Review



slc9a3r1  (Atlas Antibodies)


Bioz Verified Symbol Atlas Antibodies is a verified supplier
Bioz Manufacturer Symbol Atlas Antibodies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Atlas Antibodies slc9a3r1
    A) Global Kaplan-Meier analysis summarize univariate analysis for 22278 genes included in the Affymetrix microarray platform. Hazard Ratios are plotted in the X axis B) <t>SLC9A3R1</t> RNA levels pre- and post- short-term aromatase inhibitor treatment in responder and non-responder patients 61 . Oestrogen-dependent expression of progesterone receptor mRNA is shown as comparison C) Silencing SLC9A3R1 leads to proliferation arrest in response to estrogen stimulation in MCF7 and estrogen independent growth in LTED cells. Proliferation assays were conducted in biological triplicate. Symbol and error bars indicate average and 95% confidence intervals. Asterisks represent significance at P<0.05, 0.01, 0.001 and 0.0001 after two-way ANOVA with Bonferroni’s correction D) RIs for the SLC9A3R1 enhancer within all the individual patients included in the current study. SLC9A3R1 enhancer location and its 3D interactions are shown in the top right inset E) SLC9A3R1 enhancer ranking analysis of available Epigenome Roadmap H3K27ac datasets. Tissues are displayed from the strongest to the weakest SLC9A3R1 enhancer activity (based on RI). Representative IHC analysis of normal tissues stained with a SLC9A3R1 antibody are shown (Scale bars, 50 μm). F-G) YY1 and SLC9A3R1 IHC analysis of BC patients profiled using H3K27ac ChIP-seq. Predicted activity (RI) of YY and SLC9A3R1 enhancers is shown on the X axis. The number of cells positively stained for YY1 and SLC9A3R1 protein is indicated on the Y axis. Representative images are shown in the inbox. We stained one slide for each patient. Linear regression R square, confidence intervals and representative staining are also shown.
    Slc9a3r1, supplied by Atlas Antibodies, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tissue+microarray+based+immunohistochemistry+analysis/Anti-SLC9A3R1/pmc06130800-268-1-5
    Average 91 stars, based on 3 article reviews
    slc9a3r1 - by Bioz Stars, 2026-10
    91/100 stars

    Images

    1) Product Images from "Enhancer mapping uncovers phenotypic heterogeneity and evolution in patients with luminal breast cancer"

    Article Title: Enhancer mapping uncovers phenotypic heterogeneity and evolution in patients with luminal breast cancer

    Journal: Nature medicine

    doi: 10.1038/s41591-018-0091-x

    A) Global Kaplan-Meier analysis summarize univariate analysis for 22278 genes included in the Affymetrix microarray platform. Hazard Ratios are plotted in the X axis B) SLC9A3R1 RNA levels pre- and post- short-term aromatase inhibitor treatment in responder and non-responder patients 61 . Oestrogen-dependent expression of progesterone receptor mRNA is shown as comparison C) Silencing SLC9A3R1 leads to proliferation arrest in response to estrogen stimulation in MCF7 and estrogen independent growth in LTED cells. Proliferation assays were conducted in biological triplicate. Symbol and error bars indicate average and 95% confidence intervals. Asterisks represent significance at P<0.05, 0.01, 0.001 and 0.0001 after two-way ANOVA with Bonferroni’s correction D) RIs for the SLC9A3R1 enhancer within all the individual patients included in the current study. SLC9A3R1 enhancer location and its 3D interactions are shown in the top right inset E) SLC9A3R1 enhancer ranking analysis of available Epigenome Roadmap H3K27ac datasets. Tissues are displayed from the strongest to the weakest SLC9A3R1 enhancer activity (based on RI). Representative IHC analysis of normal tissues stained with a SLC9A3R1 antibody are shown (Scale bars, 50 μm). F-G) YY1 and SLC9A3R1 IHC analysis of BC patients profiled using H3K27ac ChIP-seq. Predicted activity (RI) of YY and SLC9A3R1 enhancers is shown on the X axis. The number of cells positively stained for YY1 and SLC9A3R1 protein is indicated on the Y axis. Representative images are shown in the inbox. We stained one slide for each patient. Linear regression R square, confidence intervals and representative staining are also shown.
    Figure Legend Snippet: A) Global Kaplan-Meier analysis summarize univariate analysis for 22278 genes included in the Affymetrix microarray platform. Hazard Ratios are plotted in the X axis B) SLC9A3R1 RNA levels pre- and post- short-term aromatase inhibitor treatment in responder and non-responder patients 61 . Oestrogen-dependent expression of progesterone receptor mRNA is shown as comparison C) Silencing SLC9A3R1 leads to proliferation arrest in response to estrogen stimulation in MCF7 and estrogen independent growth in LTED cells. Proliferation assays were conducted in biological triplicate. Symbol and error bars indicate average and 95% confidence intervals. Asterisks represent significance at P<0.05, 0.01, 0.001 and 0.0001 after two-way ANOVA with Bonferroni’s correction D) RIs for the SLC9A3R1 enhancer within all the individual patients included in the current study. SLC9A3R1 enhancer location and its 3D interactions are shown in the top right inset E) SLC9A3R1 enhancer ranking analysis of available Epigenome Roadmap H3K27ac datasets. Tissues are displayed from the strongest to the weakest SLC9A3R1 enhancer activity (based on RI). Representative IHC analysis of normal tissues stained with a SLC9A3R1 antibody are shown (Scale bars, 50 μm). F-G) YY1 and SLC9A3R1 IHC analysis of BC patients profiled using H3K27ac ChIP-seq. Predicted activity (RI) of YY and SLC9A3R1 enhancers is shown on the X axis. The number of cells positively stained for YY1 and SLC9A3R1 protein is indicated on the Y axis. Representative images are shown in the inbox. We stained one slide for each patient. Linear regression R square, confidence intervals and representative staining are also shown.

    Techniques Used: Microarray, Expressing, Comparison, Activity Assay, Staining, ChIP-sequencing

    A) Theoretical framework of the analysis. The relative size of phenotypic clones can be tracked using enhancer ranking (RIs). Phenotypic clones can be positively or negatively selected during BC progression in response to endocrine therapies. B) Expanding or contracting phenotypic clones were defined based on the RI-ratio in primary and metastatic samples (RI P /RI M ). Distribution of RI-ratio shows that YY1 enhancers RI does not change significantly during progression compared to other enhancers, while SLC9A3R1 RI ranks among the enhancers with stronger increase in activity during progression. Vertical bars represent 1σ (Standard Deviation) increments from the population median C) Scatterplot of YY1 and SLC9A3R1 enhancer ranking according to patient stage. Bars indicate mean and 95% confidence intervals. Asterisks represent significance at P<0.05 after students two-tail T-Test D) IHC staining for YY1 and SLC9A3R1 positive cells in an independent matched longitudinal cohort of 22 ERα breast cancer patients (Scale bars, 100 μm). All normal and primaries are treatment naïve. All metastatic have received endocrine therapies (Tamoxifen or Aromatase inhibitors). Statistical significance was calculated using a pair-wise, two-tail T-test. Representative images are also shown E) Enhancer and promoter stratification based on frequency of usage in primary and metastatic patients. Percentages were calculated for each regulatory region for each stage (primary and metastatic) and differential was then derived and plotted on the X-axis. All enhancers and promoters called in were used. PE and ME were called by taking the top 1/1000 in the distribution that also satisfied a Fisher-exact test p<0.05. F) Dot-plot represent RI indexes for all PE (324) and ME (301) are plotted. As a control, RI for common enhancers (CE=320) were also plotted. Bottom plot: permutation was used to assess changes in RI in 50 randomly selected sets of 320 CE. Bow and whiskers represent median and 1-99 percentile for P-Value distribution. A Wilcoxon matched-pairs signed rank test was used to test for statistical significance G) Kaplan-Meier analysis using 1427 ERα-positive patients and averaged RNA expression of genes associated with PE or ME regulatory regions. Confidence interval for PE (0.39-0.61). Confidence interval for ME (1.1-1.67). Comparison of survival curves was performed using a Log-rank (Mantel-Cox) test. Genes were assigned considering CTCF insulated perimeters. Multivariate correction for the comparisons is also shown H) Pathway analysis for genes associated with PE or ME regulatory regions. Pathways were identified using GREAT and are listed in order of significance (symbols indicate qValue).
    Figure Legend Snippet: A) Theoretical framework of the analysis. The relative size of phenotypic clones can be tracked using enhancer ranking (RIs). Phenotypic clones can be positively or negatively selected during BC progression in response to endocrine therapies. B) Expanding or contracting phenotypic clones were defined based on the RI-ratio in primary and metastatic samples (RI P /RI M ). Distribution of RI-ratio shows that YY1 enhancers RI does not change significantly during progression compared to other enhancers, while SLC9A3R1 RI ranks among the enhancers with stronger increase in activity during progression. Vertical bars represent 1σ (Standard Deviation) increments from the population median C) Scatterplot of YY1 and SLC9A3R1 enhancer ranking according to patient stage. Bars indicate mean and 95% confidence intervals. Asterisks represent significance at P<0.05 after students two-tail T-Test D) IHC staining for YY1 and SLC9A3R1 positive cells in an independent matched longitudinal cohort of 22 ERα breast cancer patients (Scale bars, 100 μm). All normal and primaries are treatment naïve. All metastatic have received endocrine therapies (Tamoxifen or Aromatase inhibitors). Statistical significance was calculated using a pair-wise, two-tail T-test. Representative images are also shown E) Enhancer and promoter stratification based on frequency of usage in primary and metastatic patients. Percentages were calculated for each regulatory region for each stage (primary and metastatic) and differential was then derived and plotted on the X-axis. All enhancers and promoters called in were used. PE and ME were called by taking the top 1/1000 in the distribution that also satisfied a Fisher-exact test p<0.05. F) Dot-plot represent RI indexes for all PE (324) and ME (301) are plotted. As a control, RI for common enhancers (CE=320) were also plotted. Bottom plot: permutation was used to assess changes in RI in 50 randomly selected sets of 320 CE. Bow and whiskers represent median and 1-99 percentile for P-Value distribution. A Wilcoxon matched-pairs signed rank test was used to test for statistical significance G) Kaplan-Meier analysis using 1427 ERα-positive patients and averaged RNA expression of genes associated with PE or ME regulatory regions. Confidence interval for PE (0.39-0.61). Confidence interval for ME (1.1-1.67). Comparison of survival curves was performed using a Log-rank (Mantel-Cox) test. Genes were assigned considering CTCF insulated perimeters. Multivariate correction for the comparisons is also shown H) Pathway analysis for genes associated with PE or ME regulatory regions. Pathways were identified using GREAT and are listed in order of significance (symbols indicate qValue).

    Techniques Used: Clone Assay, Activity Assay, Standard Deviation, Immunohistochemistry, Derivative Assay, Control, RNA Expression, Comparison

    Related Articles

    Recombinant:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2

    Polymerase Chain Reaction:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2

    Whole Genome Amplification:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2

    Purification:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2

    cDNA Synthesis:

    Article Title: Multimerization and Retention of the Scavenger Receptor SR-B1 in the Plasma Membrane.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies SR-B1, rabbit monoclonal Abcam Clone: EPI556Y; Cat# ab52629; RRID: AB_882458 b-Actin, mouse monoclonal Sigma-Aldrich Clone: AC-15; Cat# A1978; RRID: AB_476692 Clathrin heavy chain, mouse monoclonal Abcam Clone: X-22; Cat# ab2731; RRID: AB_303256 Caveolin-1, rabbit polyclonal BD Biosciences Cat# 610059; RRID: AB_397471 6His, mouse monoclonal Biolegend Clone: 6-His; Cat# 906101; RRID: AB_2565061 NHERF1, rabbit polyclonal Atlas Antibodies Cat# HPA027247; RRID: AB_10601162 NHERF2, rabbit polyclonal Atlas Antibodies Cat# HPA001672; RRID: AB_1080017 Ezrin, mouse monoclonal Thermo Fisher Clone: 3C12; Cat# MA5-13862; RRID: AB_10979020 Goat anti-rabbit IRDye 680RD LI-COR Cat# 925–68071; RRID: AB_2721181 Donkey anti-mouse IRDye 800CW LI-COR Cat# 925-32212; RRID: AB_2716622 CD81, hamster monoclonal Thermo Fisher Clone: Eat2; Cat# MA180209; RRID: AB_929499 Tfn-R, mouse monoclonal Thermo Fisher Clone: H68.4; Cat# 13-6800; RRID: AB_2533029 Chemicals, Peptides, and Recombinant Proteins Single-chain variable fragment (ScFv) This paper Based on mAb IgG C167 from Catanese et al., 2007 Human transferrin-AF488 Thermo Fisher Cat# T13342 Cholera Toxin B-AF488 Thermo Fisher Cat# C34775 FM 4–64 Thermo Fisher Cat# T13320 Anti GFP-binding protein (VHH, nanobody) Chromotek Cat# gt-250 Methyl-b-cyclodextrin (MbCD) Sigma-Aldrich Cat# C4555 2-bromopalmitate (2-BP) Sigma-Aldrich Cat# 238422 Latrunculin B Sigma-Aldrich Cat# L5288 Human HDL Kalen Biomedical Cat# 770300-4 Human LDL Kalen Biomedical Cat# 770200-4 Nile Red Thermo Fisher Cat# N3013 Ezrin Inhibitor Calbiochem Cat# NSC668394 Triton X-100 Fisher Scientific Cat# BP151-500 DAPI Thermo Fisher Cat# D1306 Hoechst 33258 Thermo Fisher Cat# H21491 Cy3B NHS ester GE Healthcare Cat# PA63101 DyLight 650 NHS ester Thermo Fisher Cat# 62265 Alexa Fluor 488 (AF488) NHS ester Thermo Fisher Cat# A20000 Top-Fluor Cholesterol Avanti Polar Lipids Cat# 810255 Nile Red Sigma-Aldrich Cat# N3013 Acti-Stain 670 Phalloidin Cytoskeleton Cat# PHDN1 ProLong Diamond Antifade mountant Thermo Fisher Cat# P36961 Oligomers ACGT Corporation N/A CloneAmp Hifi PCR premix Takara Cat# 638500 DpnI restriction enzyme New England Biolabs Cat# R0176S 2-mercaptoethanesulfonate (MESNA) Sigma-Aldrich Cat# 63705 Wheat germ agglutinin (WGA)-AF647 Thermo Fisher Cat# W32466 Critical Commercial Assays GeneJet RNA Purification Kit Thermo Fisher Cat# K0731 Superscript VILO cDNA synthesis Kit Thermo Fisher Cat# 11754-010 (Continued on next page) e1 Developmental Cell 50, 1–13.e1–e5, August 5, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine LTX with Plus Reagent Thermo Fisher Cat# 15338100 FuGENE 6 Transfection Reagent Promega Cat# E2691 VIROMER Blue Transfection Reagent Lipocalyx Cat# VB-01LB-00 Taqman Fast Advanced Master Mix Thermo Fisher Cat# 4444557 QIAquick PCR purification kit Qiagen Cat# 28104 In-Fusion HD EcoDry cloning kit Takara Cat# 639690 Pierce Cell Surface Protein Isolation kit Thermo Fisher Cat# 89881 Experimental Models: Cell Lines Human female NCI-H295R ATCC Cat# CRL-2128 Hamster female CHO-K1 ATCC Cat# CCL-61 Human male HepG2 ATCC Cat# HB-8065 Human HAMEC (sex not known) ScienCell Cat# 7200 Human male HDLEC PromoCell Cat# C-12216 Experimental Models: Organisms/Strains Escherichia coli Stellar Competent Cells Clontech Cat# 636763 Oligonucleotides TaqMan gene expression assay total SR-B1 Thermo Fisher Cat# Hs00969821_m1 Custom TaqMan gene expression assay SR-B1 canonical: Forward: actatgcccagtacgtcctcctg; Reverse: ctccaaaataaatagcatttctcttggctccgg Thermo Fisher N/A Custom TaqMan gene expression assay SR-B1.1: Forward: actatgcccagtacgtcctcctg; Reverse: gtcctcaggaccttggctccgga Thermo Fisher N/A TaqMan gene expression assay CD81 Thermo Fisher Cat# Hs01002167_m1 TaqMan gene expression assay CDKN1A Thermo Fisher Cat# Hs00355782_m1 SR-B1 Stealth siRNA Thermo Fisher Cat# HSS101570 CD81 Stealth siRNA Thermo Fisher Cat# HSS101629 Stealth RNAi negative control duplexes Thermo Fisher Cat# 12935300 Recombinant DNA SR-B1-GFP Neculai et al., 2013 N/A SR-B1.1-GFP This paper N/A SR-B1 Neculai et al., 2013 N/A SR-B1.1 This paper N/A GFP-TMC This paper N/A GFP-TMC.1 This paper N/A SR-B1 PALM-/- This paper N/A SR-B1 MYRI-/- This paper N/A SR-B1 L413A This paper N/A SR-B1 L413A/L427A This paper N/A SR-B1 L441A/L448A/L455A This paper N/A SR-B1 G15L/G18L/G25L This paper N/A VapB-mCherry Zewe et al., 2018 Addgene D4H-mCherry Maekawa and Fairn, 2015 N/A Clathrin light chain-GFP Gaidarov et al., 1999 N/A tdEos-SR-B1 This paper N/A Software and Algorithms Volocity Perkin Elmer http://cellularimaging.perkinelmer.com/downloads/ detail.php?id=14 GraphPad Prism GraphPad Software https://www.graphpad.com/scientific-software/ prism/ (Continued on next page) Developmental Cell 50, 1–13.e1–e5, August 5, 2019 e2



    Similar Products

    tissue microarray based immunohistochemistry analysis  (Human Protein Atlas)
    86
    Human Protein Atlas tissue microarray based immunohistochemistry analysis
    Cell type specific genes demonstrated at mRNA level. (A) Heat map of genes with cell type specific expression. (B) Heat map of selected genes with endothelial or epithelial cell type specific expression. (C) <t>Immunohistochemistry</t> staining of protein C1orf116 across human tissues showing its epithelial cell type specific expression. The panel shows a magnified view (20×) from tissue microarrays.
    Tissue Microarray Based Immunohistochemistry Analysis, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tissue+microarray+based+immunohistochemistry+analysis/data+microarray+tissue/pmc12802902-14-17-1
    Average 86 stars, based on 1 article reviews
    tissue microarray based immunohistochemistry analysis - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    tissue microarray analysis-based immunohistochemistry  (Human Protein Atlas)
    90
    Human Protein Atlas tissue microarray analysis-based immunohistochemistry
    Cell type specific genes demonstrated at mRNA level. (A) Heat map of genes with cell type specific expression. (B) Heat map of selected genes with endothelial or epithelial cell type specific expression. (C) <t>Immunohistochemistry</t> staining of protein C1orf116 across human tissues showing its epithelial cell type specific expression. The panel shows a magnified view (20×) from tissue microarrays.
    Tissue Microarray Analysis Based Immunohistochemistry, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tissue+microarray+based+immunohistochemistry+analysis/tissue+microarrays/pm29459781-307-35-43
    Average 90 stars, based on 1 article reviews
    tissue microarray analysis-based immunohistochemistry - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Cell type specific genes demonstrated at mRNA level. (A) Heat map of genes with cell type specific expression. (B) Heat map of selected genes with endothelial or epithelial cell type specific expression. (C) Immunohistochemistry staining of protein C1orf116 across human tissues showing its epithelial cell type specific expression. The panel shows a magnified view (20×) from tissue microarrays.

    Journal: Nucleic Acids Research

    Article Title: A transcriptomic and proteomic map of primary human cell types

    doi: 10.1093/nar/gkaf1498

    Figure Lengend Snippet: Cell type specific genes demonstrated at mRNA level. (A) Heat map of genes with cell type specific expression. (B) Heat map of selected genes with endothelial or epithelial cell type specific expression. (C) Immunohistochemistry staining of protein C1orf116 across human tissues showing its epithelial cell type specific expression. The panel shows a magnified view (20×) from tissue microarrays.

    Article Snippet: The Human Protein Atlas (HPA) project provided a tissue-based map of the human proteome through transcriptomics and tissue microarray-based immunohistochemistry analysis [ , ].

    Techniques: Expressing, Immunohistochemistry, Staining