Review



untagged human stx3 pstx3  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    OriGene untagged human stx3 pstx3
    Fig. 1. Interaction of SERT with <t>STX3</t> in COS-7 cells overexpressing SERT and STX3. A: Immunoprecipitation studies using COS-7 cells overexpressing SERT and STX3. COS-7 cells were transfected with FLAG-SERT and untagged STX3 cDNA or mock vector (pcDNA3.0). Cell lysates were subjected to immunoprecipitation (IP) with anti-FLAG-tagged mAb magnetic agarose beads and analyzed by immunoblotting (IB) with an anti-FLAG antibody or anti-STX3 antibody. The cell lysate inputs used for IP were blotted with anti-FLAG or anti-STX3 antibodies. Immunoprecipitated samples prepared from cells expressing both STX3 and FLAG-SERT contained STX3 (black circles). Arrowheads and arrows indicate mature glycosylated SERT and immaturely glycosylated SERT, respectively. An asterisk indicates a nonspecific band. The figure shows the representative data from two independent experiments. B: Immunoprecipitation studies using normal mouse IgG and anti-FLAG antibodies. COS-7 cells were transfected with FLAG-SERT and untagged STX3 cDNA. Cell lysates were subjected to IP with normal mouse IgG, followed by protein G magnetic sepharose beads or anti-FLAG-tagged mAb magnetic agarose beads, and analyzed by IB with an anti-FLAG antibody or anti-STX3 antibody. The immunoprecipitated samples that reacted with an anti-FLAG antibody contain STX3 (black circle), while those that reacted with normal IgG do not contain STX3. An asterisk indicates a nonspecific band. SERT, serotonin transporter; STX$, <t>syntaxin-3.</t>
    Untagged Human Stx3 Pstx3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+(STX3)+(NM_001178040)+Human+Untagged+Clone/pm33712280-67-11-18
    Average 90 stars, based on 1 article reviews
    untagged human stx3 pstx3 - by Bioz Stars, 2026-11
    90/100 stars

    Images

    1) Product Images from "Syntaxin 3 interacts with serotonin transporter and regulates its function."

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.

    Journal: Journal of pharmacological sciences

    doi: 10.1016/j.jphs.2021.01.007

    Fig. 1. Interaction of SERT with STX3 in COS-7 cells overexpressing SERT and STX3. A: Immunoprecipitation studies using COS-7 cells overexpressing SERT and STX3. COS-7 cells were transfected with FLAG-SERT and untagged STX3 cDNA or mock vector (pcDNA3.0). Cell lysates were subjected to immunoprecipitation (IP) with anti-FLAG-tagged mAb magnetic agarose beads and analyzed by immunoblotting (IB) with an anti-FLAG antibody or anti-STX3 antibody. The cell lysate inputs used for IP were blotted with anti-FLAG or anti-STX3 antibodies. Immunoprecipitated samples prepared from cells expressing both STX3 and FLAG-SERT contained STX3 (black circles). Arrowheads and arrows indicate mature glycosylated SERT and immaturely glycosylated SERT, respectively. An asterisk indicates a nonspecific band. The figure shows the representative data from two independent experiments. B: Immunoprecipitation studies using normal mouse IgG and anti-FLAG antibodies. COS-7 cells were transfected with FLAG-SERT and untagged STX3 cDNA. Cell lysates were subjected to IP with normal mouse IgG, followed by protein G magnetic sepharose beads or anti-FLAG-tagged mAb magnetic agarose beads, and analyzed by IB with an anti-FLAG antibody or anti-STX3 antibody. The immunoprecipitated samples that reacted with an anti-FLAG antibody contain STX3 (black circle), while those that reacted with normal IgG do not contain STX3. An asterisk indicates a nonspecific band. SERT, serotonin transporter; STX$, syntaxin-3.
    Figure Legend Snippet: Fig. 1. Interaction of SERT with STX3 in COS-7 cells overexpressing SERT and STX3. A: Immunoprecipitation studies using COS-7 cells overexpressing SERT and STX3. COS-7 cells were transfected with FLAG-SERT and untagged STX3 cDNA or mock vector (pcDNA3.0). Cell lysates were subjected to immunoprecipitation (IP) with anti-FLAG-tagged mAb magnetic agarose beads and analyzed by immunoblotting (IB) with an anti-FLAG antibody or anti-STX3 antibody. The cell lysate inputs used for IP were blotted with anti-FLAG or anti-STX3 antibodies. Immunoprecipitated samples prepared from cells expressing both STX3 and FLAG-SERT contained STX3 (black circles). Arrowheads and arrows indicate mature glycosylated SERT and immaturely glycosylated SERT, respectively. An asterisk indicates a nonspecific band. The figure shows the representative data from two independent experiments. B: Immunoprecipitation studies using normal mouse IgG and anti-FLAG antibodies. COS-7 cells were transfected with FLAG-SERT and untagged STX3 cDNA. Cell lysates were subjected to IP with normal mouse IgG, followed by protein G magnetic sepharose beads or anti-FLAG-tagged mAb magnetic agarose beads, and analyzed by IB with an anti-FLAG antibody or anti-STX3 antibody. The immunoprecipitated samples that reacted with an anti-FLAG antibody contain STX3 (black circle), while those that reacted with normal IgG do not contain STX3. An asterisk indicates a nonspecific band. SERT, serotonin transporter; STX$, syntaxin-3.

    Techniques Used: Immunoprecipitation, Transfection, Plasmid Preparation, Western Blot, Expressing

    Fig. 2. Localization of SERT and STX3 in COS-7 cells. A: Immunocytochemical anal- ysis of COS-7 cells transfected with pHA-SERT and pMyc-DDK-STX3. Forty-eight hours after transfection, immunocytochemical studies using an anti-HA antibody or anti-Myc antibody were performed. HA-SERT and Myc-DDK-STX3 are colocalized in some intracellular organelles of COS-7 cells as aggregate-like structures. Bar: 10 mm. B: Comparison of SERT and STX3 localization in the endoplasmic reticulum (ER), as visualized with KDEL antibody, in COS-7 cells. HA-SERT is localized in the ER, which was labeled with an anti-KDEL antibody (upper panel). Myc-DDK-STX3 is also localized in the ER (lower panel). Bar: 10 mm. C: Comparison of SERT and STX3 localization with the Golgi apparatus, as visualized by an anti-GM130 antibody, in COS-7 cells. HA-SERT is localized in the Golgi apparatus, which was labeled with an anti-GM130 antibody (upper panel). Myc-DDK-STX3 was also localized in the Golgi apparatus (lower panel). Bar: 10 mm. SERT, serotonin transporter; STX$, syntaxin-3.
    Figure Legend Snippet: Fig. 2. Localization of SERT and STX3 in COS-7 cells. A: Immunocytochemical anal- ysis of COS-7 cells transfected with pHA-SERT and pMyc-DDK-STX3. Forty-eight hours after transfection, immunocytochemical studies using an anti-HA antibody or anti-Myc antibody were performed. HA-SERT and Myc-DDK-STX3 are colocalized in some intracellular organelles of COS-7 cells as aggregate-like structures. Bar: 10 mm. B: Comparison of SERT and STX3 localization in the endoplasmic reticulum (ER), as visualized with KDEL antibody, in COS-7 cells. HA-SERT is localized in the ER, which was labeled with an anti-KDEL antibody (upper panel). Myc-DDK-STX3 is also localized in the ER (lower panel). Bar: 10 mm. C: Comparison of SERT and STX3 localization with the Golgi apparatus, as visualized by an anti-GM130 antibody, in COS-7 cells. HA-SERT is localized in the Golgi apparatus, which was labeled with an anti-GM130 antibody (upper panel). Myc-DDK-STX3 was also localized in the Golgi apparatus (lower panel). Bar: 10 mm. SERT, serotonin transporter; STX$, syntaxin-3.

    Techniques Used: Transfection, Comparison, Labeling

    Fig. 3. Effects of STX3 overexpression on the uptake activity, protein expression, and glycosylation of SERT. A: Effects of STX3 overexpression on SERT uptake activity. In cells expressing FLAG-SERT and mock (pcDNA) or Myc-DDK-STX3, we measured the uptake of fluorescent SERT substrate per cell as the 5-HT uptake activity. Uptake activity was evaluated using the Neurotransmitter Transporter Uptake Assay kit as described in the Materials and Methods section. STX3 overexpression significantly reduces the 5-HT uptake activity of SERT in AD293 and COS-7 cells [AD293 cells: *p < 0.0001, n ¼ 9 (three independent experiments), Student's t-test, compared to mock control; COS-7 cells: *p < 0.0001, n ¼ 12 (4 independent experiments), Student's t-test, compared to mock control]. B: Effects of STX3 overexpression on SERT protein expression and glycosylation. Representative immunoblotting data of FLAG-SERT expression in AD293, FLAG-SERT HEK, and COS-7 cells are shown. According to our previous studies, the band with a molecular size of approximately 80 kDa (arrowhead) is considered to be functional and maturely glycosylated SERT expressed at the plasma membrane, and the band with a molecular size of approximately 63 kDa (arrow) is considered to be high-mannose-type immaturely glycosylated SERT in the endoplasmic reticulum (ER). Furthermore, a band larger than 100 kDa is considered to be a dimer of immaturely glycosylated SERT.18,19,37 STX3 overexpression tends to decrease the expression of mature SERT in all cell types. C: Comparison of levels of maturely glycosylated SERT between mock-transfected and STX3-overexpressing COS-7 cells. There are no statistically significant differences between the groups, although STX3 overexpression tends to decrease the expression of mature SERT (n ¼ 5, ns). SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine.
    Figure Legend Snippet: Fig. 3. Effects of STX3 overexpression on the uptake activity, protein expression, and glycosylation of SERT. A: Effects of STX3 overexpression on SERT uptake activity. In cells expressing FLAG-SERT and mock (pcDNA) or Myc-DDK-STX3, we measured the uptake of fluorescent SERT substrate per cell as the 5-HT uptake activity. Uptake activity was evaluated using the Neurotransmitter Transporter Uptake Assay kit as described in the Materials and Methods section. STX3 overexpression significantly reduces the 5-HT uptake activity of SERT in AD293 and COS-7 cells [AD293 cells: *p < 0.0001, n ¼ 9 (three independent experiments), Student's t-test, compared to mock control; COS-7 cells: *p < 0.0001, n ¼ 12 (4 independent experiments), Student's t-test, compared to mock control]. B: Effects of STX3 overexpression on SERT protein expression and glycosylation. Representative immunoblotting data of FLAG-SERT expression in AD293, FLAG-SERT HEK, and COS-7 cells are shown. According to our previous studies, the band with a molecular size of approximately 80 kDa (arrowhead) is considered to be functional and maturely glycosylated SERT expressed at the plasma membrane, and the band with a molecular size of approximately 63 kDa (arrow) is considered to be high-mannose-type immaturely glycosylated SERT in the endoplasmic reticulum (ER). Furthermore, a band larger than 100 kDa is considered to be a dimer of immaturely glycosylated SERT.18,19,37 STX3 overexpression tends to decrease the expression of mature SERT in all cell types. C: Comparison of levels of maturely glycosylated SERT between mock-transfected and STX3-overexpressing COS-7 cells. There are no statistically significant differences between the groups, although STX3 overexpression tends to decrease the expression of mature SERT (n ¼ 5, ns). SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine.

    Techniques Used: Over Expression, Activity Assay, Expressing, Glycoproteomics, Control, Western Blot, Functional Assay, Clinical Proteomics, Membrane, Comparison, Transfection

    Fig. 4. Effects of STX3 overexpression on SERT membrane expression. A: Comparison of the membrane expression of HA-SERT in Myc-STX3-overexpressing and non-Myc-STX3- overexpressing cells. Immunofluorescence staining of COS-7 cells transfected with pHA-SERT and pMyc-DDK-STX3 using anti-HA and anti-Myc antibodies, respectively, was performed. Fluorescence signals were observed using a confocal laser scanning microscope. HA-SERT appears to be expressed throuout Myc-STX3-expressing cells (arrows). In contrast, HA-SERT is preferentially expressed at the plasma membrane in non-Myc-STX3-expressing cells (arrowhead). Bar: 10 mm. B: Comparison of SERT membrane expression between STX3-overexpressing and non-STX3-expressing cells using line profiling of SERT immunofluorescence. Line profile analysis was performed along the white lines, which did not cross the nucleus. Bar: 10 mm. C: Representative line profile data from STX3-overexpressing and non-STX3-expressing cells. In non-STX3-expressing cells, the SERT fluorescence intensity is high in the cell membrane, whereas the fluorescence intensity was spread evenly in STX3-expressing cells. Red lines indicate the peak fluorescence intensity corre- sponding to the plasma membrane expression of SERT. The green line indicates the scanning distance of the line profiling. D: Quantitative analysis of SERT membrane expression using line profiling analysis. SERT membrane expression was quantitatively analyzed as described in the Materials and Methods section. Overexpression of STX3 significantly decreases the membrane expression of SERT (*p < 0.001, Student's t-test, compared with non-STX3-expressing control cells, n ¼ 39 in the non-STX3-expressing group, n ¼ 33 in the STX3-overexpressing group). Three independent experiments were conducted. SERT, serotonin transporter; STX$, syntaxin-3.
    Figure Legend Snippet: Fig. 4. Effects of STX3 overexpression on SERT membrane expression. A: Comparison of the membrane expression of HA-SERT in Myc-STX3-overexpressing and non-Myc-STX3- overexpressing cells. Immunofluorescence staining of COS-7 cells transfected with pHA-SERT and pMyc-DDK-STX3 using anti-HA and anti-Myc antibodies, respectively, was performed. Fluorescence signals were observed using a confocal laser scanning microscope. HA-SERT appears to be expressed throuout Myc-STX3-expressing cells (arrows). In contrast, HA-SERT is preferentially expressed at the plasma membrane in non-Myc-STX3-expressing cells (arrowhead). Bar: 10 mm. B: Comparison of SERT membrane expression between STX3-overexpressing and non-STX3-expressing cells using line profiling of SERT immunofluorescence. Line profile analysis was performed along the white lines, which did not cross the nucleus. Bar: 10 mm. C: Representative line profile data from STX3-overexpressing and non-STX3-expressing cells. In non-STX3-expressing cells, the SERT fluorescence intensity is high in the cell membrane, whereas the fluorescence intensity was spread evenly in STX3-expressing cells. Red lines indicate the peak fluorescence intensity corre- sponding to the plasma membrane expression of SERT. The green line indicates the scanning distance of the line profiling. D: Quantitative analysis of SERT membrane expression using line profiling analysis. SERT membrane expression was quantitatively analyzed as described in the Materials and Methods section. Overexpression of STX3 significantly decreases the membrane expression of SERT (*p < 0.001, Student's t-test, compared with non-STX3-expressing control cells, n ¼ 39 in the non-STX3-expressing group, n ¼ 33 in the STX3-overexpressing group). Three independent experiments were conducted. SERT, serotonin transporter; STX$, syntaxin-3.

    Techniques Used: Over Expression, Membrane, Expressing, Comparison, Staining, Transfection, Fluorescence, Laser-Scanning Microscopy, Clinical Proteomics, Control

    Fig. 5. Effects of STX3 knockdown on SERT uptake activity and the levels of SERT. A: Confirmation of STX3 knockdown in AD293 cells by transfection with STX3 siRNA. AD293 cells were transfected with STX3 siRNA or control siRNA concomitantly with FLAG-SERT. Immunoblotting using an anti-STX3 antibody confirmed that STX3 levels are reduced by STX3 siRNA. Similar results were obtained when COS-7 or FLAG-SERT HEK cells were used (data not shown). B: Effects of STX3 knockdown on SERT uptake activity in AD293, COS-7, and FLAG-SERT HEK cells. STX3 siRNA or control siRNA was transfected into AD293, COS-7, and FLAG-SERT HEK cells concomitantly with pFLAG-SERT. We measured the uptake of fluorescent SERT substrate per cell as the 5-HT uptake activity, as described in the Materials and Methods section. Knockdown of STX3 does not demonstrate any significant effect on SERT uptake activity in any cell type (AD293 cells: n ¼ 9, 3 independent experiments, ns, Student's t-test; FLAG-SERT HEK cells: n ¼ 9, 3 independent experiments, ns, Student's t- test; COS-7 cells: n ¼ 18, 6 independent experiments, ns, Student's t-test). C: Effects of STX3 knockdown on the protein level of SERT expressed in COS-7 cells. COS-7 cells were transfected with siRNAs and pFLAG-SERT. Immunoblotting using an anti-FLAG antibody shows that STX3 knockdown does not alter the protein levels of maturely glycosylated or immaturely glycosylated SERT (ns, n ¼ 5). SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine.
    Figure Legend Snippet: Fig. 5. Effects of STX3 knockdown on SERT uptake activity and the levels of SERT. A: Confirmation of STX3 knockdown in AD293 cells by transfection with STX3 siRNA. AD293 cells were transfected with STX3 siRNA or control siRNA concomitantly with FLAG-SERT. Immunoblotting using an anti-STX3 antibody confirmed that STX3 levels are reduced by STX3 siRNA. Similar results were obtained when COS-7 or FLAG-SERT HEK cells were used (data not shown). B: Effects of STX3 knockdown on SERT uptake activity in AD293, COS-7, and FLAG-SERT HEK cells. STX3 siRNA or control siRNA was transfected into AD293, COS-7, and FLAG-SERT HEK cells concomitantly with pFLAG-SERT. We measured the uptake of fluorescent SERT substrate per cell as the 5-HT uptake activity, as described in the Materials and Methods section. Knockdown of STX3 does not demonstrate any significant effect on SERT uptake activity in any cell type (AD293 cells: n ¼ 9, 3 independent experiments, ns, Student's t-test; FLAG-SERT HEK cells: n ¼ 9, 3 independent experiments, ns, Student's t- test; COS-7 cells: n ¼ 18, 6 independent experiments, ns, Student's t-test). C: Effects of STX3 knockdown on the protein level of SERT expressed in COS-7 cells. COS-7 cells were transfected with siRNAs and pFLAG-SERT. Immunoblotting using an anti-FLAG antibody shows that STX3 knockdown does not alter the protein levels of maturely glycosylated or immaturely glycosylated SERT (ns, n ¼ 5). SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine.

    Techniques Used: Knockdown, Activity Assay, Transfection, Control, Western Blot

    Fig. 6. Effects of STX3 knockdown on SERT glycosylation. A: Transfection with STX3 siRNA causes the maturely glycosylated SERT band to shift upward. The maturely glycosylated SERT band (arrowhead) migrates slightly upward in STX3 siRNA-transfected AD293, FLAG-SERT-HEK, and COS-7 cells. Immaturely glycosylated SERT is barely observed in AD293 and FLAG-SERT HEK cells. The figure shows representative data from three to five independent experiments. B: Effects of the glycolytic enzymes PNGaseF and EndoH on the shift of the maturely glycosylated SERT band. Lysates of AD293 cells transfected with siRNAs and pFLAG-SERT were treated with the glycolytic enzyme PNGaseF or EndoH for 2 h at 37 C and were subjected to Western blot analysis. Treatment with PNGase F shifts the band of the maturely glycosylated SERT to a molecular size of 50 kDa (asterisk). No band shift is observed in the PNGase F-treated samples (asterisk). Conversely, Endo H does not affect the size of the maturely glycosylated SERT band (triangle). The figure shows the repre- sentative data from two independent experiments. SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine.
    Figure Legend Snippet: Fig. 6. Effects of STX3 knockdown on SERT glycosylation. A: Transfection with STX3 siRNA causes the maturely glycosylated SERT band to shift upward. The maturely glycosylated SERT band (arrowhead) migrates slightly upward in STX3 siRNA-transfected AD293, FLAG-SERT-HEK, and COS-7 cells. Immaturely glycosylated SERT is barely observed in AD293 and FLAG-SERT HEK cells. The figure shows representative data from three to five independent experiments. B: Effects of the glycolytic enzymes PNGaseF and EndoH on the shift of the maturely glycosylated SERT band. Lysates of AD293 cells transfected with siRNAs and pFLAG-SERT were treated with the glycolytic enzyme PNGaseF or EndoH for 2 h at 37 C and were subjected to Western blot analysis. Treatment with PNGase F shifts the band of the maturely glycosylated SERT to a molecular size of 50 kDa (asterisk). No band shift is observed in the PNGase F-treated samples (asterisk). Conversely, Endo H does not affect the size of the maturely glycosylated SERT band (triangle). The figure shows the repre- sentative data from two independent experiments. SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine.

    Techniques Used: Knockdown, Glycoproteomics, Transfection, Western Blot, Electrophoretic Mobility Shift Assay

    Fig. 7. Confirmation of SERT mRNA expression, 5-HT uptake activity, and localization of SERT and STX3 in Caco-2 cells. A: SERT mRNA expression in various cell lines. The mRNA expression of SERT in Caco-2, COS-7, and AD293 cells was investigated by real-time PCR. The expression of SERT mRNA in Caco-2 cells is high, whereas it is extremely low in COS-7 and AD293 cells. B: 5-HT uptake activity in Caco-2 cells. Caco-2 cells seeded in 24-well plates were subjected to the [3H] 5-HT uptake assay. The left column shows 5-HT uptake activity in the absence of 20 mM fluvoxamine, an SSRI. The right column shows 5-HT uptake activity in the presence of SSRI. The results reveal the existence of 5-HT uptake activity, which is probably mediated via SSRI-sensitive endogenous SERT in Caco-2 cells (n ¼ 4). C: Comparison of colocalization of SERT and STX3 with villin, a micro- villus marker, in Caco-2 cells. Caco-2 cells were immunostained with anti-SERT or anti-STX3 antibodies. The cells were then stained with an antibody against villin, a microvillus marker. SERT and STX3 are localized in punctate structures, which almost coincides with the localization of villin. The inset presents a magnified view of the indicated area, showing that STX3 is partially colocalized with villin (lower panel). Bar: 20 mm. D: Orthographic view of X- and Y-axis cross-sections constructed from a 3D image of villin and actin. Caco- 2 cells were immunostained with an anti-villin antibody and then with phalloidin-TRITC to stain actin and visualize the cell border. Villin staining reveals microvilli-like structures at the apical membrane (arrowhead). Red signals indicate actin, and green signals indicate villin. Bar: 20 mm. E: Comparison of orthographic views of SERT and STX3 with an orthographic view of the villin. Caco-2 cells were immunostained with anti-SERT or anti-STX3 antibodies. The cells were then stained with phalloidin-TRITC. Orthographic views of SERT and STX3 staining demonstrate that like villin (arrowhead), both SERT and STX are localized in microvilli-like structures. Red signals indicate actin, and green signals indicate SERT or STX3. Bar: 20 mm. SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine; SSRI, selective serotonin reuptake inhibitor.
    Figure Legend Snippet: Fig. 7. Confirmation of SERT mRNA expression, 5-HT uptake activity, and localization of SERT and STX3 in Caco-2 cells. A: SERT mRNA expression in various cell lines. The mRNA expression of SERT in Caco-2, COS-7, and AD293 cells was investigated by real-time PCR. The expression of SERT mRNA in Caco-2 cells is high, whereas it is extremely low in COS-7 and AD293 cells. B: 5-HT uptake activity in Caco-2 cells. Caco-2 cells seeded in 24-well plates were subjected to the [3H] 5-HT uptake assay. The left column shows 5-HT uptake activity in the absence of 20 mM fluvoxamine, an SSRI. The right column shows 5-HT uptake activity in the presence of SSRI. The results reveal the existence of 5-HT uptake activity, which is probably mediated via SSRI-sensitive endogenous SERT in Caco-2 cells (n ¼ 4). C: Comparison of colocalization of SERT and STX3 with villin, a micro- villus marker, in Caco-2 cells. Caco-2 cells were immunostained with anti-SERT or anti-STX3 antibodies. The cells were then stained with an antibody against villin, a microvillus marker. SERT and STX3 are localized in punctate structures, which almost coincides with the localization of villin. The inset presents a magnified view of the indicated area, showing that STX3 is partially colocalized with villin (lower panel). Bar: 20 mm. D: Orthographic view of X- and Y-axis cross-sections constructed from a 3D image of villin and actin. Caco- 2 cells were immunostained with an anti-villin antibody and then with phalloidin-TRITC to stain actin and visualize the cell border. Villin staining reveals microvilli-like structures at the apical membrane (arrowhead). Red signals indicate actin, and green signals indicate villin. Bar: 20 mm. E: Comparison of orthographic views of SERT and STX3 with an orthographic view of the villin. Caco-2 cells were immunostained with anti-SERT or anti-STX3 antibodies. The cells were then stained with phalloidin-TRITC. Orthographic views of SERT and STX3 staining demonstrate that like villin (arrowhead), both SERT and STX are localized in microvilli-like structures. Red signals indicate actin, and green signals indicate SERT or STX3. Bar: 20 mm. SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5-hydroxytryptamine; SSRI, selective serotonin reuptake inhibitor.

    Techniques Used: Expressing, Activity Assay, Real-time Polymerase Chain Reaction, Comparison, Marker, Staining, Construct, Membrane

    Fig. 8. Effects of STX3 knockdown on 5-HT uptake in Caco-2 cells. A: Confirmation of STX3 knockdown in Caco-2 cells. Caco-2 cells were transfected with either the control or STX3 siRNA. Immunoblotting analysis using an anti-STX3 antibody was performed 48 h after transfection. Transfection with STX3 siRNA reduces the levels of STX3 in Caco-2 cells. B: Effects of STX3 knockdown on 5-HT uptake in Caco-2 cells. A [3H] 5-HT uptake assay was performed 48 h after transfection. Transfection with STX3 siRNA marginally but significantly reduces 5-HT uptake activity in Caco-2 cells (*p < 0.00.5 (Student's t-test, n ¼ 28, 7 independent experiments). SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5- hydroxytryptamine.
    Figure Legend Snippet: Fig. 8. Effects of STX3 knockdown on 5-HT uptake in Caco-2 cells. A: Confirmation of STX3 knockdown in Caco-2 cells. Caco-2 cells were transfected with either the control or STX3 siRNA. Immunoblotting analysis using an anti-STX3 antibody was performed 48 h after transfection. Transfection with STX3 siRNA reduces the levels of STX3 in Caco-2 cells. B: Effects of STX3 knockdown on 5-HT uptake in Caco-2 cells. A [3H] 5-HT uptake assay was performed 48 h after transfection. Transfection with STX3 siRNA marginally but significantly reduces 5-HT uptake activity in Caco-2 cells (*p < 0.00.5 (Student's t-test, n ¼ 28, 7 independent experiments). SERT, serotonin transporter; STX$, syntaxin-3; 5-HT, 5- hydroxytryptamine.

    Techniques Used: Knockdown, Transfection, Control, Western Blot, Activity Assay

    Related Articles

    Expressing:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Immunoprecipitation:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Transfection:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Plasmid Preparation:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Western Blot:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Comparison:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Labeling:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Over Expression:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Activity Assay:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Glycoproteomics:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Control:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Functional Assay:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Clinical Proteomics:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Membrane:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Staining:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Fluorescence:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Laser-Scanning Microscopy:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Knockdown:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Electrophoretic Mobility Shift Assay:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Real-time Polymerase Chain Reaction:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Marker:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).

    Construct:

    Article Title: Syntaxin 3 interacts with serotonin transporter and regulates its function.
    Article Snippet: Negative control siRNA was purchased from Ambion, Inc. (negative control No.1 siRNA, Austin, TX).



    Similar Products

    anti syntaxin3 rabbit polyclonal antibody  (Alomone Labs)
    90
    Alomone Labs anti syntaxin3 rabbit polyclonal antibody
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Anti Syntaxin3 Rabbit Polyclonal Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Anti-Syntaxin+3+Antibody/pm30522963-39-1-8
    Average 90 stars, based on 1 article reviews
    anti syntaxin3 rabbit polyclonal antibody - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    syntaxin3 ddk  (OriGene)
    92
    OriGene syntaxin3 ddk
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3 Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+(STX3)+(NM_004177)+Human+Recombinant+Protein/pmc10963788-377-1-2
    Average 92 stars, based on 1 article reviews
    syntaxin3 ddk - by Bioz Stars, 2026-11
    92/100 stars
    		  Buy from Supplier
    syntaxin3 (rb) proteintech 15556-1-ap  (Proteintech)
    93
    Proteintech syntaxin3 (rb) proteintech 15556-1-ap
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3 (Rb) Proteintech 15556 1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+Antibody/pmc10500017__41467_2023_41450_MOESM1_ESM-40-117-119
    Average 93 stars, based on 1 article reviews
    syntaxin3 (rb) proteintech 15556-1-ap - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    syntaxin3  (Proteintech)
    93
    Proteintech syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Syntaxin+3+Antibody/pm37351635-50-32-30
    Average 93 stars, based on 1 article reviews
    syntaxin3 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    rabbit anti-syntaxin3  (Synaptic Systems)
    90
    Synaptic Systems rabbit anti-syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Rabbit Anti Syntaxin3, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/syntaxin+2+antibody/pm38026697-52-1-6
    Average 90 stars, based on 1 article reviews
    rabbit anti-syntaxin3 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    syntaxin3  (Danaher Inc)
    86
    Danaher Inc syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Syntaxin3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/10__7554_slash_elife__80135-233-112-118
    Average 86 stars, based on 1 article reviews
    syntaxin3 - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    recombinant protein corresponding to aa 1 to 260 from rat syntaxin3  (ImmunoGen Inc)
    90
    ImmunoGen Inc recombinant protein corresponding to aa 1 to 260 from rat syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Recombinant Protein Corresponding To Aa 1 To 260 From Rat Syntaxin3, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/recombinant+protein+corresponding+to+aa+1+to+260+from+rat+syntaxin3/pmc09622911__41467_2022_33986_MOESM3_ESM-44-17-7
    Average 90 stars, based on 1 article reviews
    recombinant protein corresponding to aa 1 to 260 from rat syntaxin3 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    control antigen syntaxin3 rabbit 100 synaptic systems  (Synaptic Systems)
    92
    Synaptic Systems control antigen syntaxin3 rabbit 100 synaptic systems
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Control Antigen Syntaxin3 Rabbit 100 Synaptic Systems, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/110+033/pm34168338-684-20-25
    Average 92 stars, based on 1 article reviews
    control antigen syntaxin3 rabbit 100 synaptic systems - by Bioz Stars, 2026-11
    92/100 stars
    		  Buy from Supplier
    accg gtcgac atgaaggaccgtctggagcag reverse sacii syntaxin3  (TaKaRa)
    96
    TaKaRa accg gtcgac atgaaggaccgtctggagcag reverse sacii syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Accg Gtcgac Atgaaggaccgtctggagcag Reverse Sacii Syntaxin3, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/Sac+II/bio_rxiv__2019__12__24__886648-173-25-41
    Average 96 stars, based on 1 article reviews
    accg gtcgac atgaaggaccgtctggagcag reverse sacii syntaxin3 - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    anti-syntaxin3  (Synaptic Systems)
    90
    Synaptic Systems anti-syntaxin3
    Fig. 4. Effects of SKF-10047 on the protein expression of <t>Syntaxin3</t> (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).
    Anti Syntaxin3, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/syntaxin3/syntaxin+2+antibody/pmc06930865-156-22-37
    Average 90 stars, based on 1 article reviews
    anti-syntaxin3 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Fig. 4. Effects of SKF-10047 on the protein expression of Syntaxin3 (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).

    Journal: Journal of pharmacological sciences

    Article Title: SKF-10047, a prototype Sigma-1 receptor agonist, augmented the membrane trafficking and uptake activity of the serotonin transporter and its C-terminus-deleted mutant via a Sigma-1 receptor-independent mechanism.

    doi: 10.1016/j.jphs.2018.11.005

    Figure Lengend Snippet: Fig. 4. Effects of SKF-10047 on the protein expression of Syntaxin3 (STX3). Syntaxin3 consists of some isoforms, produced by alternative splicing (https://www.uniprot. org/uniprot/Q13277). According to the predictive molecular size of isoforms, the isoform A and isoform B, main isoforms of STX3 were considered to be detected in COS-7 cells (left). Treatment of COS-7 cells with SKF-10047 for 48 h significantly increased the protein levels of both STX3 isoforms in a dose-dependent manner. Statistical analysis was performed for isoform B (*P < 0.05, n ¼ 3, one-way ANOVA with Dunnett's post-test).

    Article Snippet: An anti-Syntaxin3 rabbit polyclonal antibody was purchased from Alomone labs. (Jerusalem, Israel).

    Techniques: Expressing, Produced, Alternative Splicing

    Fig. 5. Influence of knockdown or overexpression of Syntaxin3 on the incremental effects of SKF-10047 on the SERTDCT uptake activity. We examined the effects of SKF-10047 on the SERTDCT uptake activity in STX3-knockdown or STX3-overexpressing COS-7 cells, and compared the increasing rate in these cells to that in control cells. A: Validation of STX3 knockdown by STX3 siRNA (upper) and overexpression by pMyc-DDK-STX3 (lower) in COS-7 cells. The transfection of STX3 siRNA #1 and #2 reduced the expression of STX3 isoform A, a functional isoform, by 53% and 56%, respectively (upper). In pMyc-DDK-STX3-transfected cells, prominent expression of Myc-DDK-STX3 was seen in addition to endogenous STX3, isoform A and B. B: Effects of SKF-10047 on the uptake activity of SERTDCT in control siRNA-transfected COS-7 cells and STX3 siRNA #2-transfected COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 was similar in control siRNA-transfected cells and STX3 siRNA-transfected cells (n ¼ 4, ns, unpaired t-test). C: Effects of SKF-10047 on the uptake activity of SERTDCT in mock-transfected COS-7 cells and Myc-DDK-STX3-expressing COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 in Myc-DDK-STX3-expressing cells was significantly higher than that in mock-transfected cells (n ¼ 4, P < 0.001, unpaired t-test).

    Journal: Journal of pharmacological sciences

    Article Title: SKF-10047, a prototype Sigma-1 receptor agonist, augmented the membrane trafficking and uptake activity of the serotonin transporter and its C-terminus-deleted mutant via a Sigma-1 receptor-independent mechanism.

    doi: 10.1016/j.jphs.2018.11.005

    Figure Lengend Snippet: Fig. 5. Influence of knockdown or overexpression of Syntaxin3 on the incremental effects of SKF-10047 on the SERTDCT uptake activity. We examined the effects of SKF-10047 on the SERTDCT uptake activity in STX3-knockdown or STX3-overexpressing COS-7 cells, and compared the increasing rate in these cells to that in control cells. A: Validation of STX3 knockdown by STX3 siRNA (upper) and overexpression by pMyc-DDK-STX3 (lower) in COS-7 cells. The transfection of STX3 siRNA #1 and #2 reduced the expression of STX3 isoform A, a functional isoform, by 53% and 56%, respectively (upper). In pMyc-DDK-STX3-transfected cells, prominent expression of Myc-DDK-STX3 was seen in addition to endogenous STX3, isoform A and B. B: Effects of SKF-10047 on the uptake activity of SERTDCT in control siRNA-transfected COS-7 cells and STX3 siRNA #2-transfected COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 was similar in control siRNA-transfected cells and STX3 siRNA-transfected cells (n ¼ 4, ns, unpaired t-test). C: Effects of SKF-10047 on the uptake activity of SERTDCT in mock-transfected COS-7 cells and Myc-DDK-STX3-expressing COS-7 cells. In both cells, 200 mM SKF-10047 significantly increased the uptake activity of SERTDCT (n ¼ 4, P < 0.001, unpaired t-test). The increase in SERTDCT uptake activity induced by 200 mM SKF-10047 in Myc-DDK-STX3-expressing cells was significantly higher than that in mock-transfected cells (n ¼ 4, P < 0.001, unpaired t-test).

    Article Snippet: An anti-Syntaxin3 rabbit polyclonal antibody was purchased from Alomone labs. (Jerusalem, Israel).

    Techniques: Knockdown, Over Expression, Activity Assay, Control, Biomarker Discovery, Transfection, Expressing, Functional Assay