and lentiviral packaging plasmid pCMV-dr8.2-dvpr (8455; Addgene).

    CRISPR:

    Article Title: USP7 inhibition perturbs proteostasis and tumorigenesis in triple negative breast cancer
    Article Snippet: .. USP7 gRNA (gRNA1 sequence: AGATGTATGATCCCAAAACG and gRNA2 sequence: GTGTACATGATGCCAACCGA) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360; Addgene). pLenti PGK V5-LUC Neo (21471; Addgene) was used for bioluminescence imaging. .. All lentiviruses were produced by calcium phosphate transfection using HEK293T cells and the lentiviral TLCV2 transfer vector, lentiviral envelope plasmid pCMV-VSV-G (8454; Addgene), and lentiviral packaging plasmid pCMV-dr8.2-dvpr (8455; Addgene).

    Imaging:

    Article Title: USP7 inhibition perturbs proteostasis and tumorigenesis in triple negative breast cancer
    Article Snippet: .. USP7 gRNA (gRNA1 sequence: AGATGTATGATCCCAAAACG and gRNA2 sequence: GTGTACATGATGCCAACCGA) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360; Addgene). pLenti PGK V5-LUC Neo (21471; Addgene) was used for bioluminescence imaging. .. All lentiviruses were produced by calcium phosphate transfection using HEK293T cells and the lentiviral TLCV2 transfer vector, lentiviral envelope plasmid pCMV-VSV-G (8454; Addgene), and lentiviral packaging plasmid pCMV-dr8.2-dvpr (8455; Addgene).



    Similar Products

    86
    Vigene Biosciences plasmid constructs encoding usp7
    KIF23 and myosin heavy chain 9 (MYH9) interact with ubiquitin‐specific protease 7 <t>(USP7).</t> (A) Molecular docking results for KIF23 and MYH9. (B) Co‐immunoprecipitation (Co‐IP) analysis to detect the interaction between KIF23 and MYH9 in CC cells. (C) Immunofluorescence (IF) analysis showing the co‐localisation of KIF23 and MYH9 in CC cells (scale bar: 10 µm). (D) Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) analysis of MYH9 mRNA levels in CC cells with or without KIF23 KO. (E) Western blotting (WB) analysis of MYH9 protein levels in CC cells with or without KIF23 KO. (F) Nuclear and cytoplasmic fractionation assay to detect MYH9 protein levels in overexpression KIF23 (oe‐ KIF23 ) CC cells. (G) Schematic diagram of the functional domains of KIF23. (H) Co‐IP assay demonstrating the interaction between different KIF23 domains and MYH9 in HEK‐293T cells transfected with the corresponding constructs. (I) Schematic diagram of the functional domains of MYH9. (J) Co‐IP assay demonstrating the interaction between different MYH9 domains and KIF23 in HEK‐293T cells. (K and L) Molecular docking diagrams of MYH9 with USP7 and KIF23 with USP7. (M) Co‐IP analysis in CC cells demonstrating the interactions of MYH9 and KIF23 with USP7. (N and O) Representative confocal images showing the co‐localisation of MYH9 with USP7 and KIF23 with USP7 (scale bar: 10 µm).
    Plasmid Constructs Encoding Usp7, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/flag+tagged+usp7/pmc13052040-64-5-12
    Average 86 stars, based on 1 article reviews
    plasmid constructs encoding usp7 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Addgene inc s protein-streptavidin-binding peptide-flag (sfb)-tagged usp7 construct
    KIF23 and myosin heavy chain 9 (MYH9) interact with ubiquitin‐specific protease 7 <t>(USP7).</t> (A) Molecular docking results for KIF23 and MYH9. (B) Co‐immunoprecipitation (Co‐IP) analysis to detect the interaction between KIF23 and MYH9 in CC cells. (C) Immunofluorescence (IF) analysis showing the co‐localisation of KIF23 and MYH9 in CC cells (scale bar: 10 µm). (D) Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) analysis of MYH9 mRNA levels in CC cells with or without KIF23 KO. (E) Western blotting (WB) analysis of MYH9 protein levels in CC cells with or without KIF23 KO. (F) Nuclear and cytoplasmic fractionation assay to detect MYH9 protein levels in overexpression KIF23 (oe‐ KIF23 ) CC cells. (G) Schematic diagram of the functional domains of KIF23. (H) Co‐IP assay demonstrating the interaction between different KIF23 domains and MYH9 in HEK‐293T cells transfected with the corresponding constructs. (I) Schematic diagram of the functional domains of MYH9. (J) Co‐IP assay demonstrating the interaction between different MYH9 domains and KIF23 in HEK‐293T cells. (K and L) Molecular docking diagrams of MYH9 with USP7 and KIF23 with USP7. (M) Co‐IP analysis in CC cells demonstrating the interactions of MYH9 and KIF23 with USP7. (N and O) Representative confocal images showing the co‐localisation of MYH9 with USP7 and KIF23 with USP7 (scale bar: 10 µm).
    S Protein Streptavidin Binding Peptide Flag (Sfb) Tagged Usp7 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/usp18+plasmid/pmc11922642-587-12-18
    Average 90 stars, based on 1 article reviews
    s protein-streptavidin-binding peptide-flag (sfb)-tagged usp7 construct - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc peptide flag sfb tagged usp7 construct
    (A and B) Immunofluorescence of <t>USP7</t> in the cerebral cortex on embryonic day 14 (E14; A) and post-natal day 42 (P42; B). Dashed lines demarcate the cortical plate (c.p.). Scale bars, 100 μm. (C) Virtual optomotor system (VOS) test: spatial frequency threshold. ** p < 0.01 by Bonferroni’s multiple-comparisons test. (D) Motor strength test: time to grip onto the inverted screen. * p < 0.05 by Dunn’s multiple-comparisons test. (E and F) CatWalk: relative mean intensity distributed onto front- and hindpaws (E) and limb swing speed (F). ** p < 0.01, *** p < 0.001 by Tukey’s multiple-comparisons test. See also . (G–I) Fear conditioning: percentage of freezing time in tone/shock pairing (G), contextual conditioning (H), and auditory cued conditioning (I). * p < 0.05, ** p < 0.01 by Bonferroni’s multiple-comparisons test ( Usp7 WT vs. cKO). (J) Representative biting injury on mice co-caged with Usp7 cKO mice. See also . (K) Percentage of tail biters among Usp7 cKO mice from 3 to 12 weeks old. (L) Schematic of behavioral phenotypes in Usp7 cKO mice that are relevant to HAFOUS. Data are presented as mean ± SEM. See also .
    Peptide Flag Sfb Tagged Usp7 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/pMH-SFB-USP7+(Plasmid+%2399393)/pmc11922642-587-14-18
    Average 93 stars, based on 1 article reviews
    peptide flag sfb tagged usp7 construct - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Viva Biotech usp7, construct usp7 (208-1102) 6*his
    (A and B) Immunofluorescence of <t>USP7</t> in the cerebral cortex on embryonic day 14 (E14; A) and post-natal day 42 (P42; B). Dashed lines demarcate the cortical plate (c.p.). Scale bars, 100 μm. (C) Virtual optomotor system (VOS) test: spatial frequency threshold. ** p < 0.01 by Bonferroni’s multiple-comparisons test. (D) Motor strength test: time to grip onto the inverted screen. * p < 0.05 by Dunn’s multiple-comparisons test. (E and F) CatWalk: relative mean intensity distributed onto front- and hindpaws (E) and limb swing speed (F). ** p < 0.01, *** p < 0.001 by Tukey’s multiple-comparisons test. See also . (G–I) Fear conditioning: percentage of freezing time in tone/shock pairing (G), contextual conditioning (H), and auditory cued conditioning (I). * p < 0.05, ** p < 0.01 by Bonferroni’s multiple-comparisons test ( Usp7 WT vs. cKO). (J) Representative biting injury on mice co-caged with Usp7 cKO mice. See also . (K) Percentage of tail biters among Usp7 cKO mice from 3 to 12 weeks old. (L) Schematic of behavioral phenotypes in Usp7 cKO mice that are relevant to HAFOUS. Data are presented as mean ± SEM. See also .
    Usp7, Construct Usp7 (208 1102) 6*His, supplied by Viva Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/usp7++construct+usp7++208+1102++6+his/us12018030-1991-5-11
    Average 90 stars, based on 1 article reviews
    usp7, construct usp7 (208-1102) 6*his - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc usp7 construct
    Loss of <t>USP7</t> in glutamatergic excitatory neurons leads to multiple disease-relevant behavioral deficits and apoptosis in mice. (A) Patients with the Hao-Fountain syndrome and Usp7 conditional knockout (cKO) mice exhibit phenotypes in similar behavioral domains. (B) Double immunofluorescence of USP7 and neuron nuclear protein (NeuN) in cerebral cortex at postnatal day 42 (P42). <t>USP7</t> <t>protein</t> was absent in most neuronal nuclei in Usp7 cKO cortex. Scale bar 100µm. (C) Virtual optomotor system (VOS) test: Spatial frequency threshold for head turn. Usp7 cKO mice (n = 6) showed reduced visual acuity compared to Usp7 WT (n = 5) and cHet mice (n = 8). **p<0.01 by Bonferroni’s multiple comparison test. (D) Motor strength test: Time to grip onto inverted screen. Usp7 cKO mice (n = 8) showed shorter latency to fall than Usp7 WT (n = 8) and cHet mice (n = 11). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (E) Catwalk 1: Relative mean intensity distributed onto each paw. Usp7 cKO mice (n = 8) put less weight onto front paw and more onto hind paw, compared to Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01 by Tukey’s multiple comparison test. See also Video S2. (F) Catwalk 2: Limb swing speed. Usp7 cKO mice (n = 8) showed higher swing speed of both front and hind limb than Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01, ***p<0.001 by Tukey’s multiple comparison test. See also Video S2. (G) Fear conditioning day 1: Time spent in freezing for tone/shock pairing (n = 8, 11 & 6 for Usp7 WT, Usp7 cHet and Usp7 cKO mice). No significant genotype effect by two-way ANOVA. (H) Fear conditioning day 2: Time spent in freezing for contextual conditioning. Usp7 cKO mice spent less time in freezing than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05, **p<0.01 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (I) Fear conditioning day 3: Time spent in freezing for auditory cue conditioning. Usp7 cKO mice spent less time in freezing after the tone than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (J) Percentage of tail biters among all monitored Usp7 cKO mice from 3 to 12 weeks old. Tail biters were identified if their co-caged mice had biting marks on the tails. (K) Representative biting injury on mice co-caged with Usp7 cKO mice. See also Video S3. Data are presented as mean ± SEM. See also .
    Usp7 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/pMH-SFB-USP7+(Plasmid+%2399393)/bio_rxiv__2023__10__24__563880-481-15-17
    Average 93 stars, based on 1 article reviews
    usp7 construct - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc wild type usp7 cdna construct
    Loss of <t>USP7</t> in glutamatergic excitatory neurons leads to multiple disease-relevant behavioral deficits and apoptosis in mice. (A) Patients with the Hao-Fountain syndrome and Usp7 conditional knockout (cKO) mice exhibit phenotypes in similar behavioral domains. (B) Double immunofluorescence of USP7 and neuron nuclear protein (NeuN) in cerebral cortex at postnatal day 42 (P42). <t>USP7</t> <t>protein</t> was absent in most neuronal nuclei in Usp7 cKO cortex. Scale bar 100µm. (C) Virtual optomotor system (VOS) test: Spatial frequency threshold for head turn. Usp7 cKO mice (n = 6) showed reduced visual acuity compared to Usp7 WT (n = 5) and cHet mice (n = 8). **p<0.01 by Bonferroni’s multiple comparison test. (D) Motor strength test: Time to grip onto inverted screen. Usp7 cKO mice (n = 8) showed shorter latency to fall than Usp7 WT (n = 8) and cHet mice (n = 11). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (E) Catwalk 1: Relative mean intensity distributed onto each paw. Usp7 cKO mice (n = 8) put less weight onto front paw and more onto hind paw, compared to Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01 by Tukey’s multiple comparison test. See also Video S2. (F) Catwalk 2: Limb swing speed. Usp7 cKO mice (n = 8) showed higher swing speed of both front and hind limb than Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01, ***p<0.001 by Tukey’s multiple comparison test. See also Video S2. (G) Fear conditioning day 1: Time spent in freezing for tone/shock pairing (n = 8, 11 & 6 for Usp7 WT, Usp7 cHet and Usp7 cKO mice). No significant genotype effect by two-way ANOVA. (H) Fear conditioning day 2: Time spent in freezing for contextual conditioning. Usp7 cKO mice spent less time in freezing than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05, **p<0.01 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (I) Fear conditioning day 3: Time spent in freezing for auditory cue conditioning. Usp7 cKO mice spent less time in freezing after the tone than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (J) Percentage of tail biters among all monitored Usp7 cKO mice from 3 to 12 weeks old. Tail biters were identified if their co-caged mice had biting marks on the tails. (K) Representative biting injury on mice co-caged with Usp7 cKO mice. See also Video S3. Data are presented as mean ± SEM. See also .
    Wild Type Usp7 Cdna Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/Flag-HA-USP7+(Plasmid+%2322591)/pmc07933146__41598_2021_84647_MOESM1_ESM-64-21-25
    Average 93 stars, based on 1 article reviews
    wild type usp7 cdna construct - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Selleck Chemicals expression constructs usp7 inhibitors
    Viral infection promotes protein expression of <t>USP7</t> that up‐regulates SOCS1 protein levels at the late stage of viral infection. (a) Western blot analysis of protein levels of SOCS1 and JOSD1 in A549 cells infected with H1N1 [multiplicity of infection (MOI) = 1·0] for the indicated times. (b) Western blot analysis of exogenously expressed Myc‐SOCS1 levels in HEK293T cells transfected with Myc‐SOCS1 and then infected with vesicular stomatitis virus (VSV) (MOI = 1·0). (c) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells transfected with Myc‐SOCS1 and then infected with VSV (MOI = 1·0). (d) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1 and different DUBs, followed by treatment with or without cycloheximide (50 μm) for 12 hr. (e) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1, control shRNAs (shCON) or shRNAs against human USP7 (shUSP7) as indicated and then infected with H1N1 (MOI = 1·0). (f) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells transfected with Myc‐SOCS1 and then treated with dimethylsulfoxide or <t>P5091</t> (100 nm) for 12 hr, followed by infection with VSV (MOI = 1·0). (g) Western blot analysis of <t>USP7</t> <t>protein</t> levels in A549 cells infected with H1N1 (MOI = 1·0) for the indicated times. (h,i) Western blot analysis of USP7 protein levels in HEK293T cells infected with Sendai virus (SeV) (MOI = 1·0) (h) or VSV (MOI = 1·0) (i). The densities of protein bands were quantified with imageJ. (j) Quantitative PCR analysis of USP7 mRNA levels in HEK293T cells infected with VSV (MOI = 1·0), SeV (MOI = 1·0) or H1N1 (MOI = 1·0) for 24 hr. (k) Quantitative PCR analysis of USP7 mRNA levels in HEK293T cells pretreated with pyrrolidine dithiocarbamate ammonium (PDTC) (nuclear factor‐κB inhibitor, 10 μm) for 1 hr and then infected with VSV (MOI = 1·0) for 24 hr. The data were shown as fold change normalized to that in uninfected control cells. (l) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1, together with control shRNAs (–) or three shUSP7 as indicated. (m) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1 and increasing amounts of Flag‐USP7. (n) Western blot analysis of SOCS1 protein levels in A549 cells co‐transfected with Flag‐USP7 (WT or inactive C223S mutant) as indicated
    Expression Constructs Usp7 Inhibitors, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/P5091/pmc07011631-60-2-20
    Average 94 stars, based on 1 article reviews
    expression constructs usp7 inhibitors - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Addgene inc usp7 constructs
    <t>USP7</t> activation by the C-terminal tail happens in cis . a Schematic domain representation of USP7 and constructs used in this study. Active site residues and domain names are indicated: TRAF TRAF domain, CD Catalytic domain, 1–5 Ubl domains 1 through 5, tail. The activating C-terminal peptide (res. 1083–1102), marked in purple. The graphical representation of the constructs is used in other figures. b Analysis of USP7 constructs on SEC-MALLS shows monomer/dimer equilibrium. CD45 (100 µL of 45 µM) or FL (80 µL of 20 µM) were loaded on a Superdex 200 gel filtration column. Absorbance at 280 nm (dark red: CD45; dark blue: FL) was monitored and eluted peaks were analysed for molecular weight (red: CD45; blue: FL) by in-line MALLS. For CD45 the molecular weights of the monomer (69 kDa) and dimer (138 kDa) are indicated with the dotted line. c Activation of USP7CD by Ubl45 requires the very C-terminal tail. CD (20 nM) was mixed with Ubl45 variants as indicated and tested for DUB activity using UbRho. d USP7CD (20 nM) was incubated with a titration range of Ubl45, and tested in a deubiquitination assay as in 1c. These initial velocities were plotted against the concentration to yield an apparent K D . Each data point is the mean ± SD of n = 2 measurements. e CD12345 ΔC (20 nM) has similar activity to CD and can be activated by the tail: when titrating in CD12345 C223A , which has no activity, the tail will activate the tailless construct upon dimerization. The activity readout shows that this dimerization-dependent activation of USP7 happens at micromolar concentrations in line with affinity of 1d. Binding of ubiquitin substrate to CD12345 C223A causes an inhibitory effect above 2 µM, therefore only lower concentrations were used to extrapolate a K D,app (blue dashes). The red dotted lines indicate the activity of WT CD12345 for comparison
    Usp7 Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/usp18+plasmid/pmc06335408-307-0-10
    Average 90 stars, based on 1 article reviews
    usp7 constructs - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc usp7 dna construct
    Clinical characteristics of enrolled HCC patients.
    Usp7 Dna Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/usp7+constructs/pCI-neo+Flag+HAUSP+(Plasmid+%2316655)/pmc05882160-96-1-7
    Average 93 stars, based on 1 article reviews
    usp7 dna construct - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    KIF23 and myosin heavy chain 9 (MYH9) interact with ubiquitin‐specific protease 7 (USP7). (A) Molecular docking results for KIF23 and MYH9. (B) Co‐immunoprecipitation (Co‐IP) analysis to detect the interaction between KIF23 and MYH9 in CC cells. (C) Immunofluorescence (IF) analysis showing the co‐localisation of KIF23 and MYH9 in CC cells (scale bar: 10 µm). (D) Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) analysis of MYH9 mRNA levels in CC cells with or without KIF23 KO. (E) Western blotting (WB) analysis of MYH9 protein levels in CC cells with or without KIF23 KO. (F) Nuclear and cytoplasmic fractionation assay to detect MYH9 protein levels in overexpression KIF23 (oe‐ KIF23 ) CC cells. (G) Schematic diagram of the functional domains of KIF23. (H) Co‐IP assay demonstrating the interaction between different KIF23 domains and MYH9 in HEK‐293T cells transfected with the corresponding constructs. (I) Schematic diagram of the functional domains of MYH9. (J) Co‐IP assay demonstrating the interaction between different MYH9 domains and KIF23 in HEK‐293T cells. (K and L) Molecular docking diagrams of MYH9 with USP7 and KIF23 with USP7. (M) Co‐IP analysis in CC cells demonstrating the interactions of MYH9 and KIF23 with USP7. (N and O) Representative confocal images showing the co‐localisation of MYH9 with USP7 and KIF23 with USP7 (scale bar: 10 µm).

    Journal: Clinical and Translational Medicine

    Article Title: Targeting KIF23 inhibits cell proliferation and primary chemoresistance in cervical cancer by inactivating the MYH9/MCM2/PCNA pathway

    doi: 10.1002/ctm2.70652

    Figure Lengend Snippet: KIF23 and myosin heavy chain 9 (MYH9) interact with ubiquitin‐specific protease 7 (USP7). (A) Molecular docking results for KIF23 and MYH9. (B) Co‐immunoprecipitation (Co‐IP) analysis to detect the interaction between KIF23 and MYH9 in CC cells. (C) Immunofluorescence (IF) analysis showing the co‐localisation of KIF23 and MYH9 in CC cells (scale bar: 10 µm). (D) Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) analysis of MYH9 mRNA levels in CC cells with or without KIF23 KO. (E) Western blotting (WB) analysis of MYH9 protein levels in CC cells with or without KIF23 KO. (F) Nuclear and cytoplasmic fractionation assay to detect MYH9 protein levels in overexpression KIF23 (oe‐ KIF23 ) CC cells. (G) Schematic diagram of the functional domains of KIF23. (H) Co‐IP assay demonstrating the interaction between different KIF23 domains and MYH9 in HEK‐293T cells transfected with the corresponding constructs. (I) Schematic diagram of the functional domains of MYH9. (J) Co‐IP assay demonstrating the interaction between different MYH9 domains and KIF23 in HEK‐293T cells. (K and L) Molecular docking diagrams of MYH9 with USP7 and KIF23 with USP7. (M) Co‐IP analysis in CC cells demonstrating the interactions of MYH9 and KIF23 with USP7. (N and O) Representative confocal images showing the co‐localisation of MYH9 with USP7 and KIF23 with USP7 (scale bar: 10 µm).

    Article Snippet: CC cells were transfected with plasmid constructs encoding USP7 (Miaoling Biology), MYH9 (Vigene Biosciences), MCM2 (Miaoling Biology) and USP15 (Miaoling Biology) using Lipofectamine 3000 (model L2000‐015; Invitrogen) as per the manufacturer's protocols.

    Techniques: Ubiquitin Proteomics, Immunoprecipitation, Co-Immunoprecipitation Assay, Immunofluorescence, Reverse Transcription, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Fractionation, Over Expression, Functional Assay, Transfection, Construct

    KIF23 induces K48‐linked deubiquitination of MYH9 through recruitment of USP7. (A) Western blotting (WB) analysis of MYH9 protein stability at different time points following cycloheximide (CHX) treatment in control and KIF23 KO groups. (B) CHX chase assay examining the regulation of MYH9 protein stability by USP7 overexpression (oe‐ USP7 ). (C) Effect of MG132 treatment (12 h) on MYH9 protein stability in KIF23 KO CC cells and their controls. (D) Co‐IP and WB analyses of the effect of KIF23 KO on MYH9 ubiquitination levels after 12 h of MG132 treatment. (E) Co‐IP and WB assays assessing the effects of control, KIF23 KO and KIF23 KO combined with USP7 overexpression (KO‐ KIF23 + oe‐ USP7 ) on MYH9 ubiquitination after 12 h of MG132 treatment in SIHA (left) and C33A (right) cells.

    Journal: Clinical and Translational Medicine

    Article Title: Targeting KIF23 inhibits cell proliferation and primary chemoresistance in cervical cancer by inactivating the MYH9/MCM2/PCNA pathway

    doi: 10.1002/ctm2.70652

    Figure Lengend Snippet: KIF23 induces K48‐linked deubiquitination of MYH9 through recruitment of USP7. (A) Western blotting (WB) analysis of MYH9 protein stability at different time points following cycloheximide (CHX) treatment in control and KIF23 KO groups. (B) CHX chase assay examining the regulation of MYH9 protein stability by USP7 overexpression (oe‐ USP7 ). (C) Effect of MG132 treatment (12 h) on MYH9 protein stability in KIF23 KO CC cells and their controls. (D) Co‐IP and WB analyses of the effect of KIF23 KO on MYH9 ubiquitination levels after 12 h of MG132 treatment. (E) Co‐IP and WB assays assessing the effects of control, KIF23 KO and KIF23 KO combined with USP7 overexpression (KO‐ KIF23 + oe‐ USP7 ) on MYH9 ubiquitination after 12 h of MG132 treatment in SIHA (left) and C33A (right) cells.

    Article Snippet: CC cells were transfected with plasmid constructs encoding USP7 (Miaoling Biology), MYH9 (Vigene Biosciences), MCM2 (Miaoling Biology) and USP15 (Miaoling Biology) using Lipofectamine 3000 (model L2000‐015; Invitrogen) as per the manufacturer's protocols.

    Techniques: Western Blot, Control, Over Expression, Co-Immunoprecipitation Assay, Ubiquitin Proteomics

    (A and B) Immunofluorescence of USP7 in the cerebral cortex on embryonic day 14 (E14; A) and post-natal day 42 (P42; B). Dashed lines demarcate the cortical plate (c.p.). Scale bars, 100 μm. (C) Virtual optomotor system (VOS) test: spatial frequency threshold. ** p < 0.01 by Bonferroni’s multiple-comparisons test. (D) Motor strength test: time to grip onto the inverted screen. * p < 0.05 by Dunn’s multiple-comparisons test. (E and F) CatWalk: relative mean intensity distributed onto front- and hindpaws (E) and limb swing speed (F). ** p < 0.01, *** p < 0.001 by Tukey’s multiple-comparisons test. See also . (G–I) Fear conditioning: percentage of freezing time in tone/shock pairing (G), contextual conditioning (H), and auditory cued conditioning (I). * p < 0.05, ** p < 0.01 by Bonferroni’s multiple-comparisons test ( Usp7 WT vs. cKO). (J) Representative biting injury on mice co-caged with Usp7 cKO mice. See also . (K) Percentage of tail biters among Usp7 cKO mice from 3 to 12 weeks old. (L) Schematic of behavioral phenotypes in Usp7 cKO mice that are relevant to HAFOUS. Data are presented as mean ± SEM. See also .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A and B) Immunofluorescence of USP7 in the cerebral cortex on embryonic day 14 (E14; A) and post-natal day 42 (P42; B). Dashed lines demarcate the cortical plate (c.p.). Scale bars, 100 μm. (C) Virtual optomotor system (VOS) test: spatial frequency threshold. ** p < 0.01 by Bonferroni’s multiple-comparisons test. (D) Motor strength test: time to grip onto the inverted screen. * p < 0.05 by Dunn’s multiple-comparisons test. (E and F) CatWalk: relative mean intensity distributed onto front- and hindpaws (E) and limb swing speed (F). ** p < 0.01, *** p < 0.001 by Tukey’s multiple-comparisons test. See also . (G–I) Fear conditioning: percentage of freezing time in tone/shock pairing (G), contextual conditioning (H), and auditory cued conditioning (I). * p < 0.05, ** p < 0.01 by Bonferroni’s multiple-comparisons test ( Usp7 WT vs. cKO). (J) Representative biting injury on mice co-caged with Usp7 cKO mice. See also . (K) Percentage of tail biters among Usp7 cKO mice from 3 to 12 weeks old. (L) Schematic of behavioral phenotypes in Usp7 cKO mice that are relevant to HAFOUS. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Immunofluorescence

    (A) Immunofluorescence of c-cas-3 in the cerebral cortex at different ages. Scale bar, 200 μm. (B) Schematic of the USP7-Mdm2-p53 signaling pathway regulating apoptosis. (C) Immunofluorescence of c-cas-3 in the cerebral cortex of mice of different Trp53 and Usp7 genotypes at P0. Scale bar, 200 μm. (D) Quantification of c-cas-3 fluorescent signal as in (C). * p < 0.05 by Tukey’s multiple-comparisons test. (E) VOS test: spatial frequency threshold. No significant genotype effect by one-way ANOVA. (F) Motor strength test: time to grip onto the inverted screen. * p < 0.05, ** p < 0.01 by Dunn’s multiple-comparisons test. (G and H) CatWalk: relative mean intensity distributed onto front- and hindpaws (G) and limb swing speed (H). * p < 0.05, *** p < 0.001, **** p < 0.0001 by Tukey’s multiple-comparison test. See also . (I–K) Fear conditioning: percentage of freezing time in tone/shock pairing (I), contextual conditioning (J), and auditory cued conditioning (K). * p < 0.05 by Bonferroni’s multiple-comparisons test ( Usp7 WT vs. cKO). (L) Representative biting injury on mice co-caged with Usp7 cKO; Trp53 +/− mice. (M) Percentage of tail biters among Usp7 cKO; Trp53 +/− mice from 3 to 12 weeks old. Data are presented as mean ± SEM. See also and .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A) Immunofluorescence of c-cas-3 in the cerebral cortex at different ages. Scale bar, 200 μm. (B) Schematic of the USP7-Mdm2-p53 signaling pathway regulating apoptosis. (C) Immunofluorescence of c-cas-3 in the cerebral cortex of mice of different Trp53 and Usp7 genotypes at P0. Scale bar, 200 μm. (D) Quantification of c-cas-3 fluorescent signal as in (C). * p < 0.05 by Tukey’s multiple-comparisons test. (E) VOS test: spatial frequency threshold. No significant genotype effect by one-way ANOVA. (F) Motor strength test: time to grip onto the inverted screen. * p < 0.05, ** p < 0.01 by Dunn’s multiple-comparisons test. (G and H) CatWalk: relative mean intensity distributed onto front- and hindpaws (G) and limb swing speed (H). * p < 0.05, *** p < 0.001, **** p < 0.0001 by Tukey’s multiple-comparison test. See also . (I–K) Fear conditioning: percentage of freezing time in tone/shock pairing (I), contextual conditioning (J), and auditory cued conditioning (K). * p < 0.05 by Bonferroni’s multiple-comparisons test ( Usp7 WT vs. cKO). (L) Representative biting injury on mice co-caged with Usp7 cKO; Trp53 +/− mice. (M) Percentage of tail biters among Usp7 cKO; Trp53 +/− mice from 3 to 12 weeks old. Data are presented as mean ± SEM. See also and .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Immunofluorescence, Comparison

    (A) Flowchart to characterize the proteome of the cerebral cortex with 10-plex TMT-MS. (B) Volcano plot showing differentially expressed proteins in TMT-MS. The p values were calculated by 2-tailed unpaired t test with Benjamini–Hochberg correction. (C) Network of GO gene sets de-enriched in Usp7 cKO cortices based on TMT protein abundance. Nodes represent gene sets (q < 0.01), and size of nodes represents number of genes. Edges represent GO-defined relations (similarity > 0.5), and thickness of edges represents similarity between gene sets. Interconnected synapse-related gene sets are circled and colored in orange. (D) GO terms enriched from downregulated proteins ( Usp7 cKO/WT fold change < 0.75). (E) Schematic of in vivo dendritic spine analysis of cortical pyramidal neurons. (F) Representative GFP micrographs of dendritic spines (arrowheads) on apical and basal dendrites. Scale bar, 5 μm. (G–I) Spine density on apical, basal, and all dendrites of pyramidal neurons in the motor cortex. **** p < 0.0001 by 2-tailed unpaired t test. Data are presented as mean ± SEM. See also .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A) Flowchart to characterize the proteome of the cerebral cortex with 10-plex TMT-MS. (B) Volcano plot showing differentially expressed proteins in TMT-MS. The p values were calculated by 2-tailed unpaired t test with Benjamini–Hochberg correction. (C) Network of GO gene sets de-enriched in Usp7 cKO cortices based on TMT protein abundance. Nodes represent gene sets (q < 0.01), and size of nodes represents number of genes. Edges represent GO-defined relations (similarity > 0.5), and thickness of edges represents similarity between gene sets. Interconnected synapse-related gene sets are circled and colored in orange. (D) GO terms enriched from downregulated proteins ( Usp7 cKO/WT fold change < 0.75). (E) Schematic of in vivo dendritic spine analysis of cortical pyramidal neurons. (F) Representative GFP micrographs of dendritic spines (arrowheads) on apical and basal dendrites. Scale bar, 5 μm. (G–I) Spine density on apical, basal, and all dendrites of pyramidal neurons in the motor cortex. **** p < 0.0001 by 2-tailed unpaired t test. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Quantitative Proteomics, In Vivo

    (A) Domain structure of mouse USP7 protein. R105, D165, and W165 are three amino acids necessary for substrate binding. , USP, ubiquitin-specific protease domain; Ubl, ubiquitin-like domain. (B) Silver staining of the FLAG-immunoprecipitated USP7 TRAF domain (arrowhead) with and without RDW mutations (R105A+D165A+W166A). (C) Protein-protein association map of the top 50 USP7 TRAF interactors (full STRING network, confidence > 0.4). Proteins in complexes are colored according to (D). (D) GO analysis (cellular component) of the top 50 USP7 TRAF interactors. nBAF complex, neuronal SWI/SNF (BAF) complex. (E) Heatmap showing adjusted p values for enrichment of the USP7 TRAF interactors in disease genes. ID, intellectual disability; ADHD, attention deficit hyperactivity disorder; SCZ, schizophrenia; Ns, not significant. The p values were calculated by one-sided hypergeometric test with Benjamini-Hochberg correction. See also .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A) Domain structure of mouse USP7 protein. R105, D165, and W165 are three amino acids necessary for substrate binding. , USP, ubiquitin-specific protease domain; Ubl, ubiquitin-like domain. (B) Silver staining of the FLAG-immunoprecipitated USP7 TRAF domain (arrowhead) with and without RDW mutations (R105A+D165A+W166A). (C) Protein-protein association map of the top 50 USP7 TRAF interactors (full STRING network, confidence > 0.4). Proteins in complexes are colored according to (D). (D) GO analysis (cellular component) of the top 50 USP7 TRAF interactors. nBAF complex, neuronal SWI/SNF (BAF) complex. (E) Heatmap showing adjusted p values for enrichment of the USP7 TRAF interactors in disease genes. ID, intellectual disability; ADHD, attention deficit hyperactivity disorder; SCZ, schizophrenia; Ns, not significant. The p values were calculated by one-sided hypergeometric test with Benjamini-Hochberg correction. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Binding Assay, Ubiquitin Proteomics, Silver Staining, Immunoprecipitation

    (A) Flowchart to characterize dynamics of the neuronal proteome in response to acute Usp7 knockout with 16-plex TMT-MS. (B) Immunoblot of USP7 depletion and Cre expression in primary cortical neurons over time. 14–3-3 is the loading control. (C) Volcano plot showing candidate substrates of USP7. Euclidean distances to USP7 were calculated in the space of TMT protein abundance. The p values were calculated by two-way ANOVA for Cre effect with Benjamini–Hochberg correction. (D) Heatmap of TMT protein abundance of USP7 and its candidate substrates. (E and F) Immunoblot images (E) and densitometric quantification (F) of candidate substrates in the cerebral cortex of Usp7 cKO; Trp53 +/− (n = 3) mice vs. Usp7 WT; Trp53 +/− ( n = 3) mice at P0. 14–3-3 and lamin A/C are loading controls. Arrowheads indicate multiple specific bands of a single candidate substrate. * p < 0.05, *** p < 0.001, **** p < 0.0001 by Šídák multiple-comparisons test. (G) RT-qPCR of candidate substrates in the cerebral cortex of Usp7 cKO; Trp53 +/− ( n = 5) mice vs. Usp7 WT; Trp53 +/− ( n = 3) mice at P0. **** p < 0.0001 by Šídák multiple-comparisons test. Data are presented as mean ± SEM. See also .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A) Flowchart to characterize dynamics of the neuronal proteome in response to acute Usp7 knockout with 16-plex TMT-MS. (B) Immunoblot of USP7 depletion and Cre expression in primary cortical neurons over time. 14–3-3 is the loading control. (C) Volcano plot showing candidate substrates of USP7. Euclidean distances to USP7 were calculated in the space of TMT protein abundance. The p values were calculated by two-way ANOVA for Cre effect with Benjamini–Hochberg correction. (D) Heatmap of TMT protein abundance of USP7 and its candidate substrates. (E and F) Immunoblot images (E) and densitometric quantification (F) of candidate substrates in the cerebral cortex of Usp7 cKO; Trp53 +/− (n = 3) mice vs. Usp7 WT; Trp53 +/− ( n = 3) mice at P0. 14–3-3 and lamin A/C are loading controls. Arrowheads indicate multiple specific bands of a single candidate substrate. * p < 0.05, *** p < 0.001, **** p < 0.0001 by Šídák multiple-comparisons test. (G) RT-qPCR of candidate substrates in the cerebral cortex of Usp7 cKO; Trp53 +/− ( n = 5) mice vs. Usp7 WT; Trp53 +/− ( n = 3) mice at P0. **** p < 0.0001 by Šídák multiple-comparisons test. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Knock-Out, Western Blot, Expressing, Control, Quantitative Proteomics, Quantitative RT-PCR

    (A) Representative GFP and PSD95 micrographs of dendritic spines (arrowheads) of DIV18 primary cortical neurons with knockdown of Ppil4 or luciferase (Luci). Micrographs of dendritic spines with knockdown of other candidate substrates are shown in . Scale bar, 5 μm. (B–G) Density of all (B–D) and PSD95+ (E–G) spines on apical, basal, and all dendrites of cortical neurons. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 by Dunnett’s multiple-comparisons test (compared to Luci). (H) Streptavidin pull-down of HEK293T lysate with overexpression of streptavidin-binding peptide-FLAG (SFB)-tagged USP7 followed by immunoblot analyses. (I) IP of endogenous Ppil4 in HEK293T lysates followed by immunoblot analyses. (J) Reciprocal IP of endogenous USP7 and Ppil4 in mouse brain at age P4, followed by immunoblot analyses. Input lysate with long exposure for clear visualization is shown on the left. (K) TUBE pull-down of MG132-treated neuronal lysate with USP7 loss driven by lentiviral Cre followed by immunoblotting of Ppil4. Densitometric quantification is shown at the bottom. IB, immunoblot; a.u., arbitrary unit. (L and M) In vitro deubiquitination using FLAG-immunoprecipitated Ppil4 from MG132-treated HEK293T cells (L) and densitometric quantification (M) of high-molecular-weight Ppil4 over all Ppil4 signals with 3 biological replicates. ** p < 0.01 by 2-tailed unpaired t test. (N and O) Immunoblot and densitometric quantification ( n = 5 biological replicates) of endogenous Ppil4 in HEK293T cells expressing patient variants of USP7. USP7 C223A is catalytically dead as a positive control. * p < 0.05, ** p < 0.01 by Dunnett’s multiple-comparisons test after repeated-measurement one-way ANOVA. (P) Schematic of the USP7-Ppil4 signaling pathway regulating dendritic spines. Data are presented as mean ± SEM. See also .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A) Representative GFP and PSD95 micrographs of dendritic spines (arrowheads) of DIV18 primary cortical neurons with knockdown of Ppil4 or luciferase (Luci). Micrographs of dendritic spines with knockdown of other candidate substrates are shown in . Scale bar, 5 μm. (B–G) Density of all (B–D) and PSD95+ (E–G) spines on apical, basal, and all dendrites of cortical neurons. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 by Dunnett’s multiple-comparisons test (compared to Luci). (H) Streptavidin pull-down of HEK293T lysate with overexpression of streptavidin-binding peptide-FLAG (SFB)-tagged USP7 followed by immunoblot analyses. (I) IP of endogenous Ppil4 in HEK293T lysates followed by immunoblot analyses. (J) Reciprocal IP of endogenous USP7 and Ppil4 in mouse brain at age P4, followed by immunoblot analyses. Input lysate with long exposure for clear visualization is shown on the left. (K) TUBE pull-down of MG132-treated neuronal lysate with USP7 loss driven by lentiviral Cre followed by immunoblotting of Ppil4. Densitometric quantification is shown at the bottom. IB, immunoblot; a.u., arbitrary unit. (L and M) In vitro deubiquitination using FLAG-immunoprecipitated Ppil4 from MG132-treated HEK293T cells (L) and densitometric quantification (M) of high-molecular-weight Ppil4 over all Ppil4 signals with 3 biological replicates. ** p < 0.01 by 2-tailed unpaired t test. (N and O) Immunoblot and densitometric quantification ( n = 5 biological replicates) of endogenous Ppil4 in HEK293T cells expressing patient variants of USP7. USP7 C223A is catalytically dead as a positive control. * p < 0.05, ** p < 0.01 by Dunnett’s multiple-comparisons test after repeated-measurement one-way ANOVA. (P) Schematic of the USP7-Ppil4 signaling pathway regulating dendritic spines. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Knockdown, Luciferase, Over Expression, Binding Assay, Western Blot, In Vitro, Immunoprecipitation, High Molecular Weight, Expressing, Positive Control

    (A) Flowchart to analyze RNA splicing upon USP7 loss. (B) GO terms enriched from genes of differential splicing clusters in LeafCutter analysis (FDR < 0.05 between Usp7 WT; Trp53 +/− and Usp7 cKO; Trp53 +/− mice). (C) Cumulative frequency curves of LeafCutter FDR of fully annotated and cryptic splicing clusters. Cumulative frequency curves for differential splicing clusters are expanded in the inset. * p < 0.05 by Kolmogorov-Smirnov test. (D) Percentage breakdown of exon-exon junction subtypes in differential and nondifferential splicing clusters. (E) Gene structure of Stxbp1 . (F–H) Inclusion of exon 19 of Stxbp1 , shown by LeafCutter sashimi plot (F), isoform-specific RT-qPCR bar plot (G), and volcano plot of all peptides mapped to Stxbp1 in TMT-MS (H). * p < 0.05 by uncorrected Fisher’s least significant difference (LSD) multiple-comparisons test. (I) Gene structure of Kalrn . (J–L) Usage of exon 34a or exon34b of Kalrn , shown by LeafCutter sashimi plot (J), isoform-specific RT-qPCR bar plot (K), and volcano plot of all peptides mapped to Stxbp1 in TMT-MS (L). **** p < 0.0001 by uncorrected Fisher’s LSD multiple-comparisons test. Data are presented as mean ± SEM. See also and .

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet: (A) Flowchart to analyze RNA splicing upon USP7 loss. (B) GO terms enriched from genes of differential splicing clusters in LeafCutter analysis (FDR < 0.05 between Usp7 WT; Trp53 +/− and Usp7 cKO; Trp53 +/− mice). (C) Cumulative frequency curves of LeafCutter FDR of fully annotated and cryptic splicing clusters. Cumulative frequency curves for differential splicing clusters are expanded in the inset. * p < 0.05 by Kolmogorov-Smirnov test. (D) Percentage breakdown of exon-exon junction subtypes in differential and nondifferential splicing clusters. (E) Gene structure of Stxbp1 . (F–H) Inclusion of exon 19 of Stxbp1 , shown by LeafCutter sashimi plot (F), isoform-specific RT-qPCR bar plot (G), and volcano plot of all peptides mapped to Stxbp1 in TMT-MS (H). * p < 0.05 by uncorrected Fisher’s least significant difference (LSD) multiple-comparisons test. (I) Gene structure of Kalrn . (J–L) Usage of exon 34a or exon34b of Kalrn , shown by LeafCutter sashimi plot (J), isoform-specific RT-qPCR bar plot (K), and volcano plot of all peptides mapped to Stxbp1 in TMT-MS (L). **** p < 0.0001 by uncorrected Fisher’s LSD multiple-comparisons test. Data are presented as mean ± SEM. See also and .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Quantitative RT-PCR

    Journal: Cell reports

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1016/j.celrep.2025.115231

    Figure Lengend Snippet:

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, an S protein-Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Western Blot, Immunoprecipitation, Immunofluorescence, Virus, Recombinant, Protease Inhibitor, Magnetic Beads, Mass Spectrometry, Software

    Loss of USP7 in glutamatergic excitatory neurons leads to multiple disease-relevant behavioral deficits and apoptosis in mice. (A) Patients with the Hao-Fountain syndrome and Usp7 conditional knockout (cKO) mice exhibit phenotypes in similar behavioral domains. (B) Double immunofluorescence of USP7 and neuron nuclear protein (NeuN) in cerebral cortex at postnatal day 42 (P42). USP7 protein was absent in most neuronal nuclei in Usp7 cKO cortex. Scale bar 100µm. (C) Virtual optomotor system (VOS) test: Spatial frequency threshold for head turn. Usp7 cKO mice (n = 6) showed reduced visual acuity compared to Usp7 WT (n = 5) and cHet mice (n = 8). **p<0.01 by Bonferroni’s multiple comparison test. (D) Motor strength test: Time to grip onto inverted screen. Usp7 cKO mice (n = 8) showed shorter latency to fall than Usp7 WT (n = 8) and cHet mice (n = 11). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (E) Catwalk 1: Relative mean intensity distributed onto each paw. Usp7 cKO mice (n = 8) put less weight onto front paw and more onto hind paw, compared to Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01 by Tukey’s multiple comparison test. See also Video S2. (F) Catwalk 2: Limb swing speed. Usp7 cKO mice (n = 8) showed higher swing speed of both front and hind limb than Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01, ***p<0.001 by Tukey’s multiple comparison test. See also Video S2. (G) Fear conditioning day 1: Time spent in freezing for tone/shock pairing (n = 8, 11 & 6 for Usp7 WT, Usp7 cHet and Usp7 cKO mice). No significant genotype effect by two-way ANOVA. (H) Fear conditioning day 2: Time spent in freezing for contextual conditioning. Usp7 cKO mice spent less time in freezing than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05, **p<0.01 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (I) Fear conditioning day 3: Time spent in freezing for auditory cue conditioning. Usp7 cKO mice spent less time in freezing after the tone than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (J) Percentage of tail biters among all monitored Usp7 cKO mice from 3 to 12 weeks old. Tail biters were identified if their co-caged mice had biting marks on the tails. (K) Representative biting injury on mice co-caged with Usp7 cKO mice. See also Video S3. Data are presented as mean ± SEM. See also .

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Loss of USP7 in glutamatergic excitatory neurons leads to multiple disease-relevant behavioral deficits and apoptosis in mice. (A) Patients with the Hao-Fountain syndrome and Usp7 conditional knockout (cKO) mice exhibit phenotypes in similar behavioral domains. (B) Double immunofluorescence of USP7 and neuron nuclear protein (NeuN) in cerebral cortex at postnatal day 42 (P42). USP7 protein was absent in most neuronal nuclei in Usp7 cKO cortex. Scale bar 100µm. (C) Virtual optomotor system (VOS) test: Spatial frequency threshold for head turn. Usp7 cKO mice (n = 6) showed reduced visual acuity compared to Usp7 WT (n = 5) and cHet mice (n = 8). **p<0.01 by Bonferroni’s multiple comparison test. (D) Motor strength test: Time to grip onto inverted screen. Usp7 cKO mice (n = 8) showed shorter latency to fall than Usp7 WT (n = 8) and cHet mice (n = 11). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (E) Catwalk 1: Relative mean intensity distributed onto each paw. Usp7 cKO mice (n = 8) put less weight onto front paw and more onto hind paw, compared to Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01 by Tukey’s multiple comparison test. See also Video S2. (F) Catwalk 2: Limb swing speed. Usp7 cKO mice (n = 8) showed higher swing speed of both front and hind limb than Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01, ***p<0.001 by Tukey’s multiple comparison test. See also Video S2. (G) Fear conditioning day 1: Time spent in freezing for tone/shock pairing (n = 8, 11 & 6 for Usp7 WT, Usp7 cHet and Usp7 cKO mice). No significant genotype effect by two-way ANOVA. (H) Fear conditioning day 2: Time spent in freezing for contextual conditioning. Usp7 cKO mice spent less time in freezing than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05, **p<0.01 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (I) Fear conditioning day 3: Time spent in freezing for auditory cue conditioning. Usp7 cKO mice spent less time in freezing after the tone than Usp7 WT mice. Numbers of mice are the same as in (G). *p<0.05 by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (J) Percentage of tail biters among all monitored Usp7 cKO mice from 3 to 12 weeks old. Tail biters were identified if their co-caged mice had biting marks on the tails. (K) Representative biting injury on mice co-caged with Usp7 cKO mice. See also Video S3. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Knock-Out, Immunofluorescence, Comparison

    Additional phenotypic characterization of Usp7 cKO mice. Related to and . (A) Immunofluorescence of USP7 in cerebral cortex at embryonic day 14 (E14). USP7 is localized to both Ki-67+ ventricular-subventricular zone (V-SVZ) and cortical plate (CP) in USP7 WT cortex. But in Usp7 cKO cortex, USP7 is depleted only in post-mitotic cortical plate (dashed outline). Scale bar 100µm. (B) Body weight curve from P6 to P48. Usp7 cKO mice (n = 7) exhibited body weight growth delay, compared to Usp7 WT (n = 10) and cHet mice (n = 7). (C) Body weight of adult mice. Number of mice = 8, 11 & 9 for Usp7 WT, cHet & cKO, respectively. No significant genotype effect by one-way ANOVA. (D) Motor coordination test 1: Ledge test. Usp7 cKO mice (n = 8) showed shorter latency to fall from ledge than Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01 by Dunn’s multiple comparison test. (E) Motor coordination test 2: Platform test. Usp7 cKO mice showed shorter latency to fall from platform than Usp7 WT mice. Numbers of mice are the same as in (D). **p<0.01 by Dunn’s multiple comparison test. (F) Motor coordination test 3: Pole test, time to climb down the pole. Numbers of mice are the same as in (D). No significant genotype effect by one-way ANOVA. (G) Motor coordination test 4: Pole test, time to turn at the tip of the pole. Usp7 cKO mice spent more time in turning than Usp7 WT and cHet mice. Numbers of mice are the same as in (D). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (H) Catwalk 3: Stride length. Usp7 cKO mice showed slightly shorter average stride length than control. Numbers of mice are the same as in (D). *p<0.05 by Tukey’s multiple comparison test. (I) Catwalk 4: Swing time. Usp7 cKO mice used less time swinging front and hind legs for each step, compared to Usp7 WT and cHet mice. Numbers of mice are the same as in (D). *p<0.05, ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. (J) Hearing test: Magnitude of response to acoustic startle at different dB level. Number of mice = 5, 8 & 6 for Usp7 WT, Usp7 cHet & Usp7 cKO. No significant genotype effect by two-way ANOVA. (K) Y maze: Alternative rate in choosing arm to enter. Number of mice = 4, 6 & 5 for Usp7 WT, Usp7 cHet & Usp7 cKO. No significant genotype effect by one-way ANOVA. Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Additional phenotypic characterization of Usp7 cKO mice. Related to and . (A) Immunofluorescence of USP7 in cerebral cortex at embryonic day 14 (E14). USP7 is localized to both Ki-67+ ventricular-subventricular zone (V-SVZ) and cortical plate (CP) in USP7 WT cortex. But in Usp7 cKO cortex, USP7 is depleted only in post-mitotic cortical plate (dashed outline). Scale bar 100µm. (B) Body weight curve from P6 to P48. Usp7 cKO mice (n = 7) exhibited body weight growth delay, compared to Usp7 WT (n = 10) and cHet mice (n = 7). (C) Body weight of adult mice. Number of mice = 8, 11 & 9 for Usp7 WT, cHet & cKO, respectively. No significant genotype effect by one-way ANOVA. (D) Motor coordination test 1: Ledge test. Usp7 cKO mice (n = 8) showed shorter latency to fall from ledge than Usp7 WT (n = 7) and cHet mice (n = 9). **p<0.01 by Dunn’s multiple comparison test. (E) Motor coordination test 2: Platform test. Usp7 cKO mice showed shorter latency to fall from platform than Usp7 WT mice. Numbers of mice are the same as in (D). **p<0.01 by Dunn’s multiple comparison test. (F) Motor coordination test 3: Pole test, time to climb down the pole. Numbers of mice are the same as in (D). No significant genotype effect by one-way ANOVA. (G) Motor coordination test 4: Pole test, time to turn at the tip of the pole. Usp7 cKO mice spent more time in turning than Usp7 WT and cHet mice. Numbers of mice are the same as in (D). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (H) Catwalk 3: Stride length. Usp7 cKO mice showed slightly shorter average stride length than control. Numbers of mice are the same as in (D). *p<0.05 by Tukey’s multiple comparison test. (I) Catwalk 4: Swing time. Usp7 cKO mice used less time swinging front and hind legs for each step, compared to Usp7 WT and cHet mice. Numbers of mice are the same as in (D). *p<0.05, ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. (J) Hearing test: Magnitude of response to acoustic startle at different dB level. Number of mice = 5, 8 & 6 for Usp7 WT, Usp7 cHet & Usp7 cKO. No significant genotype effect by two-way ANOVA. (K) Y maze: Alternative rate in choosing arm to enter. Number of mice = 4, 6 & 5 for Usp7 WT, Usp7 cHet & Usp7 cKO. No significant genotype effect by one-way ANOVA. Data are presented as mean ± SEM.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Immunofluorescence, Comparison

    Deletion of p53 rescues apoptosis, impairment of visual acuity and auditory cue conditioning in Usp7 cKO mice but not other behavioral deficits. (A) Immunofluorescence of apoptosis marker cleaved caspase 3 (c-cas 3) in cerebral cortex at different developmental time points. Usp7 cKO cortex showed large scale of apoptosis at P0, whereas apoptosis is low at E15, P5 and P10. Scale bars all 200µm. (B) Schematic of USP7-Mdm2-p53 signaling pathway regulating apoptosis. (C) Immunofluorescence of c-cas 3 in P0 cortex of different Trp53 and Usp7 genotypes. Trp53 heterozygosity diminished USP7 loss-induced apoptosis. Scale bar 200µm. (D) Quantification of c-cas 3 fluorescent signal, as shown in (C). Number of mice = 3, 3, 4 & 3 for Usp7 WT, Usp7 cKO, Usp7 cKO; Trp53 +/− & Usp7 WT; Trp53 +/−, respectively. *p<0.05 by Tukey’s multiple comparison test. (E) Virtual optomotor system (VOS) test: Spatial frequency threshold for head turn. Usp7 cKO; Trp53 +/− mice (n = 15) did not have impaired visual acuity, compared to Usp7 WT; Trp53 +/− (n = 14) and Usp7 cHet; Trp53 +/− mice (n = 9). No significant genotype effect by one-way ANOVA. (F) Motor strength test: Time to grip onto inverted screen. Usp7 cKO mice (n = 10) showed shorter latency to fall than Usp7 WT; Trp53 +/− (n = 10) and Usp7 cHet; Trp53 +/− mice (n = 14). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (G) Catwalk 1: Relative mean intensity distributed onto each paw. Usp7 cKO; Trp53 +/− mice (n = 5) put less weight onto front paw and more onto hind paw than Usp7 WT; Trp53 +/− (n = 7) and Usp7 cHet; Trp53 +/− mice (n = 8). ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. See also Video S4. (H) Catwalk 2: Limb swing speed. Usp7 cKO; Trp53 +/− mice showed slightly higher swing speed than Usp7 cHet; Trp53 +/− mice. Numbers of mice are the same as in (G). *p<0.05 by Tukey’s multiple comparison test. See also Video S4. (I) Fear conditioning day 1: Time spent in freezing for tone/shock pairing (n = 12, 6 & 11 for Usp7 WT, Usp7 cHet and Usp7 cKO mice). No significant genotype effect by two-way ANOVA. (J) Fear conditioning day 2: Time spent in freezing for contextual conditioning. Usp7 cKO; Trp53 +/− mice spent less time in freezing than Usp7 WT; Trp53 +/− mice. Numbers of mice are the same as in (H). *p<0.05, by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (K) Fear conditioning day 3: Time spent in freezing for auditory cue conditioning. Usp7 cKO; Trp53 +/− mice had no difference in freezing after the tone, compared to Usp7 WT; Trp53 +/− and Usp7 cHet; Trp53 +/− mice. Numbers of mice are the same as in (H). No significant genotype effect by two-way ANOVA. (L) Percentage of tail biters among all monitored Usp7 cKO; Trp53 +/− mice from 3 to 12 weeks old. Tail biters were counted if their co-caged mice had biting marks on their tails. (M) Representative biting injury on mice co-caged with Usp7 cKO; Trp53 +/− mice. Data are presented as mean ± SEM. See also , and .

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Deletion of p53 rescues apoptosis, impairment of visual acuity and auditory cue conditioning in Usp7 cKO mice but not other behavioral deficits. (A) Immunofluorescence of apoptosis marker cleaved caspase 3 (c-cas 3) in cerebral cortex at different developmental time points. Usp7 cKO cortex showed large scale of apoptosis at P0, whereas apoptosis is low at E15, P5 and P10. Scale bars all 200µm. (B) Schematic of USP7-Mdm2-p53 signaling pathway regulating apoptosis. (C) Immunofluorescence of c-cas 3 in P0 cortex of different Trp53 and Usp7 genotypes. Trp53 heterozygosity diminished USP7 loss-induced apoptosis. Scale bar 200µm. (D) Quantification of c-cas 3 fluorescent signal, as shown in (C). Number of mice = 3, 3, 4 & 3 for Usp7 WT, Usp7 cKO, Usp7 cKO; Trp53 +/− & Usp7 WT; Trp53 +/−, respectively. *p<0.05 by Tukey’s multiple comparison test. (E) Virtual optomotor system (VOS) test: Spatial frequency threshold for head turn. Usp7 cKO; Trp53 +/− mice (n = 15) did not have impaired visual acuity, compared to Usp7 WT; Trp53 +/− (n = 14) and Usp7 cHet; Trp53 +/− mice (n = 9). No significant genotype effect by one-way ANOVA. (F) Motor strength test: Time to grip onto inverted screen. Usp7 cKO mice (n = 10) showed shorter latency to fall than Usp7 WT; Trp53 +/− (n = 10) and Usp7 cHet; Trp53 +/− mice (n = 14). *p<0.05, **p<0.01 by Dunn’s multiple comparison test. (G) Catwalk 1: Relative mean intensity distributed onto each paw. Usp7 cKO; Trp53 +/− mice (n = 5) put less weight onto front paw and more onto hind paw than Usp7 WT; Trp53 +/− (n = 7) and Usp7 cHet; Trp53 +/− mice (n = 8). ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. See also Video S4. (H) Catwalk 2: Limb swing speed. Usp7 cKO; Trp53 +/− mice showed slightly higher swing speed than Usp7 cHet; Trp53 +/− mice. Numbers of mice are the same as in (G). *p<0.05 by Tukey’s multiple comparison test. See also Video S4. (I) Fear conditioning day 1: Time spent in freezing for tone/shock pairing (n = 12, 6 & 11 for Usp7 WT, Usp7 cHet and Usp7 cKO mice). No significant genotype effect by two-way ANOVA. (J) Fear conditioning day 2: Time spent in freezing for contextual conditioning. Usp7 cKO; Trp53 +/− mice spent less time in freezing than Usp7 WT; Trp53 +/− mice. Numbers of mice are the same as in (H). *p<0.05, by Bonferroni’s multiple comparison test ( Usp7 WT vs. cKO). (K) Fear conditioning day 3: Time spent in freezing for auditory cue conditioning. Usp7 cKO; Trp53 +/− mice had no difference in freezing after the tone, compared to Usp7 WT; Trp53 +/− and Usp7 cHet; Trp53 +/− mice. Numbers of mice are the same as in (H). No significant genotype effect by two-way ANOVA. (L) Percentage of tail biters among all monitored Usp7 cKO; Trp53 +/− mice from 3 to 12 weeks old. Tail biters were counted if their co-caged mice had biting marks on their tails. (M) Representative biting injury on mice co-caged with Usp7 cKO; Trp53 +/− mice. Data are presented as mean ± SEM. See also , and .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Immunofluorescence, Marker, Comparison

    Loss of USP7 in glutamatergic neurons induces apoptosis in a cell autonomous manner. Related to . (A) Double immunofluorescence of cleaved caspase 3 (c-cas 3) and Cre. An expanded region shows overlap (arrows) of cleaved caspase 3 and Cre, supporting that the apoptotic cells are glutamatergic neurons. Scale bar 200µm. (B) Western blot validation of USP7 RNAi in HEK293Tcells. Both USP7i.1 and USP7i.2 diminished expression of GFP-USP7. 14-3-3 is loading control. (C) Immunocytochemistry of c-cas 3 in primary cortical neurons dissociated from wild-type E14 cortices and transfected with a GFP plasmid. Scale bar 100µm. Cells were fixed at DIV5, 6 and 7. At the bottom are close-up of neurons with and without c-cas 3 signal. (D) Quantification of apoptotic percentage, defined as the percentage of c-cas 3 and GFP double positive neurons among all GFP positive neurons. Cortical neurons were transfected with USP7 shRNA plasmids at 3 days in vitro (DIV3) and analyzed at DIV5, 6 and 7. Data were collected from three independent batches of neuron culture, three wells per condition within each batch. USP7 knockdown by two independent shRNA led to a progressive elevation in apoptotic percentage. Empty vector U6 and knockdown of an irrelevant deubiquitinase, USP30, served as negative controls. ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Loss of USP7 in glutamatergic neurons induces apoptosis in a cell autonomous manner. Related to . (A) Double immunofluorescence of cleaved caspase 3 (c-cas 3) and Cre. An expanded region shows overlap (arrows) of cleaved caspase 3 and Cre, supporting that the apoptotic cells are glutamatergic neurons. Scale bar 200µm. (B) Western blot validation of USP7 RNAi in HEK293Tcells. Both USP7i.1 and USP7i.2 diminished expression of GFP-USP7. 14-3-3 is loading control. (C) Immunocytochemistry of c-cas 3 in primary cortical neurons dissociated from wild-type E14 cortices and transfected with a GFP plasmid. Scale bar 100µm. Cells were fixed at DIV5, 6 and 7. At the bottom are close-up of neurons with and without c-cas 3 signal. (D) Quantification of apoptotic percentage, defined as the percentage of c-cas 3 and GFP double positive neurons among all GFP positive neurons. Cortical neurons were transfected with USP7 shRNA plasmids at 3 days in vitro (DIV3) and analyzed at DIV5, 6 and 7. Data were collected from three independent batches of neuron culture, three wells per condition within each batch. USP7 knockdown by two independent shRNA led to a progressive elevation in apoptotic percentage. Empty vector U6 and knockdown of an irrelevant deubiquitinase, USP30, served as negative controls. ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. Data are presented as mean ± SEM.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Immunofluorescence, Western Blot, Expressing, Immunocytochemistry, Transfection, Plasmid Preparation, shRNA, In Vitro, Comparison

    Deletion of p53 rescues USP7 loss-induced apoptosis but minimally restores the brain volume reduction in Usp7 cKO mice. Related to and . (A) Immunofluorescence of c-cas 3 in the cerebral cortex of Usp7 cKO mice at P0 with deletion of one or both allele of Trp53 . C-cas 3 signal remained sparse with either Trp53 heterozygosity or homozygosity. Scale bar 200µm. (B) Immunofluorescence of USP7 in primary cortical neurons dissociated from Usp7 fl/fl ; Trp53 +/− embryos. Neurons transduced with Cre WT showed loss of USP7 protein at DIV14. Scale bar 25µm. (C) MTS assay of Usp7 fl/fl cortical neurons transduced by lentiviral Cre with different Trp53 genotypes. USP7 knockout in Trp53 +/+ neurons (n = 5 wells) strongly reduced cell viability, indicating of neuronal death. No significant viability decrease in Trp53 +/− (n = 3 wells) and Trp53 −/− neurons (n = 5 wells). Puromycin (2µg/mL, 24hrs) treated neurons serve as positive control. ***p<0.001 by Šídák’s multiple comparisons test between Cre WT and Cre dead. (D) Representative segmentation on FA map and DWI for volumetric measurement with diffusion-weighted ex vivo MRI. Cerbral cortex and hippocampus are shown in blue and red, respectively. (E) Volumetric measurement with ex vivo MRI. Usp7 cKO brains (P30-32) are smaller than Usp7 WT . Deletion of p53 minimally stored the volume of cortex and hippocampus. OB = olfactory bulbs. Number of mice = 5, 4, 5 & 5 for Usp7 WT, Usp7 cKO, Usp7 WT; Trp53 +/− & Usp7 cKO; Trp53 +/− . *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Deletion of p53 rescues USP7 loss-induced apoptosis but minimally restores the brain volume reduction in Usp7 cKO mice. Related to and . (A) Immunofluorescence of c-cas 3 in the cerebral cortex of Usp7 cKO mice at P0 with deletion of one or both allele of Trp53 . C-cas 3 signal remained sparse with either Trp53 heterozygosity or homozygosity. Scale bar 200µm. (B) Immunofluorescence of USP7 in primary cortical neurons dissociated from Usp7 fl/fl ; Trp53 +/− embryos. Neurons transduced with Cre WT showed loss of USP7 protein at DIV14. Scale bar 25µm. (C) MTS assay of Usp7 fl/fl cortical neurons transduced by lentiviral Cre with different Trp53 genotypes. USP7 knockout in Trp53 +/+ neurons (n = 5 wells) strongly reduced cell viability, indicating of neuronal death. No significant viability decrease in Trp53 +/− (n = 3 wells) and Trp53 −/− neurons (n = 5 wells). Puromycin (2µg/mL, 24hrs) treated neurons serve as positive control. ***p<0.001 by Šídák’s multiple comparisons test between Cre WT and Cre dead. (D) Representative segmentation on FA map and DWI for volumetric measurement with diffusion-weighted ex vivo MRI. Cerbral cortex and hippocampus are shown in blue and red, respectively. (E) Volumetric measurement with ex vivo MRI. Usp7 cKO brains (P30-32) are smaller than Usp7 WT . Deletion of p53 minimally stored the volume of cortex and hippocampus. OB = olfactory bulbs. Number of mice = 5, 4, 5 & 5 for Usp7 WT, Usp7 cKO, Usp7 WT; Trp53 +/− & Usp7 cKO; Trp53 +/− . *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by Tukey’s multiple comparison test. Data are presented as mean ± SEM.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Immunofluorescence, Transduction, MTS Assay, Knock-Out, Positive Control, Diffusion-based Assay, Ex Vivo, Comparison

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet:

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Comparison

    Additional phenotypic characterization of Usp7 cKO; Trp53 +/− mice. Related to and . (A) Body weight curve from P6 to P48. Usp7 cKO; Trp53 +/− mice (n = 6) exhibited body weight growth delay, compared to Usp7 WT; Trp53 +/− (n = 10) and Usp7 cHet; Trp53 +/− mice (n = 5). (B) Body weight of adult mice. Number of mice = 10, 14 & 10 for Usp7 WT, cHet & cKO; Trp53 +/− , respectively. No significant genotype effect by one-way ANOVA. (C) Motor coordination test 1: Ledge test. Usp7 cKO; Trp53 +/− mice showed slightly shorter latency to fall from ledge than control mice. Numbers of mice are the same as in (B). *p<0.05 by Dunn’s multiple comparison test. (D) Motor coordination test 2: Platform test. Usp7 cKO; Trp53 +/− mice showed shorter latency to fall from platform than control mice. Numbers of mice are the same as in (B). **p<0.01 by Dunn’s multiple comparison test. (E) Motor coordination test 3: Pole test, time to climb down the pole. Numbers of mice are the same as in (B). No significant genotype effect by one-way ANOVA. (F) Motor coordination test 4: Pole test, time to turn at the tip of the pole. Usp7 cKO; Trp53 +/− mice spent more time in turning than control mice. Numbers of mice are the same as in (B). **p<0.01, ***p<0.001 by Dunn’s multiple comparison test. (G) Catwalk 3: Stride length. Usp7 cKO; Trp53 +/− mice showed shorter average stride length than control. Number of mice = 7, 8 & 5 for Usp7 WT, cHet & cKO; Trp53 +/− . *p<0.05, **p<0.01 by Tukey’s multiple comparison test. (H) Catwalk 4: Swing time. Usp7 cKO; Trp53 +/− mice used less time swinging front and hind legs for each step, compared to control mice. Numbers of mice are the same as in (G). *p<0.05, ***p<0.001 by Tukey’s multiple comparison test. (I) Hearing test: Magnitude of response to acoustic startle at different dB level. Number of mice = 10, 14 & 10 for Usp7 WT, cHet & cKO; Trp53 +/− . No significant genotype effect by two-way ANOVA. Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Additional phenotypic characterization of Usp7 cKO; Trp53 +/− mice. Related to and . (A) Body weight curve from P6 to P48. Usp7 cKO; Trp53 +/− mice (n = 6) exhibited body weight growth delay, compared to Usp7 WT; Trp53 +/− (n = 10) and Usp7 cHet; Trp53 +/− mice (n = 5). (B) Body weight of adult mice. Number of mice = 10, 14 & 10 for Usp7 WT, cHet & cKO; Trp53 +/− , respectively. No significant genotype effect by one-way ANOVA. (C) Motor coordination test 1: Ledge test. Usp7 cKO; Trp53 +/− mice showed slightly shorter latency to fall from ledge than control mice. Numbers of mice are the same as in (B). *p<0.05 by Dunn’s multiple comparison test. (D) Motor coordination test 2: Platform test. Usp7 cKO; Trp53 +/− mice showed shorter latency to fall from platform than control mice. Numbers of mice are the same as in (B). **p<0.01 by Dunn’s multiple comparison test. (E) Motor coordination test 3: Pole test, time to climb down the pole. Numbers of mice are the same as in (B). No significant genotype effect by one-way ANOVA. (F) Motor coordination test 4: Pole test, time to turn at the tip of the pole. Usp7 cKO; Trp53 +/− mice spent more time in turning than control mice. Numbers of mice are the same as in (B). **p<0.01, ***p<0.001 by Dunn’s multiple comparison test. (G) Catwalk 3: Stride length. Usp7 cKO; Trp53 +/− mice showed shorter average stride length than control. Number of mice = 7, 8 & 5 for Usp7 WT, cHet & cKO; Trp53 +/− . *p<0.05, **p<0.01 by Tukey’s multiple comparison test. (H) Catwalk 4: Swing time. Usp7 cKO; Trp53 +/− mice used less time swinging front and hind legs for each step, compared to control mice. Numbers of mice are the same as in (G). *p<0.05, ***p<0.001 by Tukey’s multiple comparison test. (I) Hearing test: Magnitude of response to acoustic startle at different dB level. Number of mice = 10, 14 & 10 for Usp7 WT, cHet & cKO; Trp53 +/− . No significant genotype effect by two-way ANOVA. Data are presented as mean ± SEM.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Comparison

    Loss of USP7 reduces synapses in cortex. (A) Flowchart to profile the proteome of the cerebral cortex of Usp7 cKO mice with tandem mass tag-mass spectrometry (TMT-MS). (B) Volcano plot of all profiled proteins in TMT-MS. Up-regulated and down-regulated proteins ( Usp7 cKO vs. WT) are labeled in red and blue, respectively. P-value were calculated by 2-tail unpaired t-test. (C) Organic layout of enriched GO gene sets based on TMT protein abundance in (B). Nodes represent gene sets (q-value < 0.01) and size of nodes represents how many genes contained in gene sets. Edges represent GO-defined relations (similarity > 0.5) and thickness of edges represents similarity between gene sets. Most enriched gene sets are related to synapse and circled in red. All gene sets shown are enriched in Usp7 WT and de-enriched in Usp7 cKO. (D) GO terms enriched from ranked list of down-regulated proteins ( Usp7 cKO vs. WT fold change < 0.75). (E) Ventricular injection of AAV PHP.eB Syn-GFP-P2A-GFPf at P0/1 to sparsely label pyramidal neurons in cerebral cortex and dendritic spine analysis at P18. (F) Representative images of dendritic spines on apical and basal dendrites. Scale bar 5µm. (G, H, I) Spine density on apical, basal and all dendrites of pyramidal neurons in motor cortex. Usp7 cKO; Trp53 +/− neurons (n = 39 & 39 neurons for apical dendrites & basal dendrites from 3 mice) showed reduced spine density than Usp7 WT; Trp53 +/− neurons (n = 40 & 50 neurons for apical dendrites & basal dendrites from 3 mice). ****p<0.0001 by 2-tail unpaired t-test. Data are presented as mean ± SEM. See also .

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Loss of USP7 reduces synapses in cortex. (A) Flowchart to profile the proteome of the cerebral cortex of Usp7 cKO mice with tandem mass tag-mass spectrometry (TMT-MS). (B) Volcano plot of all profiled proteins in TMT-MS. Up-regulated and down-regulated proteins ( Usp7 cKO vs. WT) are labeled in red and blue, respectively. P-value were calculated by 2-tail unpaired t-test. (C) Organic layout of enriched GO gene sets based on TMT protein abundance in (B). Nodes represent gene sets (q-value < 0.01) and size of nodes represents how many genes contained in gene sets. Edges represent GO-defined relations (similarity > 0.5) and thickness of edges represents similarity between gene sets. Most enriched gene sets are related to synapse and circled in red. All gene sets shown are enriched in Usp7 WT and de-enriched in Usp7 cKO. (D) GO terms enriched from ranked list of down-regulated proteins ( Usp7 cKO vs. WT fold change < 0.75). (E) Ventricular injection of AAV PHP.eB Syn-GFP-P2A-GFPf at P0/1 to sparsely label pyramidal neurons in cerebral cortex and dendritic spine analysis at P18. (F) Representative images of dendritic spines on apical and basal dendrites. Scale bar 5µm. (G, H, I) Spine density on apical, basal and all dendrites of pyramidal neurons in motor cortex. Usp7 cKO; Trp53 +/− neurons (n = 39 & 39 neurons for apical dendrites & basal dendrites from 3 mice) showed reduced spine density than Usp7 WT; Trp53 +/− neurons (n = 40 & 50 neurons for apical dendrites & basal dendrites from 3 mice). ****p<0.0001 by 2-tail unpaired t-test. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Mass Spectrometry, Labeling, Injection

    USP7 loss does not cause significant change in dendritic morphology in primary cortical neurons with Trp53 heterzygosity. Related to . (A) Representative DIV11 images of cortical pyramidal neurons and their Imaris dendritic traces. For the Imaris dendritic traces, apical dendrties are highlighted in yellow. The cortical neurons were dissociated from Usp7 fl/fl ; Trp53 +/− E15 embryos and transduced with Cre WT or Cre dead lentivirus at DIV3. (B) Sholl profile of pyramidal neurons (n = 40 & 32 for Cre dead & WT) and all neurons (n = 55 & 44 for Cre dead & WT). Shaded area represents standard deviation. Profiles of neurons transduced with Cre dead and Cre WT are colored in red and green, respectively. (C) Sum of dendrite length in pyramidal neurons, apical dendrites vs. basal dendrites (n = 40 & 32 for Cre dead & WT). No significant Cre effect by two-way ANOVA. (D) Sum of dendrite length in pyramidal neurons, across 1-4 branch levels. Numbers of neurons are the same as in (C). No significant Cre effect by two-way ANOVA. (E) Average length of primary dendrites in pyramidal neurons. Numbers of neurons are the same as in (C). No significance by 2-tail unpaired t-test. (F) Number of primary dendrites in pyramidal neurons. Numbers of neurons are the same as in (C). No significance by 2-tail unpaired t-test. (G) Soma 3D-volumes of pyramidal neurons (n = 65 & 57 for Cre dead & WT). No significance by 2-tail unpaired t-test. Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: USP7 loss does not cause significant change in dendritic morphology in primary cortical neurons with Trp53 heterzygosity. Related to . (A) Representative DIV11 images of cortical pyramidal neurons and their Imaris dendritic traces. For the Imaris dendritic traces, apical dendrties are highlighted in yellow. The cortical neurons were dissociated from Usp7 fl/fl ; Trp53 +/− E15 embryos and transduced with Cre WT or Cre dead lentivirus at DIV3. (B) Sholl profile of pyramidal neurons (n = 40 & 32 for Cre dead & WT) and all neurons (n = 55 & 44 for Cre dead & WT). Shaded area represents standard deviation. Profiles of neurons transduced with Cre dead and Cre WT are colored in red and green, respectively. (C) Sum of dendrite length in pyramidal neurons, apical dendrites vs. basal dendrites (n = 40 & 32 for Cre dead & WT). No significant Cre effect by two-way ANOVA. (D) Sum of dendrite length in pyramidal neurons, across 1-4 branch levels. Numbers of neurons are the same as in (C). No significant Cre effect by two-way ANOVA. (E) Average length of primary dendrites in pyramidal neurons. Numbers of neurons are the same as in (C). No significance by 2-tail unpaired t-test. (F) Number of primary dendrites in pyramidal neurons. Numbers of neurons are the same as in (C). No significance by 2-tail unpaired t-test. (G) Soma 3D-volumes of pyramidal neurons (n = 65 & 57 for Cre dead & WT). No significance by 2-tail unpaired t-test. Data are presented as mean ± SEM.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Transduction, Standard Deviation

    Identification of proteins that interact with the USP7-TRAF domain and are stabilized by USP7. (A) Domain structure of mouse USP7 protein. R105, D165 and W165 on the TRAF domain are three amino acids critical for substrate binding , . USP: Ubiquitin specific protease domain. Ubl: Ubiquitin like domain. (B) Silver stain of FLAG-immunoprecipitated USP7-TRAF domain (arrow) with and without RDW mutations (R105A + D165A + W166A).1.5% of all eluted sample were stained while rest of the sample were analyzed by liquid chromatography-mass spectrometry (LC-MS). (C) Protein-protein association map of USP7-TRAF interactors (full STRING network, confidence > 0.4). Edge thickness represents confidence in association between proteins. Shown are only 50 interactors with highest gene length-normalized spectral counts. Ribonucleoprotein complex is colored in red. Spliceosomal complex is colored in green. SWI/SNF complex is colored in blue. Mitochondrial pyruvate dehydrogenase complex is colored in yellow. (D) Molecular component GO enrichments of top 50 interactors of the USP7-TRAF domain. Different molecular components are colored as in (C). (E) Flowchart to profile proteomic change with tandem mass tag-mass spectrometry (TMT-MS) in response to acute Usp7 knockout in primary cortical neurons. Neurons were dissociated from Usp7 fl/fl ; Trp53 −/− embryos at E15 and subject to Cre lentiviral transduction at DIV3. Cre harboring Y331F mutation is catalytically dead (Cre dead) and served as negative control. (F) Western blot validation of USP7 depletion and Cre expression in Cre WT-transduced neurons over time. 14-3-3 is loading control. (G) Heatmap of TMT protein abundance of USP7 and its candidate substrates. Candidate substrates were sorted out by smallest p-value of Cre main effect (two-way ANOVA) and shortest Euclidean distance to USP7. (H) Western blot quantitation of candidate substrates with the cerebral cortex of Usp7 cKO; Trp53 +/− (n = 3 mice) vs. Usp7 WT; Trp53 +/− (n = 3 mice) at P0. Western blot images are in . (I) RT-qPCR of candidate substrates with the cerebral cortex of Usp7 cKO; Trp53 +/− (n = 5 mice) vs. Usp7 WT; Trp53 +/− (n = 3 mice) at P0. No candidate substrate in the analysis showed RNA reduction with the loss of USP7. Data are presented as mean ± SEM. See also , and .

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Identification of proteins that interact with the USP7-TRAF domain and are stabilized by USP7. (A) Domain structure of mouse USP7 protein. R105, D165 and W165 on the TRAF domain are three amino acids critical for substrate binding , . USP: Ubiquitin specific protease domain. Ubl: Ubiquitin like domain. (B) Silver stain of FLAG-immunoprecipitated USP7-TRAF domain (arrow) with and without RDW mutations (R105A + D165A + W166A).1.5% of all eluted sample were stained while rest of the sample were analyzed by liquid chromatography-mass spectrometry (LC-MS). (C) Protein-protein association map of USP7-TRAF interactors (full STRING network, confidence > 0.4). Edge thickness represents confidence in association between proteins. Shown are only 50 interactors with highest gene length-normalized spectral counts. Ribonucleoprotein complex is colored in red. Spliceosomal complex is colored in green. SWI/SNF complex is colored in blue. Mitochondrial pyruvate dehydrogenase complex is colored in yellow. (D) Molecular component GO enrichments of top 50 interactors of the USP7-TRAF domain. Different molecular components are colored as in (C). (E) Flowchart to profile proteomic change with tandem mass tag-mass spectrometry (TMT-MS) in response to acute Usp7 knockout in primary cortical neurons. Neurons were dissociated from Usp7 fl/fl ; Trp53 −/− embryos at E15 and subject to Cre lentiviral transduction at DIV3. Cre harboring Y331F mutation is catalytically dead (Cre dead) and served as negative control. (F) Western blot validation of USP7 depletion and Cre expression in Cre WT-transduced neurons over time. 14-3-3 is loading control. (G) Heatmap of TMT protein abundance of USP7 and its candidate substrates. Candidate substrates were sorted out by smallest p-value of Cre main effect (two-way ANOVA) and shortest Euclidean distance to USP7. (H) Western blot quantitation of candidate substrates with the cerebral cortex of Usp7 cKO; Trp53 +/− (n = 3 mice) vs. Usp7 WT; Trp53 +/− (n = 3 mice) at P0. Western blot images are in . (I) RT-qPCR of candidate substrates with the cerebral cortex of Usp7 cKO; Trp53 +/− (n = 5 mice) vs. Usp7 WT; Trp53 +/− (n = 3 mice) at P0. No candidate substrate in the analysis showed RNA reduction with the loss of USP7. Data are presented as mean ± SEM. See also , and .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Binding Assay, Silver Staining, Immunoprecipitation, Staining, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Knock-Out, Transduction, Mutagenesis, Negative Control, Western Blot, Expressing, Quantitation Assay, Quantitative RT-PCR

    Validation of USP7 TRAF domain expression and interaction for IP-MS. Related to . (A) Immunoprecipitation of GFP-TRAF domain followed by western blot of myc3-Mdm2 and GFP. Lysates were prepared from HEK293T cells transfected with myc3-Mdm2 and GFP-tagged USP7-TRAF domain. DW double and RDW triple mutations (All mutated into Alanine) on the USP7-TRAF domain disrupted the interaction with MDM2. FT as flow-through lysates. (B) Mostly nuclear localization of truncated GFP-USP7 in rat cortical neurons at DIV9, including USP7-TRAF domain (USP7 amino acid 55-209). Neurons were co-transfected with pCAG-mCherry with Ca phosphate. USP7 fl as USP7 full length. Scale bar 50µm. (C) Immunocytochemistry of FLAG showed mostly nuclear expression of FLAG-USP7 TRAF domain in rat cortical neurons with and without RDW mutations at DIV10. Immunocytochemistry of Map2 shows neuronal morphology. Scale bar 100µm.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Validation of USP7 TRAF domain expression and interaction for IP-MS. Related to . (A) Immunoprecipitation of GFP-TRAF domain followed by western blot of myc3-Mdm2 and GFP. Lysates were prepared from HEK293T cells transfected with myc3-Mdm2 and GFP-tagged USP7-TRAF domain. DW double and RDW triple mutations (All mutated into Alanine) on the USP7-TRAF domain disrupted the interaction with MDM2. FT as flow-through lysates. (B) Mostly nuclear localization of truncated GFP-USP7 in rat cortical neurons at DIV9, including USP7-TRAF domain (USP7 amino acid 55-209). Neurons were co-transfected with pCAG-mCherry with Ca phosphate. USP7 fl as USP7 full length. Scale bar 50µm. (C) Immunocytochemistry of FLAG showed mostly nuclear expression of FLAG-USP7 TRAF domain in rat cortical neurons with and without RDW mutations at DIV10. Immunocytochemistry of Map2 shows neuronal morphology. Scale bar 100µm.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Expressing, Immunoprecipitation, Western Blot, Transfection, Immunocytochemistry

    A closer look at the in vitro TMT-MS results. Related to . (A) PCA of 16 samples based on TMT abundance of all 8304 proteins detected by TMT-MS. Principal component 1 (PC1) separates DIV6 and DIV8 samples whereas principal component 2 (PC2) separates Cre WT and Cre dead samples. (B) TMT protein abundance of candidate substrates in previous in vivo TMT-MS . Most candidate substrates showed various degrees of reduction in the cerebral cortex of Usp7 cKO mice at P17. n = 5 for both Usp7 WT; Trp53 +/− and Usp7 cKO; Trp53 +/− mice. (C) Dendrogram and heatmap of TMT protein adjacencies by weighted gene co-expression network analysis (WGCNA). WGCNA segragates 2627 differentially expressed proteins (Cre effect p<0.05 or Cre time interaction effect p<0.05 by two-way ANOVA) into 10 modules in different colors. (D) Module-trait relationships. Correlations and p-values between module eigengene (ME) and Cre (Cre WT as 1, Cre dead as 0) or time (DIV6 or DIV8) are denoted and color-coded according to the color legend. (E) Membership of candidate substrates in each module. (F) GO annotation for each module. Turquiose module is enriched in ribonucleoprotein complex and splicing-related terms. Brown module is enriched in microtubule and axon-related terms. Black module is enriched in mitochondrion-related terms. Yellow module is enriched in E3 ligase-related terms. Data are presented as mean ± SEM.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: A closer look at the in vitro TMT-MS results. Related to . (A) PCA of 16 samples based on TMT abundance of all 8304 proteins detected by TMT-MS. Principal component 1 (PC1) separates DIV6 and DIV8 samples whereas principal component 2 (PC2) separates Cre WT and Cre dead samples. (B) TMT protein abundance of candidate substrates in previous in vivo TMT-MS . Most candidate substrates showed various degrees of reduction in the cerebral cortex of Usp7 cKO mice at P17. n = 5 for both Usp7 WT; Trp53 +/− and Usp7 cKO; Trp53 +/− mice. (C) Dendrogram and heatmap of TMT protein adjacencies by weighted gene co-expression network analysis (WGCNA). WGCNA segragates 2627 differentially expressed proteins (Cre effect p<0.05 or Cre time interaction effect p<0.05 by two-way ANOVA) into 10 modules in different colors. (D) Module-trait relationships. Correlations and p-values between module eigengene (ME) and Cre (Cre WT as 1, Cre dead as 0) or time (DIV6 or DIV8) are denoted and color-coded according to the color legend. (E) Membership of candidate substrates in each module. (F) GO annotation for each module. Turquiose module is enriched in ribonucleoprotein complex and splicing-related terms. Brown module is enriched in microtubule and axon-related terms. Black module is enriched in mitochondrion-related terms. Yellow module is enriched in E3 ligase-related terms. Data are presented as mean ± SEM.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: In Vitro, In Vivo, Expressing

    Western blot with P0 Usp7 cKO; Trp53 +/− cortex. Related to . Three biological replicates of each genotype were denoted in numbers. (A) Phip, USP7 and Xiap. (B) Ppil4, Ring1 and Gpd1. (C) Ubxn7, Ruvbl2 and Rnf2. (D) Chfr and Sub1. (E) Fto, Gfap and Cre. (F) Rnf220, Cfdp1 and Phc. (G) Fam172a. (H) Trip12. (I) Smarcal1. 14-3-3 and Lamin A/C are loading controls.

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: Western blot with P0 Usp7 cKO; Trp53 +/− cortex. Related to . Three biological replicates of each genotype were denoted in numbers. (A) Phip, USP7 and Xiap. (B) Ppil4, Ring1 and Gpd1. (C) Ubxn7, Ruvbl2 and Rnf2. (D) Chfr and Sub1. (E) Fto, Gfap and Cre. (F) Rnf220, Cfdp1 and Phc. (G) Fam172a. (H) Trip12. (I) Smarcal1. 14-3-3 and Lamin A/C are loading controls.

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Western Blot

    USP7 targets and de-ubiquitinates Ppil4 to promote synaptogenesis. (A) Streptavidin pull-down of HEK293T lysate with overexpression of Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 followed by western blot of multiple endogenous candidate substrates. 2% input lysate is shown on the left. (B, C, D) Density of dendritic spine on apical, basal and all dendrites of pyramidal-shaped neurons in (H). Two independent lentiviral shRNA knocking down Ppil4 reduced spine density compared with control shRNA targeting Luciferase (Luci). Number of neurons (apical dendrties) = 24, 27, 23, 20, 23, 18, 16 & 17 for Luci, Ppil4i.1, Ppil4i.2, Smarcal1i.1, Smarcal1i.2, Trip12i, Ring1i & Sub1i. Number of neurons (basal dendrties) = 22, 24, 26, 20, 24, 17, 15 & 16 for Luci, Ppil4i.1, Ppil4i.2, Smarcal1i.1, Smarcal1i.2, Trip12i, Ring1i & Sub1i. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by Dunnett’s multiple comparison test (compared to Luci). (E, F, G) Density of PSD95+ dendritic spine on apical, basal and all dendrites of cortical neurons in (H) and . Two independent lentiviral shRNA knocking down Ppil4 reduced PSD95+ spine density compared with control shRNA targeting Luciferase (Luci). Number of neurons are the same as in (B, C, D). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by Dunnett’s multiple comparison test (compared to Luci). (H) Representative images show the effect of Ppil4 knockdown on dendritic spines of cortical neurons at DIV18. PSD95 puncta decorating the dendritic spines were immunostained along with GFP. Arrows show dendritic spines. Scale bar 5µm. (I) Immunoprecipitation of endogenous Ppil4 in HEK293T lysates followed by western blot of GFP-USP7 and Ppil4. 2% Input lysate is shown on the left. GFP-USP7 was co-immunoprecipiated with Ppil4. (J) Tandem Ubiquitin Binding Entities (TUBE) pull-down of neuronal lysate with USP7 loss driven by lentiviral Cre, followed by immunoblotting of Ppil4. Input lysates are shown at the bottom. Endogenous Poly-Ubiquitinated Ppil4 increased with USP7 loss (Cre WT). A.U. = aribitary unit. (K) In vitro deubiquitination assay using FLAG-immunoprecipitated Ppil4 from HEK293T cells. Incubation with recombinant His-USP7 at 37°C for 1 hour converted high-molecular weight ubiquitinated Ppil4 (dashed rectangle) into low-molecular weight Ppil4 (arrow). (L) Densitometric quantification of high-molecular weight Ppil4 over all Ppil4 signal in (K) over 3 biological replicates. **p<0.01 by 2-tail unpaired t-test. (M) Western blot of USP7 with mutations from the Hao-Fountain syndrome patients in HEK293T cells. USP7 C223A is catalytically dead. (N) Western blot of endogenous Ppil4 in HEK293T cells expressing different USP7 variants. (O) Densitometric quantification of Ppil4 signal as in (N) over 4 biological replicates. Repeated measurement one way ANOVA. *p<0.05 by Dunnett’s multiple comparison. (P) Schematic of USP7-Ppil4 signaling pathway regulating dendritic spine density in glutamatergic cortical neuron. Data are presented as mean ± SEM. See also .

    Journal: bioRxiv

    Article Title: The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway

    doi: 10.1101/2023.10.24.563880

    Figure Lengend Snippet: USP7 targets and de-ubiquitinates Ppil4 to promote synaptogenesis. (A) Streptavidin pull-down of HEK293T lysate with overexpression of Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 followed by western blot of multiple endogenous candidate substrates. 2% input lysate is shown on the left. (B, C, D) Density of dendritic spine on apical, basal and all dendrites of pyramidal-shaped neurons in (H). Two independent lentiviral shRNA knocking down Ppil4 reduced spine density compared with control shRNA targeting Luciferase (Luci). Number of neurons (apical dendrties) = 24, 27, 23, 20, 23, 18, 16 & 17 for Luci, Ppil4i.1, Ppil4i.2, Smarcal1i.1, Smarcal1i.2, Trip12i, Ring1i & Sub1i. Number of neurons (basal dendrties) = 22, 24, 26, 20, 24, 17, 15 & 16 for Luci, Ppil4i.1, Ppil4i.2, Smarcal1i.1, Smarcal1i.2, Trip12i, Ring1i & Sub1i. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by Dunnett’s multiple comparison test (compared to Luci). (E, F, G) Density of PSD95+ dendritic spine on apical, basal and all dendrites of cortical neurons in (H) and . Two independent lentiviral shRNA knocking down Ppil4 reduced PSD95+ spine density compared with control shRNA targeting Luciferase (Luci). Number of neurons are the same as in (B, C, D). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 by Dunnett’s multiple comparison test (compared to Luci). (H) Representative images show the effect of Ppil4 knockdown on dendritic spines of cortical neurons at DIV18. PSD95 puncta decorating the dendritic spines were immunostained along with GFP. Arrows show dendritic spines. Scale bar 5µm. (I) Immunoprecipitation of endogenous Ppil4 in HEK293T lysates followed by western blot of GFP-USP7 and Ppil4. 2% Input lysate is shown on the left. GFP-USP7 was co-immunoprecipiated with Ppil4. (J) Tandem Ubiquitin Binding Entities (TUBE) pull-down of neuronal lysate with USP7 loss driven by lentiviral Cre, followed by immunoblotting of Ppil4. Input lysates are shown at the bottom. Endogenous Poly-Ubiquitinated Ppil4 increased with USP7 loss (Cre WT). A.U. = aribitary unit. (K) In vitro deubiquitination assay using FLAG-immunoprecipitated Ppil4 from HEK293T cells. Incubation with recombinant His-USP7 at 37°C for 1 hour converted high-molecular weight ubiquitinated Ppil4 (dashed rectangle) into low-molecular weight Ppil4 (arrow). (L) Densitometric quantification of high-molecular weight Ppil4 over all Ppil4 signal in (K) over 3 biological replicates. **p<0.01 by 2-tail unpaired t-test. (M) Western blot of USP7 with mutations from the Hao-Fountain syndrome patients in HEK293T cells. USP7 C223A is catalytically dead. (N) Western blot of endogenous Ppil4 in HEK293T cells expressing different USP7 variants. (O) Densitometric quantification of Ppil4 signal as in (N) over 4 biological replicates. Repeated measurement one way ANOVA. *p<0.05 by Dunnett’s multiple comparison. (P) Schematic of USP7-Ppil4 signaling pathway regulating dendritic spine density in glutamatergic cortical neuron. Data are presented as mean ± SEM. See also .

    Article Snippet: For assessment of the interaction between USP7 and endogenously expressed proteins, a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection.

    Techniques: Over Expression, Binding Assay, Western Blot, shRNA, Luciferase, Comparison, Immunoprecipitation, In Vitro, Incubation, Recombinant, Molecular Weight, Expressing

    Viral infection promotes protein expression of USP7 that up‐regulates SOCS1 protein levels at the late stage of viral infection. (a) Western blot analysis of protein levels of SOCS1 and JOSD1 in A549 cells infected with H1N1 [multiplicity of infection (MOI) = 1·0] for the indicated times. (b) Western blot analysis of exogenously expressed Myc‐SOCS1 levels in HEK293T cells transfected with Myc‐SOCS1 and then infected with vesicular stomatitis virus (VSV) (MOI = 1·0). (c) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells transfected with Myc‐SOCS1 and then infected with VSV (MOI = 1·0). (d) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1 and different DUBs, followed by treatment with or without cycloheximide (50 μm) for 12 hr. (e) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1, control shRNAs (shCON) or shRNAs against human USP7 (shUSP7) as indicated and then infected with H1N1 (MOI = 1·0). (f) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells transfected with Myc‐SOCS1 and then treated with dimethylsulfoxide or P5091 (100 nm) for 12 hr, followed by infection with VSV (MOI = 1·0). (g) Western blot analysis of USP7 protein levels in A549 cells infected with H1N1 (MOI = 1·0) for the indicated times. (h,i) Western blot analysis of USP7 protein levels in HEK293T cells infected with Sendai virus (SeV) (MOI = 1·0) (h) or VSV (MOI = 1·0) (i). The densities of protein bands were quantified with imageJ. (j) Quantitative PCR analysis of USP7 mRNA levels in HEK293T cells infected with VSV (MOI = 1·0), SeV (MOI = 1·0) or H1N1 (MOI = 1·0) for 24 hr. (k) Quantitative PCR analysis of USP7 mRNA levels in HEK293T cells pretreated with pyrrolidine dithiocarbamate ammonium (PDTC) (nuclear factor‐κB inhibitor, 10 μm) for 1 hr and then infected with VSV (MOI = 1·0) for 24 hr. The data were shown as fold change normalized to that in uninfected control cells. (l) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1, together with control shRNAs (–) or three shUSP7 as indicated. (m) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1 and increasing amounts of Flag‐USP7. (n) Western blot analysis of SOCS1 protein levels in A549 cells co‐transfected with Flag‐USP7 (WT or inactive C223S mutant) as indicated

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: Viral infection promotes protein expression of USP7 that up‐regulates SOCS1 protein levels at the late stage of viral infection. (a) Western blot analysis of protein levels of SOCS1 and JOSD1 in A549 cells infected with H1N1 [multiplicity of infection (MOI) = 1·0] for the indicated times. (b) Western blot analysis of exogenously expressed Myc‐SOCS1 levels in HEK293T cells transfected with Myc‐SOCS1 and then infected with vesicular stomatitis virus (VSV) (MOI = 1·0). (c) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells transfected with Myc‐SOCS1 and then infected with VSV (MOI = 1·0). (d) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1 and different DUBs, followed by treatment with or without cycloheximide (50 μm) for 12 hr. (e) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1, control shRNAs (shCON) or shRNAs against human USP7 (shUSP7) as indicated and then infected with H1N1 (MOI = 1·0). (f) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells transfected with Myc‐SOCS1 and then treated with dimethylsulfoxide or P5091 (100 nm) for 12 hr, followed by infection with VSV (MOI = 1·0). (g) Western blot analysis of USP7 protein levels in A549 cells infected with H1N1 (MOI = 1·0) for the indicated times. (h,i) Western blot analysis of USP7 protein levels in HEK293T cells infected with Sendai virus (SeV) (MOI = 1·0) (h) or VSV (MOI = 1·0) (i). The densities of protein bands were quantified with imageJ. (j) Quantitative PCR analysis of USP7 mRNA levels in HEK293T cells infected with VSV (MOI = 1·0), SeV (MOI = 1·0) or H1N1 (MOI = 1·0) for 24 hr. (k) Quantitative PCR analysis of USP7 mRNA levels in HEK293T cells pretreated with pyrrolidine dithiocarbamate ammonium (PDTC) (nuclear factor‐κB inhibitor, 10 μm) for 1 hr and then infected with VSV (MOI = 1·0) for 24 hr. The data were shown as fold change normalized to that in uninfected control cells. (l) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1, together with control shRNAs (–) or three shUSP7 as indicated. (m) Western blot analysis of Myc‐SOCS1 protein levels in A549 cells co‐transfected with Myc‐SOCS1 and increasing amounts of Flag‐USP7. (n) Western blot analysis of SOCS1 protein levels in A549 cells co‐transfected with Flag‐USP7 (WT or inactive C223S mutant) as indicated

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Infection, Expressing, Western Blot, Transfection, Virus, Immunoprecipitation, Control, Real-time Polymerase Chain Reaction, Mutagenesis

    USP7 interacts with and stabilizes SOCS1 protein. (a,b) Immunoprecipitation analysis of the interaction between Flag‐USP7 and Myc‐SOCS1 in A549 cells co‐transfected with Myc‐SOCS1 and Flag‐USP7 using anti‐Myc (a) or anti‐Flag (b) antibodies for immunoprecipitation. (c) Immunoprecipitation analysis of the interaction between endogenous USP7 and SOCS1 in A549 cells using either the isotype IgG (−) or anti‐USP7 antibodies (USP7) for immunoprecipitation. (d) Immunoprecipitation analysis of the interaction between endogenous USP7 and SOCS1 in A549 cells using either the isotype IgG (−) or anti‐SOCS1 antibodies (SOCS1) for immunoprecipitation. (e) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1, together with shCON or shUSP7, followed by treatment with cycloheximide (50 μm) as indicated. (f) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1, together with shCON (−) or shUSP7, followed by treatment with dimethylsulfoxide or MG132 (10 μm) for 12 hr

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: USP7 interacts with and stabilizes SOCS1 protein. (a,b) Immunoprecipitation analysis of the interaction between Flag‐USP7 and Myc‐SOCS1 in A549 cells co‐transfected with Myc‐SOCS1 and Flag‐USP7 using anti‐Myc (a) or anti‐Flag (b) antibodies for immunoprecipitation. (c) Immunoprecipitation analysis of the interaction between endogenous USP7 and SOCS1 in A549 cells using either the isotype IgG (−) or anti‐USP7 antibodies (USP7) for immunoprecipitation. (d) Immunoprecipitation analysis of the interaction between endogenous USP7 and SOCS1 in A549 cells using either the isotype IgG (−) or anti‐SOCS1 antibodies (SOCS1) for immunoprecipitation. (e) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1, together with shCON or shUSP7, followed by treatment with cycloheximide (50 μm) as indicated. (f) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1, together with shCON (−) or shUSP7, followed by treatment with dimethylsulfoxide or MG132 (10 μm) for 12 hr

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Immunoprecipitation, Transfection, Western Blot

    USP7 removes polyubiquitination of SOCS1 dependently on its deubiquitinase activity. (a) Immunoprecipitation analysis of polyubiquitination of Myc‐SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1, HA‐ub and Flag‐USP7 as indicated. (b) Immunoprecipitation analysis of polyubiquitination of Myc‐SOCS1 in A549 cells co‐transfected with Myc‐SOCS1 and increasing amounts of Flag‐USP7. (c) Immunoprecipitation analysis of polyubiquitination of endogenous SOCS1 in HEK293T cells transfected with empty vectors (−) or Flag‐USP7. (d) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1, HA‐ub and shUSP7 as indicated. (e) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1 and Flag‐USP7 (WT or inactive C223S mutant) as indicated

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: USP7 removes polyubiquitination of SOCS1 dependently on its deubiquitinase activity. (a) Immunoprecipitation analysis of polyubiquitination of Myc‐SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1, HA‐ub and Flag‐USP7 as indicated. (b) Immunoprecipitation analysis of polyubiquitination of Myc‐SOCS1 in A549 cells co‐transfected with Myc‐SOCS1 and increasing amounts of Flag‐USP7. (c) Immunoprecipitation analysis of polyubiquitination of endogenous SOCS1 in HEK293T cells transfected with empty vectors (−) or Flag‐USP7. (d) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1, HA‐ub and shUSP7 as indicated. (e) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1 and Flag‐USP7 (WT or inactive C223S mutant) as indicated

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Activity Assay, Immunoprecipitation, Transfection, Mutagenesis

    USP7 regulates interferon type I (IFN‐I) ‐induced Janus kinase–signal transducer and activator of transcription (JAK–STAT1) activation through SOCS1. (a) Western blot analysis of STAT1 phosphorylation on tyrosine 701 (p‐STAT1) in HEK293T cells transfected with control shRNA (−) or three shUSP7 and then treated with IFN‐α (1000 IU/ml) for 30 min. (b) Western blot analysis of p‐STAT1 in HEK293T cells transfected with shCON or shUSP7 and then treated with IFN‐α (1000 IU/ml) as indicated. (c) Western blot analysis of p‐STAT1 in HEK293T cells transfected with empty vectors (CON) or Flag‐USP7 and then treated with IFN‐α (1000 IU/ml) as indicated. (d) Western blot analysis of p‐STAT1 in HEK293T cells transfected with Flag‐USP7 and then treated with IFN‐α (0, 1000, 3000 IU/ml) for 30 min. (e) Western blot analysis of p‐STAT1 in HEK293T cells transfected with empty vectors (−) or Flag‐USP7 (WT or inactive C223S mutant) and then treated with IFN‐α (1000 IU/ml) as indicated. (f) Western blot analysis of phosphorylated Tyk2 on tyrosine 1054/1055 (p‐Tyk2) and phosphorylated JAK1 on serine 1022/1023 (p‐JAK1) in HEK293T cells transfected with Flag‐USP7 and then treated with IFN‐α (1000 IU/ml) as indicated. (g) Western blot analysis of endogenous SOCS1 protein levels in stable SOCS1‐knockdown HeLa cells (shSOCS1: 1# and 2#) or stable control‐shRNA HeLa cells (shCON). (h) Western blot analysis of p‐STAT1 levels in stable SOCS1‐knockdown HeLa cells transfected with Flag‐USP7 and then treated with IFN‐α (1000 IU/ml) for 30 min

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: USP7 regulates interferon type I (IFN‐I) ‐induced Janus kinase–signal transducer and activator of transcription (JAK–STAT1) activation through SOCS1. (a) Western blot analysis of STAT1 phosphorylation on tyrosine 701 (p‐STAT1) in HEK293T cells transfected with control shRNA (−) or three shUSP7 and then treated with IFN‐α (1000 IU/ml) for 30 min. (b) Western blot analysis of p‐STAT1 in HEK293T cells transfected with shCON or shUSP7 and then treated with IFN‐α (1000 IU/ml) as indicated. (c) Western blot analysis of p‐STAT1 in HEK293T cells transfected with empty vectors (CON) or Flag‐USP7 and then treated with IFN‐α (1000 IU/ml) as indicated. (d) Western blot analysis of p‐STAT1 in HEK293T cells transfected with Flag‐USP7 and then treated with IFN‐α (0, 1000, 3000 IU/ml) for 30 min. (e) Western blot analysis of p‐STAT1 in HEK293T cells transfected with empty vectors (−) or Flag‐USP7 (WT or inactive C223S mutant) and then treated with IFN‐α (1000 IU/ml) as indicated. (f) Western blot analysis of phosphorylated Tyk2 on tyrosine 1054/1055 (p‐Tyk2) and phosphorylated JAK1 on serine 1022/1023 (p‐JAK1) in HEK293T cells transfected with Flag‐USP7 and then treated with IFN‐α (1000 IU/ml) as indicated. (g) Western blot analysis of endogenous SOCS1 protein levels in stable SOCS1‐knockdown HeLa cells (shSOCS1: 1# and 2#) or stable control‐shRNA HeLa cells (shCON). (h) Western blot analysis of p‐STAT1 levels in stable SOCS1‐knockdown HeLa cells transfected with Flag‐USP7 and then treated with IFN‐α (1000 IU/ml) for 30 min

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Activation Assay, Western Blot, Phospho-proteomics, Transfection, Control, shRNA, Mutagenesis, Knockdown

    USP7 regulates the strength of interferon type I (IFN‐I) signaling. (a) The ISRE‐luciferase activity was measured in HEK293T cells transfected with control shRNA (−) or three shUSP7, together with ISRE‐luciferase and Renilla, and then treated with IFN‐α (500 IU/ml) for 18 hr. (b) The ISRE‐luciferase activity was measured in HEK293T cells transfected with Flag‐USP7, together with ISRE‐luciferase and Renilla, and then treated with IFN‐α (500 IU/ml) for 18 hr. (c) The ISRE‐luciferase activity was measured in HEK293T cells transfected with Flag‐USP7 (WT or inactive C223S mutant), together with ISRE‐luciferase and Renilla, and then treated with IFN‐α (200, 500 IU/ml) for 18 hr. (d) Quantitative‐PCR analysis of IFIT1, ISG15 and ISG54 mRNA levels in HEK293T cells transfected with shCON or shUSP7 and then treated with IFN‐α (1000 IU/ml) for 8 hr. (e) Quantitative‐PCR analysis of IFIT1, ISG15 and ISG54 mRNA levels in HEK293T cells transfected with Flag‐USP7 (WT or inactive C223S mutant) and then treated with IFN‐α (1000 IU/ml) for 8 hr. NS, not significant, *P < 0·05, ***P < 0·001 (two‐tailed unpaired Student's t‐test). All data are shown as mean ± SD of three independent replicates

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: USP7 regulates the strength of interferon type I (IFN‐I) signaling. (a) The ISRE‐luciferase activity was measured in HEK293T cells transfected with control shRNA (−) or three shUSP7, together with ISRE‐luciferase and Renilla, and then treated with IFN‐α (500 IU/ml) for 18 hr. (b) The ISRE‐luciferase activity was measured in HEK293T cells transfected with Flag‐USP7, together with ISRE‐luciferase and Renilla, and then treated with IFN‐α (500 IU/ml) for 18 hr. (c) The ISRE‐luciferase activity was measured in HEK293T cells transfected with Flag‐USP7 (WT or inactive C223S mutant), together with ISRE‐luciferase and Renilla, and then treated with IFN‐α (200, 500 IU/ml) for 18 hr. (d) Quantitative‐PCR analysis of IFIT1, ISG15 and ISG54 mRNA levels in HEK293T cells transfected with shCON or shUSP7 and then treated with IFN‐α (1000 IU/ml) for 8 hr. (e) Quantitative‐PCR analysis of IFIT1, ISG15 and ISG54 mRNA levels in HEK293T cells transfected with Flag‐USP7 (WT or inactive C223S mutant) and then treated with IFN‐α (1000 IU/ml) for 8 hr. NS, not significant, *P < 0·05, ***P < 0·001 (two‐tailed unpaired Student's t‐test). All data are shown as mean ± SD of three independent replicates

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Luciferase, Activity Assay, Transfection, Control, shRNA, Mutagenesis, Real-time Polymerase Chain Reaction, Two Tailed Test

    USP7 regulates interferon type I (IFN‐I) ‐mediated antiviral activity. (a) Fluorescence microscopy of vesicular stomatitis virus (VSV) with a green fluorescent protein gene (GFP) in HEK293T cells transfected with shCON or shUSP7 and then pretreated with or with IFN‐α (50 IU/ml) for 20 hr, followed by infection with VSV‐GFP [multiplicity of infection (MOI) = 0·5] for 20 hr. Scale bars, 100 µm. (b) Quantitative PCR analysis of mRNA levels of a representative ISG (ISG15) in HEK293T cells transfected with shCON or shUSP7 and then infected with VSV (MOI = 1·0) for 20 hr. (c) Quantitative PCR analysis of VSV viral RNA in HEK293T cells transfected with empty vectors (CON) or Flag‐USP7 and then pretreated with or without IFN‐α (50 IU/ml) for 20 hr, followed by infection with VSV (MOI = 1·0) for 20 hr. (d) Western blot analysis of H1N1‐encoded HA protein levels in HEK293T cells transfected with increasing amounts of Flag‐USP7 and then infected with H1N1 (MOI = 1·0) for 20 hr. (e) Fluorescence microscopy of VSV‐GFP viruses in HEK293T cells transfected with Flag‐USP7 (WT or inactive C223S mutant) and then infected with VSV‐GFP (MOI = 0·5) for 20 hr. Scale bars, 100 µm. ***P < 0·001 (two‐tailed unpaired Student's t‐test). Data are shown as mean ± SD of three independent replicates (b,c)

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: USP7 regulates interferon type I (IFN‐I) ‐mediated antiviral activity. (a) Fluorescence microscopy of vesicular stomatitis virus (VSV) with a green fluorescent protein gene (GFP) in HEK293T cells transfected with shCON or shUSP7 and then pretreated with or with IFN‐α (50 IU/ml) for 20 hr, followed by infection with VSV‐GFP [multiplicity of infection (MOI) = 0·5] for 20 hr. Scale bars, 100 µm. (b) Quantitative PCR analysis of mRNA levels of a representative ISG (ISG15) in HEK293T cells transfected with shCON or shUSP7 and then infected with VSV (MOI = 1·0) for 20 hr. (c) Quantitative PCR analysis of VSV viral RNA in HEK293T cells transfected with empty vectors (CON) or Flag‐USP7 and then pretreated with or without IFN‐α (50 IU/ml) for 20 hr, followed by infection with VSV (MOI = 1·0) for 20 hr. (d) Western blot analysis of H1N1‐encoded HA protein levels in HEK293T cells transfected with increasing amounts of Flag‐USP7 and then infected with H1N1 (MOI = 1·0) for 20 hr. (e) Fluorescence microscopy of VSV‐GFP viruses in HEK293T cells transfected with Flag‐USP7 (WT or inactive C223S mutant) and then infected with VSV‐GFP (MOI = 0·5) for 20 hr. Scale bars, 100 µm. ***P < 0·001 (two‐tailed unpaired Student's t‐test). Data are shown as mean ± SD of three independent replicates (b,c)

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Activity Assay, Fluorescence, Microscopy, Virus, Transfection, Infection, Real-time Polymerase Chain Reaction, Western Blot, Mutagenesis, Two Tailed Test

    USP7 Small‐molecule inhibitors enhance interferon type I (IFN‐I) signaling and antiviral efficacy. (a) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1 and HA‐ub and then treated with either P5091 (100 nm) or P22077 (100 nm) for 12 hr. (b) Western blot analysis of endogenous SOCS1 protein levels in A549 cells treated with P5091 (100 nm) or P22077 (100 nm) for 12 hr. (c) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1 and then pretreated with MG132 (10 μm) for 12 hr, followed by treatment with P22077 (100 nm) for 12 hr. (d) Western blot analysis of p‐STAT1 in HEK293T cells pretreated with P22077 or P5091 (100 nm) for 12 hr and then treated with IFN‐α (1000 IU/ml) as indicated. (e) The ISRE‐luciferase activity was measured in HEK293T cells co‐transfected with ISRE‐luciferase and Renilla and then treated with P5091 (100 nm) or P22077 (100 nm) for 12 hr, followed by treatment with IFN‐α (500 IU/ml) for 18 hr. (f) Quantitative PCR analysis of mRNA levels of IFIT1, ISG15 and ISG54 in HEK293T cells pretreated with dimethylsulfoxide or P22077 (100 nm) for 12 hr, and then treated with or without IFN‐α (1000 IU/ml) for 6 hr. (g) Cell viability was measured in HEK293T cells treated with either P5091 or P22077 using different concentrations as indicated. (h) Quantitative PCR analysis of vesicular stomatitis virus (VSV) viral RNA in HEK293T cells pretreated with P5091 or P22077 (20 and 100 nm) for 12 hr and then challenged with VSV [multiplicity of infection (MOI) = 1·0] for 24 hr. (i) Fluorescence microscopy of VSV‐GFP viruses in HEK293T cells pretreated with DMSO, P5091 and P22077 (100 nm) for 12 hr and then treatment with or without IFN‐α (50 IU/ml) for 20 hr, followed by infection with VSV‐GFP (MOI = 0·5) for 24 hr. Scale bars, 100 µm. *P < 0·05, **P < 0·01 and ***P < 0·001 (two‐tailed unpaired Student's t‐test). Data are shown as mean ± SD. of three independent replicates (e,f,h)

    Journal: Immunology

    Article Title: Small‐molecule inhibitors of ubiquitin‐specific protease 7 enhance type‐I interferon antiviral efficacy by destabilizing SOCS1

    doi: 10.1111/imm.13147

    Figure Lengend Snippet: USP7 Small‐molecule inhibitors enhance interferon type I (IFN‐I) signaling and antiviral efficacy. (a) Immunoprecipitation analysis of polyubiquitination of SOCS1 in HEK293T cells co‐transfected with Myc‐SOCS1 and HA‐ub and then treated with either P5091 (100 nm) or P22077 (100 nm) for 12 hr. (b) Western blot analysis of endogenous SOCS1 protein levels in A549 cells treated with P5091 (100 nm) or P22077 (100 nm) for 12 hr. (c) Western blot analysis of Myc‐SOCS1 protein levels in HEK293T cells transfected with Myc‐SOCS1 and then pretreated with MG132 (10 μm) for 12 hr, followed by treatment with P22077 (100 nm) for 12 hr. (d) Western blot analysis of p‐STAT1 in HEK293T cells pretreated with P22077 or P5091 (100 nm) for 12 hr and then treated with IFN‐α (1000 IU/ml) as indicated. (e) The ISRE‐luciferase activity was measured in HEK293T cells co‐transfected with ISRE‐luciferase and Renilla and then treated with P5091 (100 nm) or P22077 (100 nm) for 12 hr, followed by treatment with IFN‐α (500 IU/ml) for 18 hr. (f) Quantitative PCR analysis of mRNA levels of IFIT1, ISG15 and ISG54 in HEK293T cells pretreated with dimethylsulfoxide or P22077 (100 nm) for 12 hr, and then treated with or without IFN‐α (1000 IU/ml) for 6 hr. (g) Cell viability was measured in HEK293T cells treated with either P5091 or P22077 using different concentrations as indicated. (h) Quantitative PCR analysis of vesicular stomatitis virus (VSV) viral RNA in HEK293T cells pretreated with P5091 or P22077 (20 and 100 nm) for 12 hr and then challenged with VSV [multiplicity of infection (MOI) = 1·0] for 24 hr. (i) Fluorescence microscopy of VSV‐GFP viruses in HEK293T cells pretreated with DMSO, P5091 and P22077 (100 nm) for 12 hr and then treatment with or without IFN‐α (50 IU/ml) for 20 hr, followed by infection with VSV‐GFP (MOI = 0·5) for 24 hr. Scale bars, 100 µm. *P < 0·05, **P < 0·01 and ***P < 0·001 (two‐tailed unpaired Student's t‐test). Data are shown as mean ± SD. of three independent replicates (e,f,h)

    Article Snippet: Reagents and expression constructs USP7 inhibitors (P5091 and {"type":"entrez-protein","attrs":{"text":"P22077","term_id":"134707"}} P22077 ), Trypan Blue and PDTC ammonium (PDTC) were purchased from Selleck Chemicals (Houston, TX).

    Techniques: Immunoprecipitation, Transfection, Western Blot, Luciferase, Activity Assay, Real-time Polymerase Chain Reaction, Virus, Infection, Fluorescence, Microscopy, Two Tailed Test

    USP7 activation by the C-terminal tail happens in cis . a Schematic domain representation of USP7 and constructs used in this study. Active site residues and domain names are indicated: TRAF TRAF domain, CD Catalytic domain, 1–5 Ubl domains 1 through 5, tail. The activating C-terminal peptide (res. 1083–1102), marked in purple. The graphical representation of the constructs is used in other figures. b Analysis of USP7 constructs on SEC-MALLS shows monomer/dimer equilibrium. CD45 (100 µL of 45 µM) or FL (80 µL of 20 µM) were loaded on a Superdex 200 gel filtration column. Absorbance at 280 nm (dark red: CD45; dark blue: FL) was monitored and eluted peaks were analysed for molecular weight (red: CD45; blue: FL) by in-line MALLS. For CD45 the molecular weights of the monomer (69 kDa) and dimer (138 kDa) are indicated with the dotted line. c Activation of USP7CD by Ubl45 requires the very C-terminal tail. CD (20 nM) was mixed with Ubl45 variants as indicated and tested for DUB activity using UbRho. d USP7CD (20 nM) was incubated with a titration range of Ubl45, and tested in a deubiquitination assay as in 1c. These initial velocities were plotted against the concentration to yield an apparent K D . Each data point is the mean ± SD of n = 2 measurements. e CD12345 ΔC (20 nM) has similar activity to CD and can be activated by the tail: when titrating in CD12345 C223A , which has no activity, the tail will activate the tailless construct upon dimerization. The activity readout shows that this dimerization-dependent activation of USP7 happens at micromolar concentrations in line with affinity of 1d. Binding of ubiquitin substrate to CD12345 C223A causes an inhibitory effect above 2 µM, therefore only lower concentrations were used to extrapolate a K D,app (blue dashes). The red dotted lines indicate the activity of WT CD12345 for comparison

    Journal: Nature Communications

    Article Title: Kinetic analysis of multistep USP7 mechanism shows critical role for target protein in activity

    doi: 10.1038/s41467-018-08231-5

    Figure Lengend Snippet: USP7 activation by the C-terminal tail happens in cis . a Schematic domain representation of USP7 and constructs used in this study. Active site residues and domain names are indicated: TRAF TRAF domain, CD Catalytic domain, 1–5 Ubl domains 1 through 5, tail. The activating C-terminal peptide (res. 1083–1102), marked in purple. The graphical representation of the constructs is used in other figures. b Analysis of USP7 constructs on SEC-MALLS shows monomer/dimer equilibrium. CD45 (100 µL of 45 µM) or FL (80 µL of 20 µM) were loaded on a Superdex 200 gel filtration column. Absorbance at 280 nm (dark red: CD45; dark blue: FL) was monitored and eluted peaks were analysed for molecular weight (red: CD45; blue: FL) by in-line MALLS. For CD45 the molecular weights of the monomer (69 kDa) and dimer (138 kDa) are indicated with the dotted line. c Activation of USP7CD by Ubl45 requires the very C-terminal tail. CD (20 nM) was mixed with Ubl45 variants as indicated and tested for DUB activity using UbRho. d USP7CD (20 nM) was incubated with a titration range of Ubl45, and tested in a deubiquitination assay as in 1c. These initial velocities were plotted against the concentration to yield an apparent K D . Each data point is the mean ± SD of n = 2 measurements. e CD12345 ΔC (20 nM) has similar activity to CD and can be activated by the tail: when titrating in CD12345 C223A , which has no activity, the tail will activate the tailless construct upon dimerization. The activity readout shows that this dimerization-dependent activation of USP7 happens at micromolar concentrations in line with affinity of 1d. Binding of ubiquitin substrate to CD12345 C223A causes an inhibitory effect above 2 µM, therefore only lower concentrations were used to extrapolate a K D,app (blue dashes). The red dotted lines indicate the activity of WT CD12345 for comparison

    Article Snippet: USP7 constructs (Fig. ) were based on the codon-optimized sequence (Addgene, #63573) .

    Techniques: Activation Assay, Construct, Filtration, Molecular Weight, Activity Assay, Incubation, Titration, Concentration Assay, Binding Assay, Ubiquitin Proteomics, Comparison

    Affinity of CD for Ubl45 increases with Ub present and is dependent on C-terminal tail. a SPR binding results indicate a weak affinity of USP7CD for either Ubl45 or Ubl45 ΔC . CD was immobilized through GST on the chip and tested for binding with Ubl45 or Ubl45 ΔC . Equilibrium binding values were plotted against concentration and fitted to get an estimated K D . Responses were normalised using B max and standard deviation for resulting values is given. b The increased binding between Ubl45 and CDUb depends on the C-terminal tail. Ubl45 or Ubl45 ΔC was immobilized on the chip and the covalent CDUb complex was flown over. A fit was made using the equilibrium binding values yielding a K D of 590 nM for Ubl45, whereas no binding could be observed for Ubl45 ΔC . Normalisation was carried out using B max . c Comparison of the affinity of Ubl45 for CD or CDUb shows a remarkable increase. Curves from A and B are replotted to exemplify the change in K D . d The C-terminal tail was immobilized using biotin and CD or CDUb was flown over to confirm that the tail interacts with the transition state (CDUb) only and not the apo CD. e Overview of affinities between Ubl45 and CD show that Ub enhances the binding of the tail. The values for the upper two rows are determined using SPR, see a – d . The values in the last row have been derived from activity assays, see Fig. and for the estimated affinity of the C-terminal tail (*). N.A. not applicable; N.D. No binding detected. f The presence of the Ubl45 domain is essential for increased affinity of CD for ubiquitin, but not the C-terminal tail. The affinity for ubiquitin was measured in an FP assay where TAMRA-labelled ubiquitin was incubated with various USP7 constructs. g Steady-state kinetics analysis of USP7 constructs indicates that the C-terminal tail mainly affects the catalytic rate, while the presence of Ubl45 without the tail enhances the affinity for the ubiquitin substrate. The Michaelis-Menten constant ( K M ) and k cat were obtained by fitting the initial velocity data for various concentrations of UbRho. For a – e , obtained values are displayed ± SD after fitting. For f – g data points are the mean ± SD of n = 2 measurements

    Journal: Nature Communications

    Article Title: Kinetic analysis of multistep USP7 mechanism shows critical role for target protein in activity

    doi: 10.1038/s41467-018-08231-5

    Figure Lengend Snippet: Affinity of CD for Ubl45 increases with Ub present and is dependent on C-terminal tail. a SPR binding results indicate a weak affinity of USP7CD for either Ubl45 or Ubl45 ΔC . CD was immobilized through GST on the chip and tested for binding with Ubl45 or Ubl45 ΔC . Equilibrium binding values were plotted against concentration and fitted to get an estimated K D . Responses were normalised using B max and standard deviation for resulting values is given. b The increased binding between Ubl45 and CDUb depends on the C-terminal tail. Ubl45 or Ubl45 ΔC was immobilized on the chip and the covalent CDUb complex was flown over. A fit was made using the equilibrium binding values yielding a K D of 590 nM for Ubl45, whereas no binding could be observed for Ubl45 ΔC . Normalisation was carried out using B max . c Comparison of the affinity of Ubl45 for CD or CDUb shows a remarkable increase. Curves from A and B are replotted to exemplify the change in K D . d The C-terminal tail was immobilized using biotin and CD or CDUb was flown over to confirm that the tail interacts with the transition state (CDUb) only and not the apo CD. e Overview of affinities between Ubl45 and CD show that Ub enhances the binding of the tail. The values for the upper two rows are determined using SPR, see a – d . The values in the last row have been derived from activity assays, see Fig. and for the estimated affinity of the C-terminal tail (*). N.A. not applicable; N.D. No binding detected. f The presence of the Ubl45 domain is essential for increased affinity of CD for ubiquitin, but not the C-terminal tail. The affinity for ubiquitin was measured in an FP assay where TAMRA-labelled ubiquitin was incubated with various USP7 constructs. g Steady-state kinetics analysis of USP7 constructs indicates that the C-terminal tail mainly affects the catalytic rate, while the presence of Ubl45 without the tail enhances the affinity for the ubiquitin substrate. The Michaelis-Menten constant ( K M ) and k cat were obtained by fitting the initial velocity data for various concentrations of UbRho. For a – e , obtained values are displayed ± SD after fitting. For f – g data points are the mean ± SD of n = 2 measurements

    Article Snippet: USP7 constructs (Fig. ) were based on the codon-optimized sequence (Addgene, #63573) .

    Techniques: Binding Assay, Concentration Assay, Standard Deviation, Comparison, Derivative Assay, Activity Assay, Ubiquitin Proteomics, FP Assay, Incubation, Construct

    Development of synthetic p53-derived substrates for USP7. a Schematic domain structure of p53 with trans activation domain (TAD), core region, tetramerization domain (TET) and C-terminal region indicated (CT). Close-up of CT highlights lysines (bold) known to be ubiquitinated and the TRAF recognition motif (underlined) , . K382 (red) is used as target lysine in the synthetic p53Ub reagents, underneath the sequence coverage of the peptides is indicated. b Three synthetic p53Ub-peptides are generated with different linkage types: covalently binding (vinylamide linkage, ( I )), uncleavable (triazole linkage, ( II )) and cleavable (native linkage, ( III )). c The affinity of USP7 for the covalent-binding p53Ub VA increases if the TRAF domain is present. USP7 constructs with and without TRAF domain have been incubated with the probe for 15 min at RT and analysed on a Coomassie gel. d The affinity of Ubl45 for the substrate-bound TCD is similar to CDUb (2.9 µM compared to 0.59 µM, Fig. ). Around 50 units of Ubl45 were immobilized on the chip before a titration range of p53Ub-bound TCD was flown over. Their equilibrium binding values were plotted and fitted to get the displayed K D -value, with the SD (±)

    Journal: Nature Communications

    Article Title: Kinetic analysis of multistep USP7 mechanism shows critical role for target protein in activity

    doi: 10.1038/s41467-018-08231-5

    Figure Lengend Snippet: Development of synthetic p53-derived substrates for USP7. a Schematic domain structure of p53 with trans activation domain (TAD), core region, tetramerization domain (TET) and C-terminal region indicated (CT). Close-up of CT highlights lysines (bold) known to be ubiquitinated and the TRAF recognition motif (underlined) , . K382 (red) is used as target lysine in the synthetic p53Ub reagents, underneath the sequence coverage of the peptides is indicated. b Three synthetic p53Ub-peptides are generated with different linkage types: covalently binding (vinylamide linkage, ( I )), uncleavable (triazole linkage, ( II )) and cleavable (native linkage, ( III )). c The affinity of USP7 for the covalent-binding p53Ub VA increases if the TRAF domain is present. USP7 constructs with and without TRAF domain have been incubated with the probe for 15 min at RT and analysed on a Coomassie gel. d The affinity of Ubl45 for the substrate-bound TCD is similar to CDUb (2.9 µM compared to 0.59 µM, Fig. ). Around 50 units of Ubl45 were immobilized on the chip before a titration range of p53Ub-bound TCD was flown over. Their equilibrium binding values were plotted and fitted to get the displayed K D -value, with the SD (±)

    Article Snippet: USP7 constructs (Fig. ) were based on the codon-optimized sequence (Addgene, #63573) .

    Techniques: Derivative Assay, Activation Assay, Sequencing, Generated, Binding Assay, Construct, Incubation, Titration

    The p53-derived tools stress the importance of both the TRAF and Ubl45 domain. a Binding of the TAMRA-labelled p53 peptide is determined by incubating 25 nM of TAMRA p53 with a dilution series of various USP7 constructs in FP assays. The obtained K D values for each USP7 construct are stated and indicate that in presence of the TRAF domain, the Ubl12345 domain affects recognition. b The non-hydrolysable p53Ub construct acts as an inhibitor for USP7 in deubiquitination assays. USP7 constructs, corrected for their activity (CD12345: 0.35 nM, TCD: 200 nM, CD: 75 nM, USP7FL: 0.35 nM) were incubated with increasing amounts of p53Ub inh and analysed for activity in a deubiquitination assay using a single concentration of UbRho. The raw data indicate that both the TRAF domain and the C-terminal Ubl domains increase the affinity towards the p53 construct. For clarity’s sake a limited number of concentrations is shown. c The observed activity for USP7 constructs after incubation with p53Ub inh (see B), is plotted against the concentration of inhibitor used. Fitting yielded IC 50 values and standard deviation as shown. The data points for a , b are the mean ± SD of at least n = 2 experiments. All reported values include the SD (±)

    Journal: Nature Communications

    Article Title: Kinetic analysis of multistep USP7 mechanism shows critical role for target protein in activity

    doi: 10.1038/s41467-018-08231-5

    Figure Lengend Snippet: The p53-derived tools stress the importance of both the TRAF and Ubl45 domain. a Binding of the TAMRA-labelled p53 peptide is determined by incubating 25 nM of TAMRA p53 with a dilution series of various USP7 constructs in FP assays. The obtained K D values for each USP7 construct are stated and indicate that in presence of the TRAF domain, the Ubl12345 domain affects recognition. b The non-hydrolysable p53Ub construct acts as an inhibitor for USP7 in deubiquitination assays. USP7 constructs, corrected for their activity (CD12345: 0.35 nM, TCD: 200 nM, CD: 75 nM, USP7FL: 0.35 nM) were incubated with increasing amounts of p53Ub inh and analysed for activity in a deubiquitination assay using a single concentration of UbRho. The raw data indicate that both the TRAF domain and the C-terminal Ubl domains increase the affinity towards the p53 construct. For clarity’s sake a limited number of concentrations is shown. c The observed activity for USP7 constructs after incubation with p53Ub inh (see B), is plotted against the concentration of inhibitor used. Fitting yielded IC 50 values and standard deviation as shown. The data points for a , b are the mean ± SD of at least n = 2 experiments. All reported values include the SD (±)

    Article Snippet: USP7 constructs (Fig. ) were based on the codon-optimized sequence (Addgene, #63573) .

    Techniques: Derivative Assay, Binding Assay, Construct, Activity Assay, Incubation, Concentration Assay, Standard Deviation

    A quantitative kinetic model for USP7 enzymatic activity through global fitting. Icons in each panel indicate the substrate used. The lines describe the fit of the data in the various experiments performed: a Minimal substrate activity assay of USP7FL (1 nM), using a dilution range of UbRho. b FP enzyme activity assay on TAMRA p53Ub (100 nM). The amounts of USP7 are indicated. After conversion to p53Ub amounts (lower panel) a delay time (DT) was introduced. c Stopped flow FP enzyme activity assay on TAMRA p53Ub (50 nM), the anisotropy signal allows observation of the early binding and hydrolysis phases. Areas marked in grey were not included in the fit as they represent the mixing time (<0.001 s) or a timescale where bleaching effects start to dominate (>10 s). d Intensity readings of the experiment in c indicates a change in chemical environment upon binding of substrate. e Like c for using peptide only (25 nM p53) shows equivalent binding phases as the full substrate. f Intensity readings of the experiment in e . All stopped-flow experiment are an addition of n = 10 separate measurements. g Behaviour of p53-substrate states during overall model in an equimolar (1–1; 50 nM) ratio of enzyme and substrate. Intermediate states as in h . h Model used for KinTek fitting with kinetic constants obtained. USP7FL indicated as USP7, intermediates with # or *. For binding steps (Step 1, 6 and 7) on-rates are in µM −1 s −1 and off-rates in s −1 . Rates for conformational changes (Step 2, 3 and 5) are in s −1 . The forward reaction for enzymatic hydrolysis (Step 4) is in s −1 , but the reverse step (labelled with θ) was assumed irreversible (fixed at 0 µM −1 s −1 ). Equation constants with matching Greek characters (α, β, γ and δ) were linked in the refinement. The on-rate for binding steps (labelled with ε) is diffusion-controlled, determined separately and fixed during modelling. These on- and off-rates reflect the optimal ratio that models the individual steps with their respective SD (±), as the experiment does not have sufficient resolution to fully resolve rates. For both UbRho and p53Ub the resulting steady-state parameters were calculated to allow for a direct comparison (last column)

    Journal: Nature Communications

    Article Title: Kinetic analysis of multistep USP7 mechanism shows critical role for target protein in activity

    doi: 10.1038/s41467-018-08231-5

    Figure Lengend Snippet: A quantitative kinetic model for USP7 enzymatic activity through global fitting. Icons in each panel indicate the substrate used. The lines describe the fit of the data in the various experiments performed: a Minimal substrate activity assay of USP7FL (1 nM), using a dilution range of UbRho. b FP enzyme activity assay on TAMRA p53Ub (100 nM). The amounts of USP7 are indicated. After conversion to p53Ub amounts (lower panel) a delay time (DT) was introduced. c Stopped flow FP enzyme activity assay on TAMRA p53Ub (50 nM), the anisotropy signal allows observation of the early binding and hydrolysis phases. Areas marked in grey were not included in the fit as they represent the mixing time (<0.001 s) or a timescale where bleaching effects start to dominate (>10 s). d Intensity readings of the experiment in c indicates a change in chemical environment upon binding of substrate. e Like c for using peptide only (25 nM p53) shows equivalent binding phases as the full substrate. f Intensity readings of the experiment in e . All stopped-flow experiment are an addition of n = 10 separate measurements. g Behaviour of p53-substrate states during overall model in an equimolar (1–1; 50 nM) ratio of enzyme and substrate. Intermediate states as in h . h Model used for KinTek fitting with kinetic constants obtained. USP7FL indicated as USP7, intermediates with # or *. For binding steps (Step 1, 6 and 7) on-rates are in µM −1 s −1 and off-rates in s −1 . Rates for conformational changes (Step 2, 3 and 5) are in s −1 . The forward reaction for enzymatic hydrolysis (Step 4) is in s −1 , but the reverse step (labelled with θ) was assumed irreversible (fixed at 0 µM −1 s −1 ). Equation constants with matching Greek characters (α, β, γ and δ) were linked in the refinement. The on-rate for binding steps (labelled with ε) is diffusion-controlled, determined separately and fixed during modelling. These on- and off-rates reflect the optimal ratio that models the individual steps with their respective SD (±), as the experiment does not have sufficient resolution to fully resolve rates. For both UbRho and p53Ub the resulting steady-state parameters were calculated to allow for a direct comparison (last column)

    Article Snippet: USP7 constructs (Fig. ) were based on the codon-optimized sequence (Addgene, #63573) .

    Techniques: Activity Assay, Enzyme Activity Assay, Binding Assay, Diffusion-based Assay, Comparison

    Kinetic model for USP7 mechanism on p53Ub The kinetic model (equations) and their interpretation are depicted schematically. The weak affinity between Ubl45 and CD suggests that free USP7 is in equilibrium between an ‘open’ and ‘closed’ state . The p53Ub substrate is bound by TRAF and CD, as well as an additional binding site that depends on the Ubl domains (1). Ubiquitin binding induces a rearrangement of the catalytic triad (2), which dramatically increases the affinity the activating C-terminal tail, but diminishes the contact between CD and Ubl45. Binding of the tail peptide (3) stabilises the active state. This promotes the hydrolysis of the isopeptide bond, allowing Ub release (4). This in turn diminishes affinity for the C-terminal tail, causing its release (5) and the subsequent release of the p53 peptide (6) to return USP7 to the ground state

    Journal: Nature Communications

    Article Title: Kinetic analysis of multistep USP7 mechanism shows critical role for target protein in activity

    doi: 10.1038/s41467-018-08231-5

    Figure Lengend Snippet: Kinetic model for USP7 mechanism on p53Ub The kinetic model (equations) and their interpretation are depicted schematically. The weak affinity between Ubl45 and CD suggests that free USP7 is in equilibrium between an ‘open’ and ‘closed’ state . The p53Ub substrate is bound by TRAF and CD, as well as an additional binding site that depends on the Ubl domains (1). Ubiquitin binding induces a rearrangement of the catalytic triad (2), which dramatically increases the affinity the activating C-terminal tail, but diminishes the contact between CD and Ubl45. Binding of the tail peptide (3) stabilises the active state. This promotes the hydrolysis of the isopeptide bond, allowing Ub release (4). This in turn diminishes affinity for the C-terminal tail, causing its release (5) and the subsequent release of the p53 peptide (6) to return USP7 to the ground state

    Article Snippet: USP7 constructs (Fig. ) were based on the codon-optimized sequence (Addgene, #63573) .

    Techniques: Binding Assay, Ubiquitin Proteomics

    Clinical characteristics of enrolled HCC patients.

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Clinical Significance of Ubiquitin Specific Protease 7 (USP7) in Predicting Prognosis of Hepatocellular Carcinoma and its Functional Mechanisms

    doi: 10.12659/MSM.909368

    Figure Lengend Snippet: Clinical characteristics of enrolled HCC patients.

    Article Snippet: The USP7 DNA construct was purchased from Addgene ( https://www.addgene.org/16655/ ).

    Techniques:

    USP7 is upregulated in HCC tumor tissues. ( A ) RT-PCR results showed that the RNA level of USP7 was increased in HCC tumor tissues than that in adjacent normal liver tissues, and was positively correlated with the TNM stage. ( B ) Representative IHC result showed the negative protein expression of USP7 in normal liver tissues. ( C ) Representative IHC result showed the high protein level of USP7 in HCC tissues, which predominately located in the nucleus. ( D ) Statistical analysis of IHC scores in normal liver tissues and HCC tissues showed a significantly higher USP7 protein level in tumor tissues. Magnification: ×400. Data was presented as mean ±SD. * P<0.05 by Student’s t-test.

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Clinical Significance of Ubiquitin Specific Protease 7 (USP7) in Predicting Prognosis of Hepatocellular Carcinoma and its Functional Mechanisms

    doi: 10.12659/MSM.909368

    Figure Lengend Snippet: USP7 is upregulated in HCC tumor tissues. ( A ) RT-PCR results showed that the RNA level of USP7 was increased in HCC tumor tissues than that in adjacent normal liver tissues, and was positively correlated with the TNM stage. ( B ) Representative IHC result showed the negative protein expression of USP7 in normal liver tissues. ( C ) Representative IHC result showed the high protein level of USP7 in HCC tissues, which predominately located in the nucleus. ( D ) Statistical analysis of IHC scores in normal liver tissues and HCC tissues showed a significantly higher USP7 protein level in tumor tissues. Magnification: ×400. Data was presented as mean ±SD. * P<0.05 by Student’s t-test.

    Article Snippet: The USP7 DNA construct was purchased from Addgene ( https://www.addgene.org/16655/ ).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing

    Kaplan-Meir survival curves of HCC patients. Overall survival analyses were conducted by Kaplan-Meir method and compared by log-rank test according to patients’ age ( A ), gender ( B ), tumor number ( C ), tumor size ( D ), TNM stage ( E ), and USP7 protein level ( F ). * P<0.05 by log-rank test.

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Clinical Significance of Ubiquitin Specific Protease 7 (USP7) in Predicting Prognosis of Hepatocellular Carcinoma and its Functional Mechanisms

    doi: 10.12659/MSM.909368

    Figure Lengend Snippet: Kaplan-Meir survival curves of HCC patients. Overall survival analyses were conducted by Kaplan-Meir method and compared by log-rank test according to patients’ age ( A ), gender ( B ), tumor number ( C ), tumor size ( D ), TNM stage ( E ), and USP7 protein level ( F ). * P<0.05 by log-rank test.

    Article Snippet: The USP7 DNA construct was purchased from Addgene ( https://www.addgene.org/16655/ ).

    Techniques:

    Kaplan-Meier overall survival of enrolled HCC patients.

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Clinical Significance of Ubiquitin Specific Protease 7 (USP7) in Predicting Prognosis of Hepatocellular Carcinoma and its Functional Mechanisms

    doi: 10.12659/MSM.909368

    Figure Lengend Snippet: Kaplan-Meier overall survival of enrolled HCC patients.

    Article Snippet: The USP7 DNA construct was purchased from Addgene ( https://www.addgene.org/16655/ ).

    Techniques: Expressing

    Cox multivariate analysis of enrolled HCC patients.

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Clinical Significance of Ubiquitin Specific Protease 7 (USP7) in Predicting Prognosis of Hepatocellular Carcinoma and its Functional Mechanisms

    doi: 10.12659/MSM.909368

    Figure Lengend Snippet: Cox multivariate analysis of enrolled HCC patients.

    Article Snippet: The USP7 DNA construct was purchased from Addgene ( https://www.addgene.org/16655/ ).

    Techniques: Expressing

    USP7 enhances tumor cell proliferation, migration, and invasion. The proliferation curves of HCC cells were plotted by MTT assays, which showed that USP7 can enhance the cell viability in both Hep3B ( A ) and Huh7 ( B ) cells. Wound-healing assays were performed to evaluate the migration capacity of HCC cells, indicating a promoting role of USP7 on cell migration ( C, D ). The invasion process of tumor cells was monitored by Matrigel-transwell assay, demonstrating that USP7-overexpression enhanced cell invasion, while USP7-knockdown suppressed tumor invasion ( E, F ). Data was presented as mean ±SD. * P<0.05 by Student’s t-test.

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Clinical Significance of Ubiquitin Specific Protease 7 (USP7) in Predicting Prognosis of Hepatocellular Carcinoma and its Functional Mechanisms

    doi: 10.12659/MSM.909368

    Figure Lengend Snippet: USP7 enhances tumor cell proliferation, migration, and invasion. The proliferation curves of HCC cells were plotted by MTT assays, which showed that USP7 can enhance the cell viability in both Hep3B ( A ) and Huh7 ( B ) cells. Wound-healing assays were performed to evaluate the migration capacity of HCC cells, indicating a promoting role of USP7 on cell migration ( C, D ). The invasion process of tumor cells was monitored by Matrigel-transwell assay, demonstrating that USP7-overexpression enhanced cell invasion, while USP7-knockdown suppressed tumor invasion ( E, F ). Data was presented as mean ±SD. * P<0.05 by Student’s t-test.

    Article Snippet: The USP7 DNA construct was purchased from Addgene ( https://www.addgene.org/16655/ ).

    Techniques: Migration, Transwell Assay, Over Expression, Knockdown