Review



one step primescript rt pcr kit  (tiangen biotech co)


Bioz Verified Symbol tiangen biotech co is a verified supplier
Bioz Manufacturer Symbol tiangen biotech co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    tiangen biotech co one step primescript rt pcr kit
    One Step Primescript Rt Pcr Kit, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 144 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/One+Step+RT-PCR+Kit/pm32712062-68-41-29
    Average 96 stars, based on 144 article reviews
    one step primescript rt pcr kit - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    RNA Extraction:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    cDNA Library Assay:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Reverse Transcription:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Article Title: A novel KDM5C mutation associated with intellectual disability: molecular mechanisms and clinical implications
    Article Snippet: Total RNA of cell was extracted by Trizol (Tiangen, China). .. The total RNA (OD260/280 ≈ 2.0) of about 1 μg was then reverse-transcribed into first-strand cDNA with FastKing one-step RT-PCR kit (Tiangen, China) and then stored at -20 °C until use. ..

    Article Title: Plasma exosome proteomics reveals upregulation of CILP-1 in concave side of paraspinal muscle in adolescent idiopathic scoliosis
    Article Snippet: NanoDrop 2000c UV–Vis Spectrophotometer (Thermo Fisher Scientific) was used to detect the concentration of extracted RNA. .. Then one-step RT-PCR kit (Tiangen, Beijing) was used to perform reverse transcription and subsequent amplification in triplicated reactions in BioRad PCR system. ..

    Article Title: Genome-Wide Identification and Functional Analysis of CLAVATA3/EMBRYO SURROUNDING REGION-RELATED ( CLE ) in Three Populus Species
    Article Snippet: A NanoDrop 2000 Spectrophotometer (Thermo, West Palm Beach Inc., West Palm Beach, FL, USA) was used to assess the quantity and quality of RNA. .. Then, Quant One Step RT-PCR kit (Tiangen Bio Inc., Beijing, China) was used for reverse transcription following the manufacturer’s protocol. ..

    Article Title: A novel KDM5C mutation associated with intellectual disability: molecular mechanisms and clinical implications.
    Article Snippet: Total RNA of cell was extracted by Trizol (Tiangen, China). .. The total RNA (OD260/280 ≈ 2.0) of about 1 μg was then reverse-transcribed into first-strand cDNA with FastKing one-step RT-PCR kit (Tiangen, China) and then stored at -20 °C until use. ..

    Article Title: Integrated analysis identifies P4HA2 as a key regulator of STAT1-mediated colorectal cancer progression and a potential biomarker for precision therapy
    Article Snippet: Total RNA was extracted from cultured cells using a SteadyPure Universal RNA Extraction Kit (Accurate Biology, Changsha, China), and the raw RNA concentration was measured via a NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). .. Two micrograms of total RNA per sample was reverse transcribed into cDNA by using the FastKing One-Step RT–PCR Kit (TIANGEN). .. The primers used are listed in . q-PCR analyses were performed with SuperReal PreMix Plus (TIANGEN) on the QuantStudioTM 5 Real-Time System (Invitrogen, Carlsbad, CA).

    One Step RT-PCR:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Article Title: A novel KDM5C mutation associated with intellectual disability: molecular mechanisms and clinical implications
    Article Snippet: Total RNA of cell was extracted by Trizol (Tiangen, China). .. The total RNA (OD260/280 ≈ 2.0) of about 1 μg was then reverse-transcribed into first-strand cDNA with FastKing one-step RT-PCR kit (Tiangen, China) and then stored at -20 °C until use. ..

    Article Title: Plasma exosome proteomics reveals upregulation of CILP-1 in concave side of paraspinal muscle in adolescent idiopathic scoliosis
    Article Snippet: NanoDrop 2000c UV–Vis Spectrophotometer (Thermo Fisher Scientific) was used to detect the concentration of extracted RNA. .. Then one-step RT-PCR kit (Tiangen, Beijing) was used to perform reverse transcription and subsequent amplification in triplicated reactions in BioRad PCR system. ..

    Article Title: Genome-Wide Identification and Functional Analysis of CLAVATA3/EMBRYO SURROUNDING REGION-RELATED ( CLE ) in Three Populus Species
    Article Snippet: A NanoDrop 2000 Spectrophotometer (Thermo, West Palm Beach Inc., West Palm Beach, FL, USA) was used to assess the quantity and quality of RNA. .. Then, Quant One Step RT-PCR kit (Tiangen Bio Inc., Beijing, China) was used for reverse transcription following the manufacturer’s protocol. ..

    Article Title: A novel KDM5C mutation associated with intellectual disability: molecular mechanisms and clinical implications.
    Article Snippet: Total RNA of cell was extracted by Trizol (Tiangen, China). .. The total RNA (OD260/280 ≈ 2.0) of about 1 μg was then reverse-transcribed into first-strand cDNA with FastKing one-step RT-PCR kit (Tiangen, China) and then stored at -20 °C until use. ..

    Article Title: Integrated analysis identifies P4HA2 as a key regulator of STAT1-mediated colorectal cancer progression and a potential biomarker for precision therapy
    Article Snippet: Total RNA was extracted from cultured cells using a SteadyPure Universal RNA Extraction Kit (Accurate Biology, Changsha, China), and the raw RNA concentration was measured via a NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). .. Two micrograms of total RNA per sample was reverse transcribed into cDNA by using the FastKing One-Step RT–PCR Kit (TIANGEN). .. The primers used are listed in . q-PCR analyses were performed with SuperReal PreMix Plus (TIANGEN) on the QuantStudioTM 5 Real-Time System (Invitrogen, Carlsbad, CA).

    Amplification:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Article Title: Plasma exosome proteomics reveals upregulation of CILP-1 in concave side of paraspinal muscle in adolescent idiopathic scoliosis
    Article Snippet: NanoDrop 2000c UV–Vis Spectrophotometer (Thermo Fisher Scientific) was used to detect the concentration of extracted RNA. .. Then one-step RT-PCR kit (Tiangen, Beijing) was used to perform reverse transcription and subsequent amplification in triplicated reactions in BioRad PCR system. ..

    SYBR Green Assay:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Real-time Polymerase Chain Reaction:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Sequencing:

    Article Title: TMEM41B is an endoplasmic reticulum Ca 2+ release channel maintaining naive T cell quiescence and responsiveness
    Article Snippet: .. Total RNA from sorted naive T cells was extracted using the RNA Easy Fast animal tissues/cells total RNA extraction kit (TIANGEN, Cat# DP451) following the manufacturer’s protocol. cDNA library was prepared by reverse transcription using FastKing one-step RT-PCR kit (TIANGEN, Cat# KR123) and further amplified by Taq SYBR® Green qPCR premix (LABLEAD, Cat# R0202) at CFX96 Real-Time PCR System (Bio-Rad). qPCR primers used in this study were: Cd25 -Forward sequence: GCGTTGCTTAGGAAACTCCTGG; Cd25 -Reverse sequence: GCATAGACTGTGTTGGCTTCTGC; Cd132 -Forward sequence: GGAGCAACAGAGATCGAAGCTG; Cd132 -Reverse sequence: CCACAGATTGGGTTATAGCGGC; Cd127 -Forward sequence: CACAGCCAGTTGGAAGTGGATG; Cd127 -Reverse sequence: GGCATTTCACTCGTAAAAGAGCC; Jun -Forward sequence: CAGTCCAGCAATGGGCACATCA; Jun -Reverse sequence: GGAAGCGTGTTCTGGCTATGCA; Junb -Forward sequence: GACCTGCACAAGATGAACCACG; Junb -Reverse sequence: ACTGCTGAGGTTGGTGTAGACG; Myc -Forward sequence: TCGCTGCTGTCCTCCGAGTCC; Myc -Reverse sequence: GGTTTGCCTCTTCTCCACAGAC; Hprt -Forward sequence: CTGGTGAAAAGGACCTCTCGAAG; Hprt -Reverse sequence: CCAGTTTCACTAATGACACAAACG. ..

    Expressing:

    Article Title: Increased Co-Expression of PD-L1 and CTLA-4 Predicts Poor Overall Survival in Patients with Acute Myeloid Leukemia Following Allogeneic Hematopoietic Stem Cell Transplantation
    Article Snippet: RNA was reverse transcribed into cDNA using a reverse transcription kit (Promega, USA). .. The expression levels of PD-1, PD 1 ligand 1 (PD-L1), PD 1 ligand 2 (PD-L2), CTLA-4, and LAG-3 were quantified with a qRT-PCR kit (TIANGEN, China), and 18S rRNA was used as an internal control using the Real-Time System (Bio-Rad, USA). ..

    Quantitative RT-PCR:

    Article Title: Increased Co-Expression of PD-L1 and CTLA-4 Predicts Poor Overall Survival in Patients with Acute Myeloid Leukemia Following Allogeneic Hematopoietic Stem Cell Transplantation
    Article Snippet: RNA was reverse transcribed into cDNA using a reverse transcription kit (Promega, USA). .. The expression levels of PD-1, PD 1 ligand 1 (PD-L1), PD 1 ligand 2 (PD-L2), CTLA-4, and LAG-3 were quantified with a qRT-PCR kit (TIANGEN, China), and 18S rRNA was used as an internal control using the Real-Time System (Bio-Rad, USA). ..

    Control:

    Article Title: Increased Co-Expression of PD-L1 and CTLA-4 Predicts Poor Overall Survival in Patients with Acute Myeloid Leukemia Following Allogeneic Hematopoietic Stem Cell Transplantation
    Article Snippet: RNA was reverse transcribed into cDNA using a reverse transcription kit (Promega, USA). .. The expression levels of PD-1, PD 1 ligand 1 (PD-L1), PD 1 ligand 2 (PD-L2), CTLA-4, and LAG-3 were quantified with a qRT-PCR kit (TIANGEN, China), and 18S rRNA was used as an internal control using the Real-Time System (Bio-Rad, USA). ..

    Polymerase Chain Reaction:

    Article Title: Plasma exosome proteomics reveals upregulation of CILP-1 in concave side of paraspinal muscle in adolescent idiopathic scoliosis
    Article Snippet: NanoDrop 2000c UV–Vis Spectrophotometer (Thermo Fisher Scientific) was used to detect the concentration of extracted RNA. .. Then one-step RT-PCR kit (Tiangen, Beijing) was used to perform reverse transcription and subsequent amplification in triplicated reactions in BioRad PCR system. ..



    Similar Products

    99
    TaKaRa 02501 primescripttm reverse transcriptase takara
    02501 Primescripttm Reverse Transcriptase Takara, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+RT+Reagent+Kit/pm41997144-265-110-114
    Average 99 stars, based on 1 article reviews
    02501 primescripttm reverse transcriptase takara - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    97
    TaKaRa takara primescript reverse transcriptase
    Takara Primescript Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+Reverse+Transcriptase/pmc12903398-251-21-21
    Average 97 stars, based on 1 article reviews
    takara primescript reverse transcriptase - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    TaKaRa primescript tm ii reverse transcriptase takara
    Primescript Tm Ii Reverse Transcriptase Takara, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+II+Reverse+Transcriptase/pm41353749-563-87-92
    Average 96 stars, based on 1 article reviews
    primescript tm ii reverse transcriptase takara - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    TaKaRa takara reverse transcriptase kit
    Takara Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+RT+Reagent+Kit+with+gDNA+Eraser/pm41259864-101-38-38
    Average 99 stars, based on 1 article reviews
    takara reverse transcriptase kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    97
    TaKaRa takara reverse transcriptase primers
    Takara Reverse Transcriptase Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+Reverse+Transcriptase/pm41191192-232-15-15
    Average 97 stars, based on 1 article reviews
    takara reverse transcriptase primers - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    TaKaRa takara cat 2680a
    Takara Cat 2680a, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+Reverse+Transcriptase/us12404323-348-14-14
    Average 97 stars, based on 1 article reviews
    takara cat 2680a - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    TaKaRa takara thermal pcr cycler
    Takara Thermal Pcr Cycler, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+Reverse+Transcriptase/10__1038_slash_s41598___025___03806___x-88-34-38
    Average 97 stars, based on 1 article reviews
    takara thermal pcr cycler - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    99
    TaKaRa takara reverse transcriptase
    Takara Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/takara+primescript+reverse+transcriptase/PrimeScript+RT+Master+Mix/pmc12388171-60-23-23
    Average 99 stars, based on 1 article reviews
    takara reverse transcriptase - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results