Review



type erbb2 expression construct  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc type erbb2 expression construct
    Validation of successful ectopic overexpression of <t>ERBB2</t> in the CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines. ( A ) Relative ERBB2 expression in the normal colon cell lines CCD33 and CCD841 and the CRC cell lines HT29 and HCT116 as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the CCD33 cells. Data represent the mean ± SD of three independent experiments. ( B ) Relative ERBB2 expression in non-transfected and either empty pcDNA3 vector or pcDNA3- ERBB2 transfected HCT116, HT29, CCD33, and CCD841 cells as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the non-transfected cells. Data represent the mean ± SD of three independent experiments. *** p < 0.001; ns: not significant. ( C ) Same as B, but relative HER2 protein expression was determined in the different experimental conditions. Blots were re-probed with anti-β-Actin antibody to confirm equal loading across the lanes. The representative blots from three independent experiments are shown.
    Type Erbb2 Expression Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/type+erbb2+expression+construct/HER2+WT+(Plasmid+%2316257)/pmc09817785-43-1-11
    Average 93 stars, based on 62 article reviews
    type erbb2 expression construct - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "Transcriptomic Changes Associated with ERBB2 Overexpression in Colorectal Cancer Implicate a Potential Role of the Wnt Signaling Pathway in Tumorigenesis"

    Article Title: Transcriptomic Changes Associated with ERBB2 Overexpression in Colorectal Cancer Implicate a Potential Role of the Wnt Signaling Pathway in Tumorigenesis

    Journal: Cancers

    doi: 10.3390/cancers15010130

    Validation of successful ectopic overexpression of ERBB2 in the CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines. ( A ) Relative ERBB2 expression in the normal colon cell lines CCD33 and CCD841 and the CRC cell lines HT29 and HCT116 as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the CCD33 cells. Data represent the mean ± SD of three independent experiments. ( B ) Relative ERBB2 expression in non-transfected and either empty pcDNA3 vector or pcDNA3- ERBB2 transfected HCT116, HT29, CCD33, and CCD841 cells as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the non-transfected cells. Data represent the mean ± SD of three independent experiments. *** p < 0.001; ns: not significant. ( C ) Same as B, but relative HER2 protein expression was determined in the different experimental conditions. Blots were re-probed with anti-β-Actin antibody to confirm equal loading across the lanes. The representative blots from three independent experiments are shown.
    Figure Legend Snippet: Validation of successful ectopic overexpression of ERBB2 in the CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines. ( A ) Relative ERBB2 expression in the normal colon cell lines CCD33 and CCD841 and the CRC cell lines HT29 and HCT116 as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the CCD33 cells. Data represent the mean ± SD of three independent experiments. ( B ) Relative ERBB2 expression in non-transfected and either empty pcDNA3 vector or pcDNA3- ERBB2 transfected HCT116, HT29, CCD33, and CCD841 cells as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the non-transfected cells. Data represent the mean ± SD of three independent experiments. *** p < 0.001; ns: not significant. ( C ) Same as B, but relative HER2 protein expression was determined in the different experimental conditions. Blots were re-probed with anti-β-Actin antibody to confirm equal loading across the lanes. The representative blots from three independent experiments are shown.

    Techniques Used: Biomarker Discovery, Over Expression, Expressing, Quantitative RT-PCR, Control, Transfection, Plasmid Preparation

    Heatmap of the differentially expressed genes in CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines transfected with empty vector or ERBB2, either clustered based on expression ( A ) or grouped based on transfection and phenotype ( B ).
    Figure Legend Snippet: Heatmap of the differentially expressed genes in CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines transfected with empty vector or ERBB2, either clustered based on expression ( A ) or grouped based on transfection and phenotype ( B ).

    Techniques Used: Transfection, Plasmid Preparation, Expressing

    Genome-wide gene expression changes between ERBB2 + and ERBB2 − CRC patients. ( A ) Principal component analysis (PCA) was performed to determine batch effects among the 14 patients’ samples. Comparison of PC1 and PC2 variation sequestered the samples based on ERBB2 expression. ( B ) Volcano plot of differentially expressed genes between ERBB2 - and ERBB2 + patients’ samples from input RNA-seq. Genes that are expressed significantly higher and lower based on log2 fold change in HER2+ samples are highlighted by green and blue dots, respectively. Unchanged transcripts are demarcated as grey circles ( p > 0.05). ( C ) Heatmap of the top 100 differentially expressed genes.
    Figure Legend Snippet: Genome-wide gene expression changes between ERBB2 + and ERBB2 − CRC patients. ( A ) Principal component analysis (PCA) was performed to determine batch effects among the 14 patients’ samples. Comparison of PC1 and PC2 variation sequestered the samples based on ERBB2 expression. ( B ) Volcano plot of differentially expressed genes between ERBB2 - and ERBB2 + patients’ samples from input RNA-seq. Genes that are expressed significantly higher and lower based on log2 fold change in HER2+ samples are highlighted by green and blue dots, respectively. Unchanged transcripts are demarcated as grey circles ( p > 0.05). ( C ) Heatmap of the top 100 differentially expressed genes.

    Techniques Used: Genome Wide, Gene Expression, Comparison, Expressing, RNA Sequencing

    Related Articles

    Mutagenesis:

    Article Title: Characterization of HER2-Positive Murine Breast Cancer Models for Investigating HER2-Targeted Therapy and Immunotherapy
    Article Snippet: .. Plasmids encoding human HER2 wild-type (HER2 WT ; Addgene, Watertown, MA, USA, #16257) and the constitutively active mutation p.A775_G776insYVMA (HER2 YVMA ; Addgene, #40982) were obtained from Addgene. .. The HER2 WT and HER2 YVMA variant were PCR-amplified with the NEBNext High-Fidelity 2X PCR master mix (NEB, Ipswich, MA, USA, M0541S) in 50 μL total volume using the following primers: forward 5′-ACTGTCTAGAATGGAGCTGGCGGCCTTGT-3′ and reverse 5′-ACTGTCTAGATCACACTGGCACGTCCAGA-3′.

    Article Title: Characterization of HER2-Positive Murine Breast Cancer Models for Investigating HER2-Targeted Therapy and Immunotherapy.
    Article Snippet: .. Plasmids encoding human HER2 wild-type (HER2WT; Addgene, Watertown, MA, USA, #16257) and the constitutively active mutation p.A775_G776insYVMA (HER2YVMA; Addgene, #40982) were obtained from Addgene. .. The HER2WT and HER2YVMA variant were PCR-amplified with the NEBNext High-Fidelity 2X PCR master mix (NEB, Ipswich, MA, USA, M0541S) in 50 μL total volume using the following primers: forward 5′-ACTGTCTAGAATGGAGCTGGCGGCCTTGT-3′ and reverse 5′-ACTGTCTAGATCACACTGGCACGTCCAGA-3′ .

    Construct:

    Article Title: p95HER2, a truncated form of the HER2 oncoprotein, drives an immunosuppressive program in HER2 + breast cancer that limits trastuzumab deruxtecan efficacy.
    Article Snippet: Resistance to human epidermal growth factor receptor 2 (HER2)-targeted therapies and immuno-oncology agents poses a major challenge in treating HER2-positive breast cancer.. Here we demonstrate that p95HER2, a truncated form of HER2, drives immune evasion in HER2-positive female breast cancer, enhancing tumor growth and conferring therapy resistance.. This stems from the unique ability of p95HER2 to promote cancer cell-intrinsic programmed death ligand 1 expression and secretion of immunosuppressive mediators including interleukin 6.

    Expressing:

    Article Title: p95HER2, a truncated form of the HER2 oncoprotein, drives an immunosuppressive program in HER2 + breast cancer that limits trastuzumab deruxtecan efficacy.
    Article Snippet: Resistance to human epidermal growth factor receptor 2 (HER2)-targeted therapies and immuno-oncology agents poses a major challenge in treating HER2-positive breast cancer.. Here we demonstrate that p95HER2, a truncated form of HER2, drives immune evasion in HER2-positive female breast cancer, enhancing tumor growth and conferring therapy resistance.. This stems from the unique ability of p95HER2 to promote cancer cell-intrinsic programmed death ligand 1 expression and secretion of immunosuppressive mediators including interleukin 6.

    Control:

    Article Title: p95HER2, a truncated form of the HER2 oncoprotein, drives an immunosuppressive program in HER2 + breast cancer that limits trastuzumab deruxtecan efficacy.
    Article Snippet: Resistance to human epidermal growth factor receptor 2 (HER2)-targeted therapies and immuno-oncology agents poses a major challenge in treating HER2-positive breast cancer.. Here we demonstrate that p95HER2, a truncated form of HER2, drives immune evasion in HER2-positive female breast cancer, enhancing tumor growth and conferring therapy resistance.. This stems from the unique ability of p95HER2 to promote cancer cell-intrinsic programmed death ligand 1 expression and secretion of immunosuppressive mediators including interleukin 6.

    Plasmid Preparation:

    Article Title: p95HER2, a truncated form of the HER2 oncoprotein, drives an immunosuppressive program in HER2 + breast cancer that limits trastuzumab deruxtecan efficacy.
    Article Snippet: Resistance to human epidermal growth factor receptor 2 (HER2)-targeted therapies and immuno-oncology agents poses a major challenge in treating HER2-positive breast cancer.. Here we demonstrate that p95HER2, a truncated form of HER2, drives immune evasion in HER2-positive female breast cancer, enhancing tumor growth and conferring therapy resistance.. This stems from the unique ability of p95HER2 to promote cancer cell-intrinsic programmed death ligand 1 expression and secretion of immunosuppressive mediators including interleukin 6.

    Article Title: Antibody-lectin chimeras for glyco-immune checkpoint blockade
    Article Snippet: K562-CD20 cells were established by transducing K562 cells (ATCC) with pre-packaged lentiviral particles encoding CD20 (G&P Biosciences) according to the manufacturer’s protocol and sorted for high and low CD20-expressing cells using rituximab and a BV421-labelled anti-human secondary (Jackson ImmunoResearch). .. Lentiviral vector encoding HER2/neu was a gift from M.-C. Hung (Addgene plasmid, 16257). ..

    Article Title: Antibody-lectin chimeras for glyco-immune checkpoint blockade.
    Article Snippet: Nature Biotechnology Article https://doi.org/10.1038/s41587-025-02884-6 enhanced ADCP compared to trastuzumab in our functional assays (for example, Fig. 2c). .. Lentiviral vector encoding HER2/neu was a gift from M.-C. Hung (Addgene plasmid, 16257). ..

    other:

    Article Title: Identification of asporin as a HER3 ligand exposes a therapeutic vulnerability in prostate cancer
    Article Snippet: Key Resources REAGENT or RESOURCE SOURCE IDENTIFIER NOTE Antibodies for Immunoblotting P-HER3 Cell Signaling Cat# 4791 RRID:AB 2099709 WB: 1:500 (BSA) HER3 Cell Signaling Cat# 12708 RRID:AB 2721919 WB: 1:1000 (BSA); IHC 1:50; IF: 1:100 P-HER2 Cell Signaling Cat# 2243 RRID:AB 490899 WB: 1:500 (BSA) HER2 Cell Signaling Cat# 2165 RRID:AB 10692490 WB: 1:1000 (BSA) P-EGFR (Y845) Cell Signaling Cat# 2231 RRID:AB 1264155 WB: 1:500 (BSA) P-EGFR (Y1173) Cell Signaling Cat# 4407 RRID:AB 331795 WB: 1:500 (BSA) EGFR Cell Signaling Cat# 4267 RRID:AB 2895042 WB: 1:1000 (BSA) P-AKT Cell Signaling Cat# 4060 RRID:AB 2315049 WB: 1:5000 (BSA) AKT Cell Signaling Cat# 9272 RRID:AB 329827 WB: 1:1000 (milk) P-ERK Cell Signaling Cat# 4370 RRID:AB 2315112 WB: 1:1000 (BSA) ERK Cell Signaling Cat# 9102 RRID:AB 330744 WB: 1:1000 (milk) P-PLCγγ Cell Signaling Cat# 2821 RRID:AB 330855 WB: 1:500 (BSA) PLCγγ Cell Signaling Cat# 2822 RRID:AB 2163702 WB: 1:1000 (milk) P-CAMKII Cell Signaling Cat# 12716 RRID:AB 2713889 WB: 1:500 (BSA) CAMKII Cell Signaling Cat# 3362 RRID:AB 2067938 WB: 1:500 (BSA) GAPDH Cell Signaling Cat# 5174 RRID:AB 10622025 WB: 1:1000 (milk) Flag-tag rabbit Cell Signaling Cat# 14793 RRID:AB 2572291 WB: 1:1000 (BSA) Flag-tag mouse Cell Signaling Cat #:8146 RRID:AB 10950495 IF: 1:200 His-tag Cell Signaling Cat# 2365 RRID:AB 2115720 WB: 1:1000 (BSA) ASPN Sigma Cat# HPA008435 RRID:AB 1845112 WB: 1:1000 (BSA) Androgen Receptor Cell Signaling Cat# 5153 RRID:AB 10691711 WB: 1:2000 (milk) anti-rabbit secondary, HRP Cell Signaling Cat# 7074 RRID:AB 2099233 WB: 1:1000-1:2000 Recombinant Proteins rhASPN MyBioSource MBS1292257 rmASPN Origene TP505760 rhNRG1 R&Dsystems 396-HB rmNRG1 R&Dsystems 9875-NR rhHER3-flag Origene TP309954 rhHER2-flag Origene TP312583 rhPDGFRβ-flag Origene TP306377 rhEGF R&Dsystems 236-EG rmEGF R&Dsystems 2028-EG Plasmids and constructs HER3-FLAG Origene RC212583 HER3-no flag SinoBiological HG10201-UT HER2-FLAG Origene RC212583 HER2-no flag AddGene 16257 pIRES-Neo3 Clontech 631621 ASPN-D14 no tag Modified from Clontech pIRES-Neo3 PMID: 26446945 ASPN-D14-3xFLAG Modified from Clontech pIRES-Neo3 PMID: 26446945 pRP[Exp]-CMV>{hERBB3[NM 001982.4]*(ΔDomain I)}/3xFLAG VectorBuilder Vector ID: VB240411-1594yjb pRP[Exp]-CMV>{hERBB3[NM 001982.4]*(ΔDomain III}/3xFLAG VectorBuilder Vector ID: VB240411-1595cyh pRP[Exp]-CMV>{hERBB3[NM 001982.4]*(ΔDomain I&III)}/3xFLAG VectorBuilder Vector ID: VB240729-1665wbu pBABE-puro-hTERT Addgene 1771 CRISPR guides HER2 sgRNA IDT TCATCGCTCACAACCAAGTG HER3 sgRNA IDT ATCATGTGAGACAACACCGG Alt-RTM S.p.



    Similar Products

    type erbb2 expression construct  (Addgene inc)
    93
    Addgene inc type erbb2 expression construct
    Validation of successful ectopic overexpression of <t>ERBB2</t> in the CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines. ( A ) Relative ERBB2 expression in the normal colon cell lines CCD33 and CCD841 and the CRC cell lines HT29 and HCT116 as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the CCD33 cells. Data represent the mean ± SD of three independent experiments. ( B ) Relative ERBB2 expression in non-transfected and either empty pcDNA3 vector or pcDNA3- ERBB2 transfected HCT116, HT29, CCD33, and CCD841 cells as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the non-transfected cells. Data represent the mean ± SD of three independent experiments. *** p < 0.001; ns: not significant. ( C ) Same as B, but relative HER2 protein expression was determined in the different experimental conditions. Blots were re-probed with anti-β-Actin antibody to confirm equal loading across the lanes. The representative blots from three independent experiments are shown.
    Type Erbb2 Expression Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/type+erbb2+expression+construct/HER2+WT+(Plasmid+%2316257)/pmc09817785-43-1-11
    Average 93 stars, based on 1 article reviews
    type erbb2 expression construct - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Validation of successful ectopic overexpression of ERBB2 in the CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines. ( A ) Relative ERBB2 expression in the normal colon cell lines CCD33 and CCD841 and the CRC cell lines HT29 and HCT116 as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the CCD33 cells. Data represent the mean ± SD of three independent experiments. ( B ) Relative ERBB2 expression in non-transfected and either empty pcDNA3 vector or pcDNA3- ERBB2 transfected HCT116, HT29, CCD33, and CCD841 cells as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the non-transfected cells. Data represent the mean ± SD of three independent experiments. *** p < 0.001; ns: not significant. ( C ) Same as B, but relative HER2 protein expression was determined in the different experimental conditions. Blots were re-probed with anti-β-Actin antibody to confirm equal loading across the lanes. The representative blots from three independent experiments are shown.

    Journal: Cancers

    Article Title: Transcriptomic Changes Associated with ERBB2 Overexpression in Colorectal Cancer Implicate a Potential Role of the Wnt Signaling Pathway in Tumorigenesis

    doi: 10.3390/cancers15010130

    Figure Lengend Snippet: Validation of successful ectopic overexpression of ERBB2 in the CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines. ( A ) Relative ERBB2 expression in the normal colon cell lines CCD33 and CCD841 and the CRC cell lines HT29 and HCT116 as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the CCD33 cells. Data represent the mean ± SD of three independent experiments. ( B ) Relative ERBB2 expression in non-transfected and either empty pcDNA3 vector or pcDNA3- ERBB2 transfected HCT116, HT29, CCD33, and CCD841 cells as determined by qRT-PCR. Data were normalized to the expression of the internal control 18S rRNA gene and fold expressions were plotted relative to expression in the non-transfected cells. Data represent the mean ± SD of three independent experiments. *** p < 0.001; ns: not significant. ( C ) Same as B, but relative HER2 protein expression was determined in the different experimental conditions. Blots were re-probed with anti-β-Actin antibody to confirm equal loading across the lanes. The representative blots from three independent experiments are shown.

    Article Snippet: The wild-type ERBB2 expression construct was a gift from Mien-Chie Hung (Addgene plasmid #16257; https://www.addgene.org/16257 , accessed on 15 December 2020) [ ].

    Techniques: Biomarker Discovery, Over Expression, Expressing, Quantitative RT-PCR, Control, Transfection, Plasmid Preparation

    Heatmap of the differentially expressed genes in CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines transfected with empty vector or ERBB2, either clustered based on expression ( A ) or grouped based on transfection and phenotype ( B ).

    Journal: Cancers

    Article Title: Transcriptomic Changes Associated with ERBB2 Overexpression in Colorectal Cancer Implicate a Potential Role of the Wnt Signaling Pathway in Tumorigenesis

    doi: 10.3390/cancers15010130

    Figure Lengend Snippet: Heatmap of the differentially expressed genes in CRC (HCT116 and HT29) and normal colon (CCD33 and CCD841) cell lines transfected with empty vector or ERBB2, either clustered based on expression ( A ) or grouped based on transfection and phenotype ( B ).

    Article Snippet: The wild-type ERBB2 expression construct was a gift from Mien-Chie Hung (Addgene plasmid #16257; https://www.addgene.org/16257 , accessed on 15 December 2020) [ ].

    Techniques: Transfection, Plasmid Preparation, Expressing

    Genome-wide gene expression changes between ERBB2 + and ERBB2 − CRC patients. ( A ) Principal component analysis (PCA) was performed to determine batch effects among the 14 patients’ samples. Comparison of PC1 and PC2 variation sequestered the samples based on ERBB2 expression. ( B ) Volcano plot of differentially expressed genes between ERBB2 - and ERBB2 + patients’ samples from input RNA-seq. Genes that are expressed significantly higher and lower based on log2 fold change in HER2+ samples are highlighted by green and blue dots, respectively. Unchanged transcripts are demarcated as grey circles ( p > 0.05). ( C ) Heatmap of the top 100 differentially expressed genes.

    Journal: Cancers

    Article Title: Transcriptomic Changes Associated with ERBB2 Overexpression in Colorectal Cancer Implicate a Potential Role of the Wnt Signaling Pathway in Tumorigenesis

    doi: 10.3390/cancers15010130

    Figure Lengend Snippet: Genome-wide gene expression changes between ERBB2 + and ERBB2 − CRC patients. ( A ) Principal component analysis (PCA) was performed to determine batch effects among the 14 patients’ samples. Comparison of PC1 and PC2 variation sequestered the samples based on ERBB2 expression. ( B ) Volcano plot of differentially expressed genes between ERBB2 - and ERBB2 + patients’ samples from input RNA-seq. Genes that are expressed significantly higher and lower based on log2 fold change in HER2+ samples are highlighted by green and blue dots, respectively. Unchanged transcripts are demarcated as grey circles ( p > 0.05). ( C ) Heatmap of the top 100 differentially expressed genes.

    Article Snippet: The wild-type ERBB2 expression construct was a gift from Mien-Chie Hung (Addgene plasmid #16257; https://www.addgene.org/16257 , accessed on 15 December 2020) [ ].

    Techniques: Genome Wide, Gene Expression, Comparison, Expressing, RNA Sequencing