superscript iv reverse transcriptase (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher superscript iv reverse transcriptase
Superscript Iv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1693 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscripttm+iv+reverse+transcriptase+kit/PureLink+RNA+Mini+Kit/ppr0473485-149-16-21
Average 99 stars, based on 1693 article reviews

superscript iv reverse transcriptase - by Bioz Stars, 2026-09

99/100 stars

Images

other:

Article Title: Regulation of RNA localization during oocyte maturation by dynamic RNA-ER association and remodeling of the ER
Article Snippet: PureLink TM RNA Mini Kit , Ambion , Cat. 12183025.

Article Title: Nuclease-dead S. aureus Cas9 downregulates alpha-synuclein and reduces mtDNA damage and oxidative stress levels in patient-derived stem cell model of Parkinson’s disease
Article Snippet: RNA extraction and DNase treatment were performed using the PureLinkTM RNA Mini Kit (ThermoFisher, Cat. No. 12183025) following manufacturer’s guidelines.

Real-time Polymerase Chain Reaction:

Article Title: 1,25(OH) 2 D 3 Alters Growth Plate Maturation and Bone Architecture in Young Rats with Normal Renal Function
Article Snippet: RNA was extracted using TRI-reagent (Sigma-Aldrich) according to manufacturer's instructions. .. 1 μg of total RNA was reversed transcribed using High Capacity cDNA kit (Applied Biosystems). cDNA was diluted 1∶25 and used for real-time PCR using Platinum SYBR Green qPCR SuperMix-UDG with ROX (Invitrogen) to measure gene expression using specific primers sets: Collagen typeII(f) GAACAGCATCGCCTACCTGG , Collagen typeII(r) TGTTTCGTGCAGCCATCCT ; Sox9(f) GCATCTGCACAACGCGG , Sox9(r) CTCGTTCAGCAGCCTCCAG ; Runx2(f) AGGCACAGACAGAAGCTTGATG , Runx2(r) GCGATCAGAGAACAAACTAGGTTTAGA ; MMP2(f) ATTGACGCTGTGTATGAGGCC , MMP2(r) ACTCATTCCCTGCGAAGAACA ; MMP9(f) AGCCCCTGCTCCTGGCTCTC , MMP9(r) CTGCCAGCTGGGTGTCCGTG ; GAPDH(f) TGACGTGCCGCCTGGAGAAA , GAPDH(r) AGTGTAGCCCAAGATGCCCTT . ..

SYBR Green Assay:

Gene Expression:

RNA Extraction:

Article Title: Semi-quantitative detection of pseudouridine modifications and type I/II hypermodifications in human mRNAs using direct long-read sequencing
Article Snippet: .. The total RNA extraction protocol was performed using a method that is the combination of total RNA extraction using TRIzol (Invitrogen,15596026) and PureLink RNA Mini Kit (Invitrogen, 12183025). .. Cells were washed with 3 ml ice-cold PBS and added with 2 ml of TRIzol in each 10 cm dish and incubated at room temperature for 5 min. Every 1 ml of lysed cells in TRIzol was transferred to a LoBind Eppendorf tube and vortexed for 30 s and added with 200 μl chloroform (Acros Organics,423555000) in each tube and mixed by shaking for 15 s and incubated at room temperature for 3 min. Then the samples were centrifuged at 12000 × G for 15 min at 4 °C and 0.4 ml of aqueous supernatant was transferred to a fresh LoBind Eppendorf tube and an equal volume of 70% ethanol was added to the solution followed by vortexing.

Review