Review



anti syntaxin 3 antibody  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Proteintech anti syntaxin 3 antibody
    Anti Syntaxin 3 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+Antibody/pmc06971263-200-4-6
    Average 93 stars, based on 18 article reviews
    anti syntaxin 3 antibody - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    other:

    Article Title: Legionella employs the multimodal ubiquitination of Sec22b to modulate SNARE pairing
    Article Snippet: Anti-Stx3 rabbit polyclonal antibody (15556-1-AP) and anti-Stx4 rabbit monoclonal antibody (14988-1-AP) were purchased from Proteintech.

    Article Title: Ciliopathy-associated protein, CEP290, is required for ciliary necklace and outer segment membrane formation in retinal photoreceptors
    Article Snippet: The following primary antibodies were used: anti-centrin (Millipore Cat# 04-1624; 10ug for STORM/Expansion; 1:100 for IF), anti-INPP5e (ProteinTech Cat# 17797-1-AP; 10ug for STORM), anti-CEP290 (Bethyl Cat# A301-659A ; 2ug/ml for WB; 10ug for STORM/Expansion/ImmunoEM; 1:100 for IF), anti-CEP290 (ProteinTech Cat# 22490-1-AP; 10ug for STORM/Expansion/ImmunoEM), anti-CEP290 (BiCell Cat# 90006; 1ug/ml for WB; 5ug for STORM/Expansion/ImmunoEM; 1:50 for IF), anti-RP1 (gift from Eric Pierce, Harvard University; 1:1000 for IF), anti-RPGR (gift from Hemant Khanna; 10ug for STORM, 1:100 for IF), anti-acetylated tubulin (SantaCruz Cat# sc23950af647; 10ug for IF/STORM/Expansion), anti-GT335 (Adipogen Cat# AG-20B-0020-C100 (GT335); 1:100 for IF; 5ug for STORM/Expansion; 1:2000 for WB), anti-BBS4 (BiCell Cat# 90204; 1:100 for IF), anti-NPHP1 (BiCell Cat# 90001; 1:100 for IF), anti-CEP89 (BiCell Cat# 01079; 1:100 for IF), anti-CP110 (ProteinTech Cat# 12780-1-AP; 1:100 for IF), anti-CEP97 (ProteinTech Cat# 22050-1-AP; 1:100 for IF), anti-AHI1 (ProteinTech Cat# 22045; 1:100 for IF), anti-NPHP8 (BiCell Cat# 90008; 1:100 for IF), anti-IFT88 (ProteinTech Cat# 13967-1-AP; 1:100 for IF), anti-IFT140 (Gift from Gregory Pazour, UMass; 1:100 for IF), anti-IFT81 (ProteinTech Cat# 11744, 1:100 for IF), anti-Rootletin (SantaCruz Cat# sc-67824; 1:500 for IF), anti-GAPDH (Fitzgerald Cat# 10R-G109a; 1:20,000 for WB), anti-β actin (CST Cat# 3700S; 1:1,000 for WB), anti-PDE6β (SantaCruz Cat# sc-377486; 1:500 for WB; 1:250 for IF), anti-pde6α (ABR Cat# PA1-720; 2ug for WB), anti-PRPH2 (gift from Andrew Goldberg, Oakland University; 1:3000 for WB; 1:500 for IF), anti-CNGA1 (EMD Cat# MABN2617-100UG; 1:100 for IF), anti-arl13b (Proteintech Cat# 17711-1-AP; 1.4ug for WB; 1:250 for IF), anti-cArr3 (Sigma Cat# AB15282; 1:1000 for IF), anti-STX3 (Proteintech Cat# 15556-1-AP; 1ug for WB; 1:500 for IF), anti-Rho-C-1D4 (Millipore Cat# MAB5356; 1:1000 for IF), anti-ROM1 (Proteintech Cat# 21984-1-AP; 1:500 for WB; 1:250 for IF), anti-GC1 (Santa Cruz Cat# sc-376217; 1:150 for WB; 1:500 for IF).

    Article Title: Legionella employs multimodal ubiquitination of Sec22b to modulate SNARE pairing
    Article Snippet: Anti-Stx3 rabbit polyclonal antibody (15556-1-AP) and anti-Stx4 rabbit 624 monoclonal antibody (14988-1-AP) were purchased from Proteintech.

    Article Title: Legionella employs the multimodal ubiquitination of Sec22b to modulate SNARE pairing
    Article Snippet: Anti-Stx3 rabbit polyclonal antibody , Proteintech , Cat# 15556-1-AP; RRID:AB_2198667.

    Concentration Assay:

    Article Title: Inpp5e is crucial for photoreceptor outer segment maintenance
    Article Snippet: .. Identifier Supplier Concentration Antibody Inpp5e 17797-AP Proteintech, Rosemont IL USA 1:200 Rhodopsin Ab98887 (4D2) Abcam, Cambridge UK 1:2000 Red/Green Opsin AB5405 MilliporeSigma, Burlington, MA USA 1:2000 Ift27 719 (Keady et al., 2012) 1:1000 Ift88 448 (Pazour et al., 2002) 1:1000 Ift140 964 (Jonassen et al., 2012) 1:1000 Cep164 22227-1AP Santa Cruz Biotech, Santa Cruz CA USA 1:1000 Prph2 RDS-CT (Stuck et al., 2014) 1:2000 Rom1 (Spencer et al., 2023) 1:5000 Prom1 MAB4310 MilliporeSigma, Burlington, MA USA 1:100 Stx3 15556-1-AP Proteintech, Rosemont IL USA 1:2000 Wasf3 2806S Cell Signaling Technology 1:500 Giantin 3991 (Nozawa et al., 2002) 1:200 Acetylated tubulin 611-B1 (MABT888) Sigma, St Louis MO USA 1:2000 Anti-mouse-Alexa488 -Alexa594 -Alexa647 A-11017 A-11032 A-21235 Invitrogen, Waltham, MA USA 1:1000 Anti-rabbit-Alexa488 -Alexa594 -Alexa647 A-11034 A-21207 A-21245 Invitrogen, Waltham, MA USA 1:1000 Lectins, toxins, etc. .. Wheat germ agglutinin (WGA)-Alexa488 W11261 Invitrogen, Waltham, MA USA 1 μg/mL Phalloidin-Alexa594 A12381 Invitrogen, Waltham, MA USA 1:500 4',6-diamidino-2- phenylindole (DAPI) D1306 Invitrogen, Waltham, MA USA 10 μg/ml Keady, B. T., Samtani, R., Tobita, K., Tsuchya, M., San Agustin, J. T., Follit, J.

    Knock-Out:

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex Cat#GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr. Maxim Sokolov); anti-GM130 (BD Biosciences Cat# 610822, RRID:AB_398141, validated by knockout in ( )); anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a (Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ( )); anti-Giantin (Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ( )); Rab1B (Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ( )); Fluo Tag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab’)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab’)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab’)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab’)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab’)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag®-X2 anti-Mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW Goat anti-Rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW Goat anti-Mouse IgG (LI-COR, Cat# 925-32210); Other labeling reagents include SNAP-Surface Alexa Fluor 647 (New England Biolabs (NEB), Cat# S9136S), SNAP-Cell ® TMR-Star (NEB, Cat# S9105S) and DAPI (Thermo Scientific, Cat# 62248)

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex, Cat# GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr Maxim Sokolov); anti-GM130 [BD Biosciences, Cat# 610822, RRID:AB_398141, validated by knockout in ]; anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a [Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ]; anti-Giantin [Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ]; Rab1B [Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ]; FluoTag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab′)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab′)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab′)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab′)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab′)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag ® -X2 anti-mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW goat anti-rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW goat anti-mouse IgG (LI-COR, Cat# 925-32210).

    Knockdown:

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex Cat#GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr. Maxim Sokolov); anti-GM130 (BD Biosciences Cat# 610822, RRID:AB_398141, validated by knockout in ( )); anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a (Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ( )); anti-Giantin (Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ( )); Rab1B (Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ( )); Fluo Tag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab’)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab’)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab’)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab’)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab’)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag®-X2 anti-Mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW Goat anti-Rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW Goat anti-Mouse IgG (LI-COR, Cat# 925-32210); Other labeling reagents include SNAP-Surface Alexa Fluor 647 (New England Biolabs (NEB), Cat# S9136S), SNAP-Cell ® TMR-Star (NEB, Cat# S9105S) and DAPI (Thermo Scientific, Cat# 62248)

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex, Cat# GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr Maxim Sokolov); anti-GM130 [BD Biosciences, Cat# 610822, RRID:AB_398141, validated by knockout in ]; anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a [Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ]; anti-Giantin [Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ]; Rab1B [Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ]; FluoTag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab′)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab′)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab′)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab′)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab′)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag ® -X2 anti-mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW goat anti-rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW goat anti-mouse IgG (LI-COR, Cat# 925-32210).

    Whole Genome Amplification:

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex Cat#GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr. Maxim Sokolov); anti-GM130 (BD Biosciences Cat# 610822, RRID:AB_398141, validated by knockout in ( )); anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a (Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ( )); anti-Giantin (Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ( )); Rab1B (Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ( )); Fluo Tag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab’)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab’)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab’)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab’)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab’)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag®-X2 anti-Mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW Goat anti-Rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW Goat anti-Mouse IgG (LI-COR, Cat# 925-32210); Other labeling reagents include SNAP-Surface Alexa Fluor 647 (New England Biolabs (NEB), Cat# S9136S), SNAP-Cell ® TMR-Star (NEB, Cat# S9105S) and DAPI (Thermo Scientific, Cat# 62248)

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex, Cat# GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr Maxim Sokolov); anti-GM130 [BD Biosciences, Cat# 610822, RRID:AB_398141, validated by knockout in ]; anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a [Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ]; anti-Giantin [Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ]; Rab1B [Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ]; FluoTag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab′)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab′)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab′)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab′)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab′)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag ® -X2 anti-mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW goat anti-rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW goat anti-mouse IgG (LI-COR, Cat# 925-32210).

    Labeling:

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex Cat#GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr. Maxim Sokolov); anti-GM130 (BD Biosciences Cat# 610822, RRID:AB_398141, validated by knockout in ( )); anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a (Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ( )); anti-Giantin (Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ( )); Rab1B (Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ( )); Fluo Tag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab’)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab’)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab’)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab’)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab’)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag®-X2 anti-Mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW Goat anti-Rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW Goat anti-Mouse IgG (LI-COR, Cat# 925-32210); Other labeling reagents include SNAP-Surface Alexa Fluor 647 (New England Biolabs (NEB), Cat# S9136S), SNAP-Cell ® TMR-Star (NEB, Cat# S9105S) and DAPI (Thermo Scientific, Cat# 62248)

    Article Title: Super-resolution microscopy reveals a Rab6a-dependent trafficking hub for rhodopsin at the mammalian rod photoreceptor Golgi
    Article Snippet: .. The following primary antibodies were used in this study: anti-Rho-C-1D4 (Millipore Sigma, Cat# MAB5356); anti-Rho-N-4D2 (Millipore Sigma, Cat# MABN15); anti-Centrin-2 (Millipore Sigma, Cat# 04-1624); anti-STX3 (Millipore Cat# MAB2258, RRID:AB_1977423); anti-STX3 (Proteintech, Cat# 15556-1-AP, RRID:AB_2198667); anti-Rho-N-GTX (GeneTex, Cat# GTX129910, RRID:AB_2886122); anti-PDC (gift from Dr Maxim Sokolov); anti-GM130 [BD Biosciences, Cat# 610822, RRID:AB_398141, validated by knockout in ]; anti-DYNC1H1 (Proteintech, 12345-1-AP); anti-Rab6a [Proteintech, Cat# 10187-2-AP, RRID:AB_2175463, validated by knockdown in ]; anti-Giantin [Proteintech, Cat# 22270-1-AP, RRID: AB_2879055, validated by localization in ]; Rab1B [Proteintech, Cat# 17824, RRID# AB_2237881, validated by knockdown in ]; FluoTag-X2 anti-ALFA-Alexa647 (Nanotag Biotechnologies, Cat# N1502); WGA-CF568 (Biotium, Cat# 29077); and WGA-Alexa-CF488A (Biotium Cat# 29022) were used for surface labeling. .. The following secondary antibodies were used in this study: F(ab′)2-goat anti-rat Alexa 488 IgG (Invitrogen, Cat# A11070); F(ab′)2-goat anti-mouse Alexa 488 IgG (Invitrogen, Cat# A11017); F(ab′)2-goat anti-rabbit Alexa 647 IgG (Invitrogen, Cat# A21246); F(ab′)2-goat anti-mouse Alexa 647 IgG (Invitrogen, Cat# A21237); F(ab′)2-goat anti-mouse Alexa 555 IgG (Invitrogen, Cat# A21425); FluoTag ® -X2 anti-mouse IgG1 Alexa647 (Nanotag, Cat# N2002-AF647-S, RRID: AB_3076020); IRDye800CW goat anti-rabbit IgG (LI-COR, Cat# 925-32211); IRDye800CW goat anti-mouse IgG (LI-COR, Cat# 925-32210).



    Similar Products

    anti syntaxin3 rabbit polyclonal antibody  (Alomone Labs)
    90
    Alomone Labs anti syntaxin3 rabbit polyclonal antibody
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Anti Syntaxin3 Rabbit Polyclonal Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Anti-Syntaxin+3+Antibody/pm30522963-39-1-8
    Average 90 stars, based on 1 article reviews
    anti syntaxin3 rabbit polyclonal antibody - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    syntaxin3 ddk  (OriGene)
    92
    OriGene syntaxin3 ddk
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3 Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+(STX3)+(NM_004177)+Human+Recombinant+Protein/pmc10963788-377-1-2
    Average 92 stars, based on 1 article reviews
    syntaxin3 ddk - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    syntaxin3 (rb) proteintech 15556-1-ap  (Proteintech)
    93
    Proteintech syntaxin3 (rb) proteintech 15556-1-ap
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3 (Rb) Proteintech 15556 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+Antibody/pmc10500017__41467_2023_41450_MOESM1_ESM-40-117-119
    Average 93 stars, based on 1 article reviews
    syntaxin3 (rb) proteintech 15556-1-ap - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    syntaxin3  (Proteintech)
    93
    Proteintech syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+Antibody/pm37351635-50-32-30
    Average 93 stars, based on 1 article reviews
    syntaxin3 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    rabbit anti-syntaxin3  (Synaptic Systems)
    90
    Synaptic Systems rabbit anti-syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Rabbit Anti Syntaxin3, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/syntaxin+2+antibody/pm38026697-52-1-6
    Average 90 stars, based on 1 article reviews
    rabbit anti-syntaxin3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    syntaxin3  (Danaher Inc)
    86
    Danaher Inc syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/10__7554_slash_elife__80135-233-112-118
    Average 86 stars, based on 1 article reviews
    syntaxin3 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    recombinant protein corresponding to aa 1 to 260 from rat syntaxin3  (ImmunoGen Inc)
    90
    ImmunoGen Inc recombinant protein corresponding to aa 1 to 260 from rat syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Recombinant Protein Corresponding To Aa 1 To 260 From Rat Syntaxin3, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/recombinant+protein+corresponding+to+aa+1+to+260+from+rat+syntaxin3/pmc09622911__41467_2022_33986_MOESM3_ESM-44-17-7
    Average 90 stars, based on 1 article reviews
    recombinant protein corresponding to aa 1 to 260 from rat syntaxin3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    control antigen syntaxin3 rabbit 100 synaptic systems  (Synaptic Systems)
    92
    Synaptic Systems control antigen syntaxin3 rabbit 100 synaptic systems
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Control Antigen Syntaxin3 Rabbit 100 Synaptic Systems, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/110+033/pm34168338-684-20-25
    Average 92 stars, based on 1 article reviews
    control antigen syntaxin3 rabbit 100 synaptic systems - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    accg gtcgac atgaaggaccgtctggagcag reverse sacii syntaxin3  (TaKaRa)
    96
    TaKaRa accg gtcgac atgaaggaccgtctggagcag reverse sacii syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Accg Gtcgac Atgaaggaccgtctggagcag Reverse Sacii Syntaxin3, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Sac+II/bio_rxiv__2019__12__24__886648-173-25-41
    Average 96 stars, based on 1 article reviews
    accg gtcgac atgaaggaccgtctggagcag reverse sacii syntaxin3 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    anti-syntaxin3  (Synaptic Systems)
    90
    Synaptic Systems anti-syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Anti Syntaxin3, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/syntaxin+2+antibody/pmc06930865-156-22-37
    Average 90 stars, based on 1 article reviews
    anti-syntaxin3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Fig. 4. Effects of SKF-10047 on the protein expression of Syntaxin3 (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).

    Journal: Journal of pharmacological sciences

    Article Title: SKF-10047, a prototype Sigma-1 receptor agonist, augmented the membrane trafficking and uptake activity of the serotonin transporter and its C-terminus-deleted mutant via a Sigma-1 receptor-independent mechanism.

    doi: 10.1016/j.jphs.2018.11.005

    Figure Lengend Snippet: Fig. 4. Effects of SKF-10047 on the protein expression of Syntaxin3 (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).

    Article Snippet: An anti-Syntaxin3 rabbit polyclonal antibody was purchased from Alomone labs. (Jerusalem, Israel).

    Techniques: Expressing, Produced, Alternative Splicing

    Fig. 5. Influence of knockdown or overexpression of Syntaxin3 on the incremental effects of SKF-10047 on the SERTDCT uptake activity. We examined the effects of SKF-10047 on the SERTDCT uptake activity in STX3-knockdown or STX3-overexpressing COS-7 cells, and compared the increasing rate in these cells to that in control cells. A: Validation of STX3 knockdown by STX3 siRNA (upper) and overexpression by pMyc-DDK-STX3 (lower) in COS-7 cells. The transfection of STX3 siRNA #1 and #2 reduced the expression of STX3 isoform A, a functional isoform, by 53% and 56%, respectively (upper). In pMyc-DDK-STX3-transfected cells, prominent expression of Myc-DDK-STX3 was seen in addition to endogenous STX3, isoform A and B. B: Effects of SKF-10047 on the uptake activity of SERTDCT in control siRNA-transfected COS-7 cells and STX3 siRNA #2-transfected COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 was similar in control siRNA-transfected cells and STX3 siRNA-transfected cells (n ¼ 4, ns, unpaired t-test). C: Effects of SKF-10047 on the uptake activity of SERTDCT in mock-transfected COS-7 cells and Myc-DDK-STX3-expressing COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 in Myc-DDK-STX3-expressing cells was significantly higher than that in mock-transfected cells (n ¼ 4, P < 0.001, unpaired t-test).

    Journal: Journal of pharmacological sciences

    Article Title: SKF-10047, a prototype Sigma-1 receptor agonist, augmented the membrane trafficking and uptake activity of the serotonin transporter and its C-terminus-deleted mutant via a Sigma-1 receptor-independent mechanism.

    doi: 10.1016/j.jphs.2018.11.005

    Figure Lengend Snippet: Fig. 5. Influence of knockdown or overexpression of Syntaxin3 on the incremental effects of SKF-10047 on the SERTDCT uptake activity. We examined the effects of SKF-10047 on the SERTDCT uptake activity in STX3-knockdown or STX3-overexpressing COS-7 cells, and compared the increasing rate in these cells to that in control cells. A: Validation of STX3 knockdown by STX3 siRNA (upper) and overexpression by pMyc-DDK-STX3 (lower) in COS-7 cells. The transfection of STX3 siRNA #1 and #2 reduced the expression of STX3 isoform A, a functional isoform, by 53% and 56%, respectively (upper). In pMyc-DDK-STX3-transfected cells, prominent expression of Myc-DDK-STX3 was seen in addition to endogenous STX3, isoform A and B. B: Effects of SKF-10047 on the uptake activity of SERTDCT in control siRNA-transfected COS-7 cells and STX3 siRNA #2-transfected COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 was similar in control siRNA-transfected cells and STX3 siRNA-transfected cells (n ¼ 4, ns, unpaired t-test). C: Effects of SKF-10047 on the uptake activity of SERTDCT in mock-transfected COS-7 cells and Myc-DDK-STX3-expressing COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 in Myc-DDK-STX3-expressing cells was significantly higher than that in mock-transfected cells (n ¼ 4, P < 0.001, unpaired t-test).

    Article Snippet: An anti-Syntaxin3 rabbit polyclonal antibody was purchased from Alomone labs. (Jerusalem, Israel).

    Techniques: Knockdown, Over Expression, Activity Assay, Control, Biomarker Discovery, Transfection, Expressing, Functional Assay