Review



trim21 antibody  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Cell Signaling Technology Inc trim21 antibody
    High expression of tripartite motif-containing protein 21 <t>(TRIM21)</t> in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Trim21 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/TRIM21+Rabbit+mAb/pmc13047273-287-9-11
    Average 94 stars, based on 55 article reviews
    trim21 antibody - by Bioz Stars, 2026-10
    94/100 stars

    Images

    1) Product Images from "Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A"

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    Journal: Research

    doi: 10.34133/research.1223

    High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Figure Legend Snippet: High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Techniques Used: Expressing, Staining, Control, Western Blot, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Comparison

    Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Figure Legend Snippet: Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Techniques Used: Expressing, Knockdown, Sequencing, Phospho-proteomics, Transmission Assay, Electron Microscopy, Fluorescence, Activity Assay, Western Blot

    Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.
    Figure Legend Snippet: Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.

    Techniques Used: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Sequencing, Western Blot, Co-Immunoprecipitation Assay, Immunofluorescence, Staining, Confocal Microscopy, Microscale Thermophoresis, Over Expression, Knockdown, Phospho-proteomics, Fluorescence

    Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.
    Figure Legend Snippet: Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.

    Techniques Used: Ubiquitin Proteomics, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Knockdown, Western Blot, Over Expression, Co-Immunoprecipitation Assay, Modification, Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Mutagenesis

    UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.
    Figure Legend Snippet: UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.

    Techniques Used: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Functional Assay, Co-Immunoprecipitation Assay, Western Blot, Immunofluorescence, Staining, Confocal Microscopy, Knockdown, Ubiquitin Proteomics, Over Expression

    MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.
    Figure Legend Snippet: MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.

    Techniques Used: Ubiquitin Proteomics, Western Blot, Knockdown, Co-Immunoprecipitation Assay, Phospho-proteomics, Activity Assay, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Staining, Comparison

    MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Figure Legend Snippet: MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Techniques Used: Staining, Transmission Assay, Electron Microscopy, Confocal Microscopy, Control, Fluorescence, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Ubiquitin Proteomics

    Related Articles

    Western Blot:

    Article Title: The E3 ligase TRIM21 promotes progression of pancreatic ductal adenocarcinoma by down-regulating TAp63α and derepressing IL20RB .
    Article Snippet: Pancreatic ductal adenocarcinoma (PDAC) is an aggressive tumor and frequently has mutations in the transcription factor p53.. TAp63α is a member of the p53 protein family that is generally tumor suppressive in various other p53mutant or p53deficient cancers.. Here, we found that TAp63α inhibited cell proliferation, epithelialmesenchymal transition (EMT), and migration in several p53mutant PDAC cell lines.

    Article Title: SNAP23 deficiency triggers Trim21 mitochondrial translocation to suppress TFAM-mediated oxidative metabolism and drive chemoresistance in colorectal cancer
    Article Snippet: Rabbit polyclonal anti-SNAP23 (for WB, IP, IHC, IF) , Proteintech , Cat# 10825-1-AP, RRID:AB_2192022. .. TRIM21 (D1O1D) Rabbit mAb (for WB, IP) , CST , Cat# 92043,RRID:AB_2800177. .. TFAM (D5C8) Rabbit mAb (for WB, IP, IHC) , CST , Cat# 8076, RRID:AB_10949110.

    Chromatin Immunoprecipitation:

    Article Title: The E3 ligase TRIM21 promotes progression of pancreatic ductal adenocarcinoma by down-regulating TAp63α and derepressing IL20RB .
    Article Snippet: Pancreatic ductal adenocarcinoma (PDAC) is an aggressive tumor and frequently has mutations in the transcription factor p53.. TAp63α is a member of the p53 protein family that is generally tumor suppressive in various other p53mutant or p53deficient cancers.. Here, we found that TAp63α inhibited cell proliferation, epithelialmesenchymal transition (EMT), and migration in several p53mutant PDAC cell lines.

    Incubation:

    Article Title: PKP1 promotes lung cancer by modulating energy metabolism through stabilization of PFKP
    Article Snippet: .. Cells were then incubated overnight at 4 °C in a humidified chamber with the following primary antibodies diluted in blocking solution: anti-PKP1 (#HPA027221, Sigma Aldrich, 1:150) and anti-TRIM21 (#92043, Cell Signaling, 1:100). .. After washing, cells were incubated for 1 h at room temperature with the corresponding secondary antibodies: Alexa Fluor 488-conjugated antibody (#A-11008, ThermoFisher) for PKP1 detection and Alexa Fluor 647-conjugated antibody (#A-21244, ThermoFisher) for TRIM21 detection.

    Article Title: Ubiquitin-dependent proteasomal degradation of small hepatitis B virus surface antigen mediated by TRIM21 and antagonized by OTUD4
    Article Snippet: Proteins were then separated on a 12% SDS-PAGE gel under reducing conditions and transferred onto polyvinylidene fluoride (PVDF) membranes (Bio-Rad Laboratories, USA). .. Membranes were blocked with Tris-buffered saline (TBS)-Tween 20 containing 5% bovine serum albumin (BSA) and incubated overnight at 4°C with primary antibodies against HBsAg (Creative-Diagnostics, #DMABT-51328MH), OTUD4 (abcam, #ab106368), β-actin (#4970S), HA (#3724S), TRIM21 (#92043S), and myc (#2276S) sourced from Cell Signaling Technology. .. Following thorough washes, horseradish peroxidase (HRP)-coupled secondary antibody (Cell Signaling Technology) was applied for an hour.

    Blocking Assay:

    Article Title: PKP1 promotes lung cancer by modulating energy metabolism through stabilization of PFKP
    Article Snippet: .. Cells were then incubated overnight at 4 °C in a humidified chamber with the following primary antibodies diluted in blocking solution: anti-PKP1 (#HPA027221, Sigma Aldrich, 1:150) and anti-TRIM21 (#92043, Cell Signaling, 1:100). .. After washing, cells were incubated for 1 h at room temperature with the corresponding secondary antibodies: Alexa Fluor 488-conjugated antibody (#A-11008, ThermoFisher) for PKP1 detection and Alexa Fluor 647-conjugated antibody (#A-21244, ThermoFisher) for TRIM21 detection.

    other:

    Article Title: Defining the Antitumor Mechanism of Action of a Clinical-stage Compound as a Selective Degrader of the Nuclear Pore Complex
    Article Snippet: The plate was read on a PHERAstar FSX plate reader (BMG Labtech; LanthaScreen Optic Module integration start: 70 μs; integration time: 600 μs).

    Immunohistochemical staining:

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
    Article Snippet: .. Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300). .. Stained slides were examined with a microscope (Nikon, ci-L).

    Staining:

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
    Article Snippet: .. Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300). .. Stained slides were examined with a microscope (Nikon, ci-L).

    Immunohistochemistry:

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A
    Article Snippet: .. Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300). .. Stained slides were examined with a microscope (Nikon, ci-L).

    Generated:

    Article Title: TAF1 acetyltransferase promotes colorectal carcinoma metastasis by catalyzing β-hydroxybutyrylation of KCTD9.
    Article Snippet: Colorectal carcinoma (CRC) ranks as the second leading cause of cancer mortality worldwide.. However, the mechanisms underlying CRC progression and metastasis, remain unclear.. Our current research has identified that TATA-binding protein-associated factor-1 (TAF1), also as a lysine acetyltransferase, is frequently upregulated in CRC.

    Article Title: TAF1 acetyltransferase promotes colorectal carcinoma metastasis by catalyzing β-hydroxybutyrylation of KCTD9
    Article Snippet: .. Antibodies for TAF1 (#12781), HES1 (#11988), CXCR4 (#64837), CXCL12 (#3740), activated Notch1 (NICD, #4380), CBP (#7389 T), P300 (#86377), TRIM21 (#92043), HA (#3724), Actin (#4967S) and His (#12698) were from CST (Danvers, MA); anti-β-Hydroxybutyryllysine (#PTM-1201RM) was from PTM BIO (Chicago, USA); antibody for KCTD9 (ab180937) were from Abcam Biotechnology (Abcam, Cambridge, UK); HEY1 (#19929-1-AP), MYC (#10828-1-AP), SNAI1 (#13099-1-AP) were from Proteintech; and anti-KCTD9 K123bhb and K129bhb rabbit polyclonal antibody generated by Proteintech using the peptide DKGVWGN-K(bhb)-QDHRGAF and D-K(bhb)-GVWGNK; and KCTD9-Kbhb peptide was synthesized by using the peptide of DK(bhb)GVWGN-K(bhb)-QDHRGAF; an antibody for FLAG (F3165) was from Sigma-Aldrich; antibodies for GAPDH (sc-25778) and GST (sc-138) were from Santa Cruz Biotechnology (Santa Cruz, CA); the secondary antibodies, anti-rabbit IgG, HRP-linked antibody (#7074) and anti-mouse IgG, HRP-linked antibody (#7076) were purchased from CST (Danvers, MA). ..

    Synthesized:

    Article Title: TAF1 acetyltransferase promotes colorectal carcinoma metastasis by catalyzing β-hydroxybutyrylation of KCTD9.
    Article Snippet: Colorectal carcinoma (CRC) ranks as the second leading cause of cancer mortality worldwide.. However, the mechanisms underlying CRC progression and metastasis, remain unclear.. Our current research has identified that TATA-binding protein-associated factor-1 (TAF1), also as a lysine acetyltransferase, is frequently upregulated in CRC.

    Article Title: TAF1 acetyltransferase promotes colorectal carcinoma metastasis by catalyzing β-hydroxybutyrylation of KCTD9
    Article Snippet: .. Antibodies for TAF1 (#12781), HES1 (#11988), CXCR4 (#64837), CXCL12 (#3740), activated Notch1 (NICD, #4380), CBP (#7389 T), P300 (#86377), TRIM21 (#92043), HA (#3724), Actin (#4967S) and His (#12698) were from CST (Danvers, MA); anti-β-Hydroxybutyryllysine (#PTM-1201RM) was from PTM BIO (Chicago, USA); antibody for KCTD9 (ab180937) were from Abcam Biotechnology (Abcam, Cambridge, UK); HEY1 (#19929-1-AP), MYC (#10828-1-AP), SNAI1 (#13099-1-AP) were from Proteintech; and anti-KCTD9 K123bhb and K129bhb rabbit polyclonal antibody generated by Proteintech using the peptide DKGVWGN-K(bhb)-QDHRGAF and D-K(bhb)-GVWGNK; and KCTD9-Kbhb peptide was synthesized by using the peptide of DK(bhb)GVWGN-K(bhb)-QDHRGAF; an antibody for FLAG (F3165) was from Sigma-Aldrich; antibodies for GAPDH (sc-25778) and GST (sc-138) were from Santa Cruz Biotechnology (Santa Cruz, CA); the secondary antibodies, anti-rabbit IgG, HRP-linked antibody (#7074) and anti-mouse IgG, HRP-linked antibody (#7076) were purchased from CST (Danvers, MA). ..

    Saline:

    Article Title: Ubiquitin-dependent proteasomal degradation of small hepatitis B virus surface antigen mediated by TRIM21 and antagonized by OTUD4
    Article Snippet: Proteins were then separated on a 12% SDS-PAGE gel under reducing conditions and transferred onto polyvinylidene fluoride (PVDF) membranes (Bio-Rad Laboratories, USA). .. Membranes were blocked with Tris-buffered saline (TBS)-Tween 20 containing 5% bovine serum albumin (BSA) and incubated overnight at 4°C with primary antibodies against HBsAg (Creative-Diagnostics, #DMABT-51328MH), OTUD4 (abcam, #ab106368), β-actin (#4970S), HA (#3724S), TRIM21 (#92043S), and myc (#2276S) sourced from Cell Signaling Technology. .. Following thorough washes, horseradish peroxidase (HRP)-coupled secondary antibody (Cell Signaling Technology) was applied for an hour.



    Similar Products

    93
    Sino Biological human trim21 gene orf cdna clone expression plasmid, c-gfpspark tag
    Human Trim21 Gene Orf Cdna Clone Expression Plasmid, C Gfpspark Tag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/Human+TRIM21+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-GFPSpark+tag/custom%40hg18010-acg%4042066836
    Average 93 stars, based on 1 article reviews
    human trim21 gene orf cdna clone expression plasmid, c-gfpspark tag - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    94
    MedChemExpress trim21
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Trim21, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/TRIM21%2C+Human/pmc13178978-237-8-9
    Average 94 stars, based on 1 article reviews
    trim21 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    86
    Huabio Inc anti trim21
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Anti Trim21, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/anti+monoclonal+rabbit+trim21/pmc13195780-26-0-2
    Average 86 stars, based on 1 article reviews
    anti trim21 - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Azenta mouse trim21 full length
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Mouse Trim21 Full Length, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/cgas+coli+escherichia+expression+full+genes+length+mouse/pm42173883-335-0-28
    Average 86 stars, based on 1 article reviews
    mouse trim21 full length - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Genechem trim21
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Trim21, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/knockdown+plasmids+trim21/10__1161_slash_jaha__124__040733-85-8-12
    Average 86 stars, based on 1 article reviews
    trim21 - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech cgaggtgatctcaaagcaata sangon biotech n a shrna trim21
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Cgaggtgatctcaaagcaata Sangon Biotech N A Shrna Trim21, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/a+biotech+cgaggtgatctcaaagcaata+n+sangon+shrna+trim21/pm42054210-663-120-121
    Average 86 stars, based on 1 article reviews
    cgaggtgatctcaaagcaata sangon biotech n a shrna trim21 - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc anti trim21
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Anti Trim21, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/pmc13047273-317-6-7
    Average 86 stars, based on 1 article reviews
    anti trim21 - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    96
    Proteintech anti trim21
    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged <t>TRIM21</t> (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.
    Anti Trim21, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/TRIM21+Antibody/pmc13047273-317-12-13
    Average 96 stars, based on 1 article reviews
    anti trim21 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    94
    Cell Signaling Technology Inc trim21 antibody
    High expression of tripartite motif-containing protein 21 <t>(TRIM21)</t> in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Trim21 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/TRIM21+Rabbit+mAb/pmc13047273-287-9-11
    Average 94 stars, based on 1 article reviews
    trim21 antibody - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    94
    MedChemExpress constipation mouse model
    High expression of tripartite motif-containing protein 21 <t>(TRIM21)</t> in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.
    Constipation Mouse Model, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trim21/TRIM21%2C+Mouse/pm41913080-49-4-17
    Average 94 stars, based on 1 article reviews
    constipation mouse model - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    Image Search Results


    a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged TRIM21 (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.

    Journal: PLOS Pathogens

    Article Title: SARS-CoV-2 Nsp1 suppresses the canonical NF-κB pathway by promoting ubiquitin-dependent degradation of TAK1 kinase

    doi: 10.1371/journal.ppat.1014191

    Figure Lengend Snippet: a : HEK293T cells were transfected with plasmids expressing FLAG-tagged TAK1 (TAK1-FLAG) and wild-type (WT) or mutant (K48R/K63R) HA-Ub, and 24 h later, were transfected again with a plasmid expressing cMYC-tagged TRIM21 (cMYC-TRIM21) or GFP (GFP-cMYC, Ctrl). Ubiquitinated TAK1 was immunoprecipitated (IP) by anti-FLAG magnetic beads, and the ubiquitination level was analyzed by an anti-HA antibody. GFP (green arrowhead) and TRIM21 (red arrowhead) were detected by anti-cMYC and anti-TAK1 with anti-FLAG antibodies in a-b . The relative signals of HA-Ub and TAK1-FLAG quantified by ImageJ are shown in the right panels in a & e . b : Plasmids expressing cMYC-tagged full-length (FL) or truncated TRIM21 mutants expressing only SPRY or lacking (Δ) the SPRY domain were constructed (left panel). SPRY, SPla and the RYanodine Receptor domain. HEK293T cells were cotransfected with plasmids expressing TAK1-FLAG and FL or truncated cMYC-TRIM21 or GFP. Immunoprecipitation (IP) was performed using anti-cMYC magnetic beads (right panel). c : HEK293T cells were cotransfected with plasmids expressing cMYC-TRIM21 and FLAG-tagged full-length (FL) or truncated N-terminal (1-303 aa, N) or C-terminal (304-606 aa, C) TAK1 mutants. FLAG-tagged GFP (green arrowhead) and TAK1 (blue arrowhead) were detected with an anti-FLAG antibody. d : HEK293T cells were transfected with plasmids expressing HA-tagged TAK1 and cMYC-TRIM21 24 h later and transfected with a plasmid expressing FLAG-tagged Nsp1 (red arrowheads) or a GFP control (Ctrl, green arrowhead). Immunoprecipitation (IP) was performed using anti-HA magnetic beads. The relative signals of cMYC-TRIM21 and TAK1-HA quantified using ImageJ are shown in the right panel. e : HEK293T cells were transfected with a lentiviral vector encoding shRNA targeting TRIM21 (shTRIM21) or luciferase (shLuc) as a control. After puromycin (10 μg/mL) selection for 72 hr, the cells were transfected with an HA-Ub plasmid, and 24 hr later, transfected with an Nsp-cMYC (red arrowheads) or a GFP-cMYC plasmid (Ctrl, green arrowheads). The results in a , d and e are representative of two independent experiments.

    Article Snippet: Nsp1 binding kinetics against TAK1 (SinoBiological, #M15-13G) or TRIM21 (MCE, #HY- P71791 ) were measured by surface plasmon resonance (SPR) on a BIAcore 8K+ (Cytiva).

    Techniques: Transfection, Expressing, Mutagenesis, Plasmid Preparation, Immunoprecipitation, Magnetic Beads, Ubiquitin Proteomics, Construct, Control, shRNA, Luciferase, Selection

    In uninfected cells (left), TAB1 binds to TAK1, and the TAK1-TAB1 complex phosphorylates downstream regulators, including IκBα, p38, and Erk, which in turn activate the downstream NF-κB, MAPK and AP-1 pathways. In SARS-CoV-2-infected cells (right), Nsp1 binds to TAK1 at the N-terminal TAB1-binding domain, preventing the formation of the TAK1-TAB1 complex and promoting the binding of TRIM21 to the C-terminus of TAK1. As a result, Nsp1 promotes the proteasomal degradation of TAK1 by enhancing the TRIM21-dependent K48-linked polyubiquitination (Ub) of TAK1, thereby attenuating the activity of the NF-κB and AP-1 pathways. Created in BioRender. Yang, Q. (2026) https://BioRender.com/41xkykd .

    Journal: PLOS Pathogens

    Article Title: SARS-CoV-2 Nsp1 suppresses the canonical NF-κB pathway by promoting ubiquitin-dependent degradation of TAK1 kinase

    doi: 10.1371/journal.ppat.1014191

    Figure Lengend Snippet: In uninfected cells (left), TAB1 binds to TAK1, and the TAK1-TAB1 complex phosphorylates downstream regulators, including IκBα, p38, and Erk, which in turn activate the downstream NF-κB, MAPK and AP-1 pathways. In SARS-CoV-2-infected cells (right), Nsp1 binds to TAK1 at the N-terminal TAB1-binding domain, preventing the formation of the TAK1-TAB1 complex and promoting the binding of TRIM21 to the C-terminus of TAK1. As a result, Nsp1 promotes the proteasomal degradation of TAK1 by enhancing the TRIM21-dependent K48-linked polyubiquitination (Ub) of TAK1, thereby attenuating the activity of the NF-κB and AP-1 pathways. Created in BioRender. Yang, Q. (2026) https://BioRender.com/41xkykd .

    Article Snippet: Nsp1 binding kinetics against TAK1 (SinoBiological, #M15-13G) or TRIM21 (MCE, #HY- P71791 ) were measured by surface plasmon resonance (SPR) on a BIAcore 8K+ (Cytiva).

    Techniques: Infection, Binding Assay, Activity Assay

    High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: High expression of tripartite motif-containing protein 21 (TRIM21) in ovarian granulosa cells (GCs) of polycystic ovary syndrome (PCOS) mice. (A) Schematic illustration showing the induction of PCOS by prenatal anti-Müllerian hormone (PAMH) treatment. (B) Estrous cycle of adult female mice for 21 consecutive days ( n = 5). (C and D) Glucose tolerance test and insulin tolerance test after 16 h of fasting and 4 h of fasting in adult female mice ( n = 5). (E) Anogenital distance in adult female mice ( n = 15). (F) Number of pups per birth ( n = 10). (G and H) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (I) Hematoxylin and eosin (H&E) staining of ovaries showing primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (J and K) Volcano plots showing differentially expressed proteins and genes in the ovaries of control and PAMH F 1 mice (up-regulated, red; down-regulated, blue; n = 3). (L) Up-regulated proteins and genes determined by proteomic and transcriptomic analysis. (M and N) Western blot (WB) and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 in mouse ovarian tissues. (O and P) WB and RT-PCR analysis of TRIM21 in mouse GCs. (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (C and D) was determined by 2-way ANOVA and multiple comparison test. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Expressing, Staining, Control, Western Blot, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Comparison

    Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) is associated with fatty acid oxidation (FAO) in ovarian granulosa cells. (A) Volcano plot for the significant ( P < 0.05) alterations in protein expression induced by TRIM21 knockdown ( n = 3). (B) Heatmap plot showing differentially expressed proteins ( n = 3). (C) Gene Ontology (GO) enrichment analysis of the proteomic sequencing. (D and E) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, adenosine triphosphate (ATP) production, and coupling efficiency ( n = 6). (F) Evaluation of the glycolysis function by extracellular acidification rate (ECAR) in KGN cells ( n = 3). (G and H) Evaluation of FAO-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) transmission electron microscopy (TEM) analysis of mitochondrial morphology in KGN cell. Green arrows indicate normal mitochondria, and red arrows indicate abnormal mitochondria ( n = 5; scale bars, 2 μm). (J) Representative images for JC-1 ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (K) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities in KGN cells. (L) Activity of mitochondrial complexes I to V in KGN cells ( n = 6). (M) Western blot (WB) analysis of OXPHOS subunits (complex I-NDUFB8, complex II-SDHB, complex III-UQCRC2, complex IV-MTCO1, and complex V-ATP5A1) of KGN cells. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Expressing, Knockdown, Sequencing, Phospho-proteomics, Transmission Assay, Electron Microscopy, Fluorescence, Activity Assay, Western Blot

    Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) regulates fatty acid oxidation in granulosa cells through carnitine palmitoyltransferase 1A (CPT1A). (A) CPT1A was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and proteomic sequencing. (B) Western blot (WB) analysis of KGN cell lysates immunoprecipitated with TRIM21 or CPT1A antibodies. (C and D) Coimmunoprecipitation (Co-IP) and WB analysis of exogenous TRIM21 and CPT1A in KGN cells overexpressing Myc-TRIM21 and Flag- CPT1A. (E) Immunofluorescence staining ofTRIM21 and CPT1A by confocal microscopy (scale bar, 10 μm) in KGN cells. (F) Molecular docking of TRIM21 and CPT1A. (G) Microscale thermophoresis of TRIM21 and CPT1A. (H to J) WB analysis of CPT1A with TRIM21 silencing or overexpression in KGN cells. (K) WB analysis of ATP5A1 with CPT1A silencing, with or without TRIM21 knockdown in KGN cells. (L) WB analysis of ATP5A1 in cells with etomoxir, with or without TRIM21 knockdown in KGN cells. (M and N) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR), including basal respiration and maximum respiration ( n = 6). (O) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) in oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (P) Representative images for lipid content in oocytes by ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. Data are expressed as means ± standard error of the mean (SEM). ns, not significant; **** P < 0.0001. IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Sequencing, Western Blot, Co-Immunoprecipitation Assay, Immunofluorescence, Staining, Confocal Microscopy, Microscale Thermophoresis, Over Expression, Knockdown, Phospho-proteomics, Fluorescence

    Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: Tripartite motif-containing protein 21 (TRIM21) facilitates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) at lysine 161. (A) Reverse transcription polymerase chain reaction (RT-PCR) analysis of CPT1A with or without TRIM21 knockdown of KGN and COV434 cells ( n = 5). (B) Western blot (WB) analysis of CPT1A with TRIM21 overexpression in the presence of MG132 in KGN cells. (C) WB analysis of CPT1A in KGN cells treated with cycloheximide (CHX) and MG132 at different time points. (D) WB analysis of CPT1A in cells with or without TRIM21 silencing in CHX-chase experiment in KGN cells. (E and F) In KGN cells, coimmunoprecipitation (Co-IP) and WB analysis of CPT1A exogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (G and H) In KGN cells, Co-IP and WB analysis of CPT1A endogenous ubiquitination with TRIM21 knockdown or overexpression in the presence of MG132 (10 μM, 4 h). (I and J) In KGN cells, Co-IP and WB analysis of exogenous ubiquitination of CPT1A treated with Flag-CPT1A and HA-UB (wild type [WT], K48-only, and K63-only) in the presence of MG132 (10 μM, 4 h). (K and L) Analysis of ubiquitination modification sites of CPT1A by immunoprecipitation-mass spectrometry (IP-MS). (M and N) In KGN cells, Co-IP and WB of exogenous ubiquitination of CPT1A treated with Flag-CPT1A mutant plasmids in the presence of MG132 (10 μM, 4 h). Data are expressed as means ± SD. IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Ubiquitin Proteomics, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Knockdown, Western Blot, Over Expression, Co-Immunoprecipitation Assay, Modification, Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Mutagenesis

    UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: UBE2M promotes tripartite motif-containing protein 21 (TRIM21) neddylation and its interaction with carnitine palmitoyltransferase 1A (CPT1A). (A) UBE2M was identified as a protein with high confidence interacting with TRIM21 by immunoprecipitation-mass spectrometry (IP-MS) and functional analysis. (B) Molecular docking of UBE2M and TRIM21. (C and D) Coimmunoprecipitation (Co-IP) and Western blot (WB) analysis of exogenous UBE2M and TRIM21 in KGN cells overexpressing Flag-UBE2M and MYC-TRIM21. (E) Immunofluorescence staining of UBE2M and TRIM21 by confocal microscopy in KGN cells (scale bar, 20 μm). (F) WB analysis of TRIM21 and neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) with UBE2M knockdown in KGN cells. (G) WB analysis of KGN cell lysates immunoprecipitated with immunoglobulin G (IgG) and anti-NEDD8 antibodies. (H) Immunofluorescence staining of TRIM21 and NEDD8 by confocal microscopy in KGN cells (scale bar, 20 μm). (I) WB analysis of TRIM21 in KGN cells overexpressing UBE2M with or without NEDD8 knockdown. (J) Co-IP and WB analysis of TRIM21 neddylation with or without UBE2M knockdown in KGN cells. (K) WB analysis of CPT1A in KGN cells treated with different concentrations of FLAG-UBE2M. (L) WB analysis of CPT1A treated with UBE2M silencing, with or without TRIM21 knockdown in KGN cells. (M) Co-IP and WB analysis of KGN cell lysates immunoprecipitated with anti-MYC antibody in the presence of UBE2M knockdown. (N) In KGN cells, Co-IP and WB analysis of TRIM21 neddylation, CPT1A and ATP5A1 with UBE2M silencing, with or without NEDD8 knockdown. (O) In KGN cells, WB analysis of K48 ubiquitination of CPT1A in cells with UBE2M overexpression, with or without TRIM21 knockdown in the presence of MG132 (10 μM, 4 h) treatment. (P) In KGN cells, Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells with UBE2M overexpression, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Functional Assay, Co-Immunoprecipitation Assay, Western Blot, Immunofluorescence, Staining, Confocal Microscopy, Knockdown, Ubiquitin Proteomics, Over Expression

    MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: MLN4924 reverses the ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) by tripartite motif-containing protein 21 (TRIM21) and ameliorates the phenotype of polycystic ovary syndrome (PCOS) mice. (A) Western blot (WB) analysis of neural precursor cell-expressed developmentally down-regulated 8 (NEDD8) and CPT1A treated with MLN4924, with or without TRIM21 knockdown in KGN cell. (B and C) Coimmunoprecipitation (Co-IP) and WB analysis of TRIM21 neddylation in KGN cells treated with or without MLN4924. (D) Co-IP and WB analysis of exogenous K48 ubiquitination of CPT1A in KGN cells overexpressing UBE2M, with or without NEDD8 knockdown in the presence of MG132 (10 μM, 4 h). (E and F) Evaluation of the mitochondrial oxidative phosphorylation (OXPHOS) function by oxygen consumption rate (OCR) in KGN cells, including basal respiration, maximum respiration, ATP generation, and coupling efficiency ( n = 6). (G and H) Evaluation of fatty acid oxidation (FAO)-dependent mitochondrial function by OCR in KGN cells, including basal respiration and maximum respiration ( n = 6). (I) Activity of mitochondrial complex V in KGN cells ( n = 6). (J and K) Testosterone and luteinizing hormone (LH) levels of serum ( n = 15). (L) Anogenital distance in adult female mice ( n = 15). (M) Insulin tolerance test (ITT) test in adult female mice after 4 h of fasting ( n = 5). (N) Number of pups per birth ( n = 10). (O and P) WB and reverse transcription polymerase chain reaction (RT-PCR) analysis of TRIM21 and CPT1A in ovarian granulosa cells (GCs). (Q) Immunohistochemical staining of TRIM21 in mouse ovarian tissues (scale bars, 100 μm). Data are expressed as means ± standard error of the mean (SEM), and each symbol represents a biologically independent mouse. Significance was calculated by 1-way analysis of variance (ANOVA) multiple comparison test. Blood glucose analysis between groups (M) was determined by 2-way ANOVA and multiple comparison test. ns, not significant; ** P < 0.01; *** P < 0.001; **** P < 0.0001. IB, immunoblot.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Ubiquitin Proteomics, Western Blot, Knockdown, Co-Immunoprecipitation Assay, Phospho-proteomics, Activity Assay, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Immunohistochemical staining, Staining, Comparison

    MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Journal: Research

    Article Title: Inhibiting TRIM21 Neddylation Rejuvenates Oocyte Quality in PCOS by Regulating Ubiquitination of CPT1A

    doi: 10.34133/research.1223

    Figure Lengend Snippet: MLN4924 improves the quality of oocytes of polycystic ovary syndrome (PCOS) mice. (A) Hematoxylin and eosin (H&E) staining of ovaries and the number of follicles in ovary including primordial follicles (*), growing follicles (#), and atretic follicles (arrows; scale bars, 100 μm). (B) Number of oocytes after superovulation ( n = 5 mice; scale bars, 100 μm). (C) Representative images and percentage of first polar body extrusion in mouse oocytes, fertilization rate, and blastocyst maturation rate ( n = 5 mice; scale bars, 100 μm). (D) Transmission electron microscopy (TEM) analysis of mitochondrial morphology of mouse ovarian granulosa cells. Green arrows indicate normal mitochondria, red arrows indicate abnormal mitochondria, and # indicates lipid droplets ( n = 5 mice; scale bar, 500 nm). (E) Representative images of spindle morphology and chromosome alignment in oocytes at the metaphase II stage by confocal microscopy ( n = 5 mice; scale bar, 10 μm). The percentage of aberrant spindles and misaligned chromosomes were quantified in oocytes at metaphase II from control ( n = 23), PCOS ( n = 19), and MLN4924 ( n = 21) mice. (F) Representative images for JC-1 staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected (G) Representative images for tetramethylrhodamine ethyl ester perchlorate (TMRE) staining of mouse oocytes ( n = 15; scale bar, 50 μm) and relative fluorescence intensities. Three fields of view of each mouse were selected. (H) Representative images for lipid content in oocytes ( n = 15; scale bar, 50 μm) and ratio of the fluorescence intensities. Three fields of view of each mouse were selected. (I) Reverse transcription polymerase chain reaction (RT-PCR) analysis of mRNA levels of follicle development-related genes in mouse cumulus–oocyte complexes (COCs) ( n = 5). Data are expressed as means ± SD, and each symbol represents a biologically independent mouse. (J) Schematic diagram of the pathway by which tripartite motif-containing protein 21 (TRIM21) regulates ubiquitination of carnitine palmitoyltransferase 1A (CPT1A) leading to abnormal fatty acid oxidation in ovarian granulosa cells. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001.

    Article Snippet: Sections were prepared and underwent immunohistochemical staining using the TRIM21 antibody (Cell Signaling Technology, cat# 92043) and CPT1A antibody (Cell Signaling Technology, cat# 97361), according to the standard procedures of the immunohistochemistry kit (KeyGEN, cat# KGC3201-300).

    Techniques: Staining, Transmission Assay, Electron Microscopy, Confocal Microscopy, Control, Fluorescence, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Ubiquitin Proteomics