gene exp hprt1 hs02800695 m1 (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
gene exp hprt1 hs02800695 m1
Gene Exp Hprt1 Hs02800695 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transcriptome+sequencing+experiment/Gene+Exp%2E+HPRT1%2C+Hs02800695_m1/pmc04924995-238-50-27
Average 99 stars, based on 1 article reviews
Gene Exp Hprt1 Hs02800695 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/transcriptome+sequencing+experiment/Gene+Exp%2E+HPRT1%2C+Hs02800695_m1/pmc04924995-238-50-27
Average 99 stars, based on 1 article reviews
gene exp hprt1 hs02800695 m1 - by Bioz Stars,
2026-10
99/100 stars
Images
1) Product Images from "Functional CRISPR screening identifies the ufmylation pathway as a regulator of SQSTM1/p62"
Article Title: Functional CRISPR screening identifies the ufmylation pathway as a regulator of SQSTM1/p62
Journal: eLife
doi: 10.7554/eLife.17290
Figure Legend Snippet: ( A ) Scramble, ATG7 and UFM1 sgRNAs were introduced into H4 Cas9 clone 4 by lentiviral infection. 7 days post-infection cells were treated with 0.1% DMSO or 50 nM Bafilomycin A1 for 2, 4 or 8 hr and protein lysates were collected and probed by immunoblot. ( B ) Representative images of H4 cells stably expressing mCherry-GFP-LC3B or mCherry-GFP-UFM1. Scale bar corresponds to 20 µm. Note that the absence of mCherry-positive puncta in mCherry-GFP-UFM1 expressing cells suggests that UFM1 is not delivered to endolysosomal compartments. ( C ) GFP-SQSTM1 clearance in ATG7- and UFM1-depleted cells. Scramble, ATG7 and UFM1 sgRNAs were introduced into H4 Cas9 GFP-SQSTM1 cells by lentiviral infection. 7 days post-infection cells were treated with 0.1% DMSO or 0.5 µM AZD8055 for 8 hr or 24 hr, fixed, and subjected to high content imaging. GFP fluorescence was quantified as ratio of GFP-SQSTM1 puncta area in DMSO- versus AZD8055-treated cells and is shown as mean +/- SD from three independent experiments. Statistical significance was assessed via a two-tailed paired t-test (*p<0.05, **p<0.01). ( D ) UFM1 knockout induces ER stress and increases SQSTM1 mRNA levels. Scramble and UFM1 sgRNAs were introduced into H4 Cas9 cells by lentiviral infection. 7 days post-infection total RNA was extracted and subjected to RNA sequencing. The volcano plot visualizes genes differentially expressed in UFM1-depleted versus cells infected with a scramble sgRNA. Selected ER stress markers and SQSTM1 are highlighted and entire dataset is reported in . ( E ) Time course analysis of ER stress and SQSTM1 induction. Indicated sgRNAs were introduced into H4 Cas9 cells by lentiviral infection, protein lysates collected 4, 6 and 8 days post-infection and probed by immunoblot. ( F ) Total RNA was collected from H4 Cas9 cells treated with 0.1% DMSO or 10 µg/ml tunicamycin for 24 hr, SQSTM1 mRNA was quantified by RT-qPCR analysis and normalized to HPRT1. The mean +/- SD of biological triplicates is shown. ( G ) Indicated sgRNAs were introduced into Huh-1 Cas9 or HepG2 Cas9 cells by lentiviral infection, protein lysates collected 7 days post-infection and probed by immunoblot. DOI: http://dx.doi.org/10.7554/eLife.17290.010 10.7554/eLife.17290.011 Figure 4—source data 1. Fold change and significance of differentially regulated genes by RNA sequencing in UFM1-depleted versus scramble sgRNA-infected cells. DOI: http://dx.doi.org/10.7554/eLife.17290.011
Techniques Used: Infection, Western Blot, Stable Transfection, Expressing, Imaging, Fluorescence, Two Tailed Test, Knock-Out, RNA Sequencing, Quantitative RT-PCR
Related Articles
other:Article Title: Functional analysis of the human miRNome in non-small cell lung cancer unveils a novel miR-92b-3p/NOTCH3 axis that drives tumor progression. Article Snippet: Data were normalized using ESD1 (Hs00382667_m1), GUSB (Hs99999908_m1) and HPRT (Hs02800695_m1) as reference genes. Article Title: Comparison studies between Cesium-137 and X-ray irradiators in epithelial injury using in vitro and in vivo models Article Snippet: Commercially available TaqMan primers detecting mouse ChgA (Mm00514341-FAM), Alpi1 (Mm01285814-FAM), Olfm4 (Mm01320260-FAM), Cdkn1a (Mm00432448-FAM), Lgr5 (Mm00438890-FAM), Mki67 (Mm01278617-FAM), Actb (Mm04394036-VIC) and human CDKN1A (Hs00355782-FAM), KLF4 (Hs00358836-FAM), KLF5 (Hs0000000-FAM), BCL2 (Hs01048932-FAM), BAX (Hs00180269-FAM) and HPRT1 (Hs02800695-VIC) transcripts were used. Isolation:Article Title: Linkage modified oligomeric compounds and uses thereof Article Snippet: .. RNA was isolated and RNA expression was analyzed via RT-qPCR using primer probe set Hs02800695_m1(ThennoFisher). .. RNA Expression:Article Title: Linkage modified oligomeric compounds and uses thereof Article Snippet: .. RNA was isolated and RNA expression was analyzed via RT-qPCR using primer probe set Hs02800695_m1(ThennoFisher). .. Quantitative RT-PCR:Article Title: Linkage modified oligomeric compounds and uses thereof Article Snippet: .. RNA was isolated and RNA expression was analyzed via RT-qPCR using primer probe set Hs02800695_m1(ThennoFisher). .. Synthesized:Article Title: Quemliclustat and chemotherapy with or without zimberelimab in metastatic pancreatic adenocarcinoma: a randomized phase 1 trial Article Snippet: Cells were incubated in the presence of AMP (Thermo Fisher Scientific, J61643.06) and EHNA (Sigma-Aldrich, 324630) or NECA (Sigma-Aldrich, E2387) for 6 hours before RNA extraction. .. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific, 18-091-050), and real-time PCR was carried out using TaqMan (Thermo Fisher Scientific) assays NR4A1 (Hs00374226_m1; cat. no. 4331182), NR4A2 (Hs01117527_g1; cat. no. 4331182), NR4A3 (Hs00545009_g1; cat. no. 4331182), HPRT1 ( Real-time Polymerase Chain Reaction:Article Title: Quemliclustat and chemotherapy with or without zimberelimab in metastatic pancreatic adenocarcinoma: a randomized phase 1 trial Article Snippet: Cells were incubated in the presence of AMP (Thermo Fisher Scientific, J61643.06) and EHNA (Sigma-Aldrich, 324630) or NECA (Sigma-Aldrich, E2387) for 6 hours before RNA extraction. .. Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific, 18-091-050), and real-time PCR was carried out using TaqMan (Thermo Fisher Scientific) assays NR4A1 (Hs00374226_m1; cat. no. 4331182), NR4A2 (Hs01117527_g1; cat. no. 4331182), NR4A3 (Hs00545009_g1; cat. no. 4331182), HPRT1 ( Article Title: CCL17 drives the expression of MMP9 and MMP13 expression via ERK1/2 and NF-κB signaling pathways in rheumatoid arthritis. Article Snippet: Total RNA was extracted using the ISOLATE II RNA Mini Kit (Bioline, London, UK) and reverse transcribed using Tetro reverse transcriptase (Bioline). .. Quantitative PCR (qPCR) was performed using the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA) and pre-developed TaqMan probe/primer combinations for human MMP2 (Hs01548727_m1), MMP3 (Hs00968305_m1), MMP9 (Hs00957562_m1), MMP13 (Hs00942584_m1) and HPRT1 ( Expressing:Article Title: Cell-specific DNA methylation in human alpha and beta cells regulates gene expression in type 2 diabetes Article Snippet: TaqMan assays were used to measure expression levels of human ADCY9 (Hs00181599_m1), human FBLL1 (Hs01584505_s1), ZNF431 (Hs00819968_m1), human ZSWIM9 (Hs00736775_m1), human ONECUT2 (Hs00191477_m1), human RHOT1 (Hs00430256_m1), human SNX1 (Hs00162052_m1), human TRAPPC13 (Hs01556088_m1), human GNAL (Hs00181836_m1), rat Adcy9 (Rn01424753_m1), rat Fbll1 (Rn06322963_s1), rat Zswim9 (Rn01753793_m1), rat Onecut2 (Rn01265320_m1), rat Snx1 (Rn01418446_m1), rat Trappc13 (Rn01493919_m1), rat Gnal (Rn01491898_m1) and rat Ins1 (Rn02121433_g1). .. Human PPIA (Hs04194521_s1) and human HPRT1 ( Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 ( Article Title: Cell-specific DNA methylation in human alpha and beta cells regulates gene expression in type 2 diabetes. Article Snippet: TaqMan assays were used to measure expression levels of human ADCY9 (Hs00181599_ m1), human FBLL1 (Hs01584505_s1), ZNF431 (Hs00819968_m1), human ZSWIM9 (Hs00736775_m1), human ONECUT2 (Hs00191477_m1), human RHOT1 (Hs00430256_m1), human SNX1 (Hs00162052_m1), human TRAPPC13 (Hs01556088_m1), human GNAL (Hs00181836_m1), rat Adcy9 (Rn01424753_m1), rat Fbll1 (Rn06322963_s1), rat Zswim9 (Rn01753793_ m1), rat Onecut2 (Rn01265320_m1), rat Snx1 (Rn01418446_m1), rat Trappc13 (Rn01493919_m1), rat Gnal (Rn01491898_m1) and rat Ins1 (Rn02121433_g1). .. Human PPIA (Hs04194521_s1) and human HPRT1 ( Gene Expression:Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 ( Reverse Transcription:Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 ( Polymerase Chain Reaction:Article Title: Beyond the interferon score: neurofilament light chain and glial fibrillary acidic protein capture immune-mediated neuroinjury and response to JAK inhibition in Aicardi–Goutières syndrome Article Snippet: RNA was reverse-transcribed using the GoScript Reverse Transcription System (Promega). .. Gene expression was determined by quantitative real-time reverse transcription (RT)-PCR using the TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI7300 and normalized to GAPDH (forward: GAAGGTGAAGGTCGGAGTC; reverse: GAAGATGGTGATGGGATTTC) and hypoxanthine phosphoribosyltransferase 1 ( |