Review



reagents for stem-loop reverse transcription  (Ribobio co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Ribobio co reagents for stem-loop reverse transcription
    Reagents For Stem Loop Reverse Transcription, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/stem+loop+reverse+transcriptase+primer+kit/pm39752926-88-3-16
    Average 90 stars, based on 1 article reviews
    reagents for stem-loop reverse transcription - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
    Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

    Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
    Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

    Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
    Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

    Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
    Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

    Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
    Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

    Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
    Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

    Amplification:

    Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
    Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

    Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
    Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

    Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
    Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

    Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
    Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

    Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
    Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

    Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
    Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

    Polymerase Chain Reaction:

    Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
    Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

    Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
    Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

    Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
    Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

    Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
    Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

    Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
    Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

    Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
    Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

    Sequencing:

    Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
    Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

    Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
    Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

    Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
    Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

    Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
    Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

    Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
    Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

    Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
    Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.

    DNA Synthesis:

    Article Title: Signal-On Fluorescence Biosensor for Detection of miRNA-21 Based on ROX labeled Specific Stem-Loop Probe.
    Article Snippet: The stem-loop reverse transcription (RT) primers and amplification primers for U6 were sourced from Ribobio Co., Ltd., in Guangzhou, China.

    Article Title: Comprehensive analysis of BUBs gene family in lung adenocarcinoma with immunological analysis.
    Article Snippet: The stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to realize the reverse transcription of the mRNA samples.

    Article Title: Bioinspired Nanovesicles Convert the Skeletal Endothelium-Associated Secretory Phenotype to Treat Osteoporosis.
    Article Snippet: Recently, bone marrow endothelial cells (BMECs) were found to play an important role in regulating bone homeostasis.. However, few studies utilized BMECs to treat bone metabolic diseases including osteoporosis.. Here, we reported bioinspired nanovesicles (BNVs) prepared from human induced pluripotent stem cells-derived endothelial cells under hypoxia culture through an extrusion approach.

    Article Title: Placental extracellular vesicles induce ovarian tumour cell death in an ex vivo explant model: Possible therapeutic potential.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-519a-5p, miRNA-512–3p, and miRNA143–3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Circulating miRNA-155 as a Potential Biomarker for Coronary Slow Flow
    Article Snippet: The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China).

    Article Title: Placental extracellular vesicles promoted cervical tumour tissue undergoing death.
    Article Snippet: All reagents for stem-loop reverse transcription and primers of miRNA-143-3p, miRNA-519a-5p, and miRNA-199a-3p were purchased from RiboBio (Guangzhou, China).

    Article Title: Magnetofection of miR-21 promoted by electromagnetic field and iron oxide nanoparticles via the p38 MAPK pathway contributes to osteogenesis and angiogenesis for intervertebral fusion
    Article Snippet: The extracted RNA was reverse-transcribed into cDNA with the stem-loop reverse transcriptase primer Kit (Ribobio, Guangzhou, China).

    Article Title: Exosomal Manf originated from endothelium regulated osteoclast differentiation by down-regulating NF-κB signaling pathway.
    Article Snippet: Subsequently, a stem-loop reverse transcriptase primer kit (Ribobio, Guangzhou, China) was used to reverse-transcribe miRNA samples.



    Similar Products

    86
    Shanghai Jierui Investment Partnership mirna stem loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Mirna Stem Loop Primers, supplied by Shanghai Jierui Investment Partnership, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/loop+mirna+primers+stem/pmc13276775-134-1-4
    Average 86 stars, based on 1 article reviews
    mirna stem loop primers - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Eurofins stem loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Stem Loop Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/primers+qpcr+rt/pm41816892-202-4-9
    Average 86 stars, based on 1 article reviews
    stem loop primers - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher stem loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Stem Loop Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/SUCROSE+EP%2FBP%2FNF+12KG/pm41816892-204-2-20
    Average 99 stars, based on 1 article reviews
    stem loop primers - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    tiangen biotech co mirna specific stem loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Mirna Specific Stem Loop Primers, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/FastKing+RT+Kit/bio_rxiv__64898__2026__02__26__708094-48-24-19
    Average 99 stars, based on 1 article reviews
    mirna specific stem loop primers - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Sangon Biotech stem loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Stem Loop Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/loop+primer+rt+stem/pm41483498-106-1-3
    Average 86 stars, based on 1 article reviews
    stem loop primers - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech stem loop rt primer based mirna cdna synthesis kit
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Stem Loop Rt Primer Based Mirna Cdna Synthesis Kit, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/cdna+first+kit+mirna+strand+synthesis/pmc12596877-77-8-16
    Average 86 stars, based on 1 article reviews
    stem loop rt primer based mirna cdna synthesis kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma stem–loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Stem–Loop Primers, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/stem+loop+primers/pmc12153334-99-7-20
    Average 90 stars, based on 1 article reviews
    stem–loop primers - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher specific stem-loop primers
    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed <t>miRNAs</t> between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.
    Specific Stem Loop Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stem+loop+primers/stem+loop+rt+primer/pmc12256415-65-13-15
    Average 90 stars, based on 1 article reviews
    specific stem-loop primers - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed miRNAs between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.

    Journal: Bioactive Materials

    Article Title: Exercise-derived exosomal miR-151-3p: An innovative anti-inflammatory and antioxidant therapeutic for spinal cord injury

    doi: 10.1016/j.bioactmat.2026.06.009

    Figure Lengend Snippet: miR-151-3p is a key functional cargo in Exe-Exos mediating anti-apoptotic and antioxidant effects. (A – B) Differentially expressed miRNAs between Exe-Exos and Sed-Exos groups (q < 0.05, |log 2 FC| > 1). (C) RT-qPCR validation of 10 differentially expressed miRNAs. (D) Flow cytometry analysis of apoptosis in OGD/R, OGD/R + Exos, and OGD/R + Exos + miR-151-3p groups. (E) Quantification of apoptotic cell percentage (n = 3 independent cell culture experiments). (F) LDH activity (U/L; n = 5 independent cell culture experiments). (G) WB and (H – M) quantification of p-JNK, JNK, C-Caspase9, Caspase9, C-Caspase3, and Caspase3 protein expression (n = 6 independent biological replicates). Exos exosomes, JNK c-Jun N-terminal kinase.

    Article Snippet: The miRNA stem-loop primers (Shanghai Jierui Bioengineering) are listed in .

    Techniques: Functional Assay, Quantitative RT-PCR, Biomarker Discovery, Flow Cytometry, Cell Culture, Activity Assay, Expressing