prism 5 (graphpad) software package (GraphPad Software Inc)
GraphPad Software Inc is a verified supplier 
90
Structured Review
GraphPad Software Inc
prism 5 (graphpad) software package
Prism 5 (Graphpad) Software Package, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/statistical+program+graphpad+prism+5/statistical+software+graphpad+prism+5/pmc07224104-208-2-4
Average 90 stars, based on 1 article reviews
Prism 5 (Graphpad) Software Package, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/statistical+program+graphpad+prism+5/statistical+software+graphpad+prism+5/pmc07224104-208-2-4
Average 90 stars, based on 1 article reviews
prism 5 (graphpad) software package - by Bioz Stars,
2026-11
90/100 stars
Images
Related Articles
other:Article Title: Multi-omics analyses of cancer-linked clinical salmonellae reveal bacterial-induced host metabolic shift and mTOR-dependent cell transformation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse Embryonic Fibroblasts Arf-/-; cMYC+ (MEF NTR) Neefjes Lab Scanu et al.11 N/A MEF TR Ref strain This study N/A MEF TR CA_SE_10 This study N/A Caco-2 ATCC HTB-37 Oligonucleotides NdeI cEndo LAMP1 5 fw (actacgcatatgtctctgcagcggcttccc) Integrated DNA Technologies N/A NheI cEndo LAMP1 5 rv (actacggctagcgatagtctggtagcctgcgtgac) Integrated DNA Technologies N/A BglII cEndo LAMP1 3 fw (actacgagatcttagcctggtgcacgcagg) Integrated DNA Technologies N/A SalI cEndo LAMP1 3 rv (actacggtcgacaccccctcagagagagcacc) Integrated DNA Technologies N/A cEndo LAMP1 gRNA S:95 fw (caccgctatctagcctggtgcacgc) Integrated DNA Technologies N/A cEndo LAMP1 gRNA S:95 rv (aaacgcgtgcaccaggctagatagc) Integrated DNA Technologies N/A PsseA fwd Asp718 (cccaggtacccgtattcttgattttcatcggtgg) Integrated DNA Technologies Article Title: A Microtubule‐Associated Protein Functions in Preventing Oocytes from Evading the Spindle Assembly Checkpoint Article Snippet: Data were analyzed by paired‐samples t‐test, which was provided by Article Title: Cytotoxic properties of Thuya occidentalis hydroalcoholic extract on androgen unresponsive prostate cancer cells. Article Snippet: Background: androgen independent phase in prostate cancer (PCa) commonly limits the therapeutic efficacy.. Thuya occidentalis through its main active compound, α-thujone, appears to be an option, considering its anti-proliferative, anti-metastatic and pro-apoptotic effects on hepatocellular carcinoma.. However, studies on PCa are limited. Article Title: Novel Magnesium- and Silver-Loaded Dressing Promotes Tissue Regeneration in Cutaneous Wounds Article Snippet: Statistical analysis was computed using Software:Article Title: Transmembrane thiol isomerase TMX1 inhibits fibrin formation by down-regulation of platelet phosphatidylserine exposure. Article Snippet: .. Data were analyzed using the statistical software Article Title: Assessment of clinical effectiveness and safety of ceftazidime-avibactam in -treating multi-drug-resistant infections - A retrospective analysis at a tertiary care hospital in Saudi Arabia. Article Snippet: .. We reviewed the data and analyzed it using a statistical software, Article Title: Strategy to mitigate aggregation during Protein A chromatography and low pH virus inactivation for a nivolumab biosimilar candidate. Article Snippet: Protein A chromatography represents the most prevalent methodology for the capture of monoclonal antibodies.. The use of a low pH elution buffer from Protein A has been observed to contribute to product aggregation, particularly in the case of IgG4 antibodies, such as nivolumab.. This paper presents a well-defined strategy for addressing this issue. |