Review



smrtbell express template prep kit 2 0  (Pacific Biosciences)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Pacific Biosciences smrtbell express template prep kit 2 0
    Smrtbell Express Template Prep Kit 2 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/0+3+kit+prep+smrtbell/pm42321367-55-18-24
    Average 86 stars, based on 1 article reviews
    smrtbell express template prep kit 2 0 - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Purification:

    Article Title: Gut microbiota signatures associated with the development of Salmonella Typhimurium super-shedders in broiler chickens
    Article Snippet: .. The purified products were mixed in equimolar ratios, and sequencing libraries were constructed using the SMRTbell prep kit 3.0 (Pacific Biosciences, USA) according to PacBio's instructions. .. The purified SMRTbell library was sequenced on the PacBio Sequel IIe system (Pacific Biosciences, CA, USA) by Majorbio (Shanghai, China).

    Sequencing:

    Article Title: Gut microbiota signatures associated with the development of Salmonella Typhimurium super-shedders in broiler chickens
    Article Snippet: .. The purified products were mixed in equimolar ratios, and sequencing libraries were constructed using the SMRTbell prep kit 3.0 (Pacific Biosciences, USA) according to PacBio's instructions. .. The purified SMRTbell library was sequenced on the PacBio Sequel IIe system (Pacific Biosciences, CA, USA) by Majorbio (Shanghai, China).

    Construct:

    Article Title: Gut microbiota signatures associated with the development of Salmonella Typhimurium super-shedders in broiler chickens
    Article Snippet: .. The purified products were mixed in equimolar ratios, and sequencing libraries were constructed using the SMRTbell prep kit 3.0 (Pacific Biosciences, USA) according to PacBio's instructions. .. The purified SMRTbell library was sequenced on the PacBio Sequel IIe system (Pacific Biosciences, CA, USA) by Majorbio (Shanghai, China).

    Article Title: A newly developed eGFP-traceable recombinant rhesus lymphocryptovirus, a tool to study viral infection and replication in vitro and ex vivo , confirms gp350 as key for viral entry.
    Article Snippet: Next, the fragmentation of 2 μg of isolated genomic DNA was conducted using the Covaris S220 ultrasonicator system (Matthew, NC), and the resulting sheared DNA sizes were analyzed using the Agilent 2011 bioanalyzer (Santa Clara, CA). .. SMRTbell libraries were constructed following the PacBio standard 20-kb template preparation protocol using the SMRTbell Template Prep Kit 1.0 from Pacific Biosciences (Menlo Park, CA). .. Briefly, the DNA was incubated with exonuclease VII (NEB) at 37°C for 15 min to remove single-stranded DNA, and any potentially damaged DNA was repaired using a DNA damage repair mix at 37°C for 20 min. Blunt-ended DNAs were treated with end-repair mix at 25°C for 5 min and ligated with 1 μM of annealed blunt adapters using 0.75 U/μL ligase at 25°C overnight; then, the ligase was inactivated by incubation at 65°C for 10 min. To remove failed ligation products, samples were treated with exonuclease III (NEB) and VII at 37°C for 1 h. To purify the DNAs and ligated products, 0.45× of AMPure PB Beads from Pacific Biosciences were applied.

    Article Title: Gardnerella enrichment in the vaginal microbiome of women with gestational diabetes mellitus is associated with lower fetal birthweight percentiles.
    Article Snippet: .. SMRTbell libraries were constructed using a SMRTbell prep kit 3.0 (Pacific Biosciences, Menlo Park, CA, USA) and sequenced on the PacBio Revio system (Pacific Biosciences, Menlo Park, CA, USA) by Majorbio Bio-Pharm Technology (Shanghai, China). ..



    Similar Products

    template dna  (ATCC)
    96
    ATCC template dna
    Template Dna, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/Staphylococcus+aureus+subsp%2E+aureus+Rosenbach/pm42243900-91-8-19
    Average 96 stars, based on 1 article reviews
    template dna - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    smrtbell express template prep kit 2 0  (Pacific Biosciences)
    86
    Pacific Biosciences smrtbell express template prep kit 2 0
    Smrtbell Express Template Prep Kit 2 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/0+3+kit+prep+smrtbell/pm42321367-55-18-24
    Average 86 stars, based on 1 article reviews
    smrtbell express template prep kit 2 0 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    spike in template f  (Sangon Biotech)
    86
    Sangon Biotech spike in template f
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/f+in+spike+template/pmc13142104-80-0-10
    Average 86 stars, based on 1 article reviews
    spike in template f - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    hdr dna template sequence  (Twist Bioscience)
    86
    Twist Bioscience hdr dna template sequence
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Hdr Dna Template Sequence, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/dna+templates/pmc13265900-103-0-5
    Average 86 stars, based on 1 article reviews
    hdr dna template sequence - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    dna template  (Twist Bioscience)
    86
    Twist Bioscience dna template
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Dna Template, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/dna+templates/pmc13265900-441-1-10
    Average 86 stars, based on 1 article reviews
    dna template - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    spike in template r  (Sangon Biotech)
    86
    Sangon Biotech spike in template r
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Spike In Template R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/f+in+spike+template/pmc13142104-81-0-10
    Average 86 stars, based on 1 article reviews
    spike in template r - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    smrtbell template prep kit  (Pacific Biosciences)
    86
    Pacific Biosciences smrtbell template prep kit
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Smrtbell Template Prep Kit, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/0+3+kit+prep+smrtbell/pm42304218-94-9-13
    Average 86 stars, based on 1 article reviews
    smrtbell template prep kit - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    template dna polynucleotides  (Solexa)
    86
    Solexa template dna polynucleotides
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Template Dna Polynucleotides, supplied by Solexa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/dna+polynucleotides+template/us12655481-206-0-21
    Average 86 stars, based on 1 article reviews
    template dna polynucleotides - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    mrna quantification  (OriGene)
    94
    OriGene mrna quantification
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Mrna Quantification, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/MRAS+Human+qPCR+Template+Standard/pm42263107-200-2-7
    Average 94 stars, based on 1 article reviews
    mrna quantification - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    smrtbell template prep kit 1 0  (Pacific Biosciences)
    86
    Pacific Biosciences smrtbell template prep kit 1 0
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Smrtbell Template Prep Kit 1 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/template/0+3+kit+prep+smrtbell/pm42274213-394-14-20
    Average 86 stars, based on 1 article reviews
    smrtbell template prep kit 1 0 - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Journal: STAR Protocols

    Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

    doi: 10.1016/j.xpro.2026.104537

    Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

    Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription

    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Journal: STAR Protocols

    Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

    doi: 10.1016/j.xpro.2026.104537

    Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Article Snippet: Spike-In template R , TTTTTTTCTCGACTGAAATGCTTAGAT GACCCAGCCCTCAATAGGGCCGCCT CGGCCNNNTGNNNACNNNATNNNG CNNNTGNNNACNNNGGCCGTAATG GCCGGTACCTTA , Sangon Biotech.

    Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription