Review



renilla luciferase expression vector prl-cmv  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Promega renilla luciferase expression vector prl-cmv
    EEAC inhibits activation and lowers mRNA level of <t>STAT3</t> in human HCC cells. Cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of (A) p-STAT3 and STAT3 and (B) p-JAK2 and JAK2 were determined by Western blot analyses. The relative protein levels were analyzed by Image J software. (C) mRNA levels of STAT3 (upper panel) and JAK2 (lower panel) in HepG2 and SMMC-7721 cells were detected by qRT-PCR. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.
    Renilla Luciferase Expression Vector Prl Cmv, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/pgl3+basic/pmc06304454-89-8-20
    Average 90 stars, based on 1 article reviews
    renilla luciferase expression vector prl-cmv - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Antrodia camphorata Mycelia Exert Anti-liver Cancer Effects and Inhibit STAT3 Signaling in vitro and in vivo"

    Article Title: Antrodia camphorata Mycelia Exert Anti-liver Cancer Effects and Inhibit STAT3 Signaling in vitro and in vivo

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.01449

    EEAC inhibits activation and lowers mRNA level of STAT3 in human HCC cells. Cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of (A) p-STAT3 and STAT3 and (B) p-JAK2 and JAK2 were determined by Western blot analyses. The relative protein levels were analyzed by Image J software. (C) mRNA levels of STAT3 (upper panel) and JAK2 (lower panel) in HepG2 and SMMC-7721 cells were detected by qRT-PCR. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.
    Figure Legend Snippet: EEAC inhibits activation and lowers mRNA level of STAT3 in human HCC cells. Cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of (A) p-STAT3 and STAT3 and (B) p-JAK2 and JAK2 were determined by Western blot analyses. The relative protein levels were analyzed by Image J software. (C) mRNA levels of STAT3 (upper panel) and JAK2 (lower panel) in HepG2 and SMMC-7721 cells were detected by qRT-PCR. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.

    Techniques Used: Activation Assay, Western Blot, Software, Quantitative RT-PCR

    EEAC reduces STAT3 nuclear pool and suppresses STAT3-luciferase reporter activity in human HCC cells. (A) Protein levels of STAT3 in cytoplasmic and nuclear extracts. HepG2 cells were treated with indicated concentrations of EEAC for 24 h. Protein levels of STAT3 were determined by Western blot analyses (left) and relative expression levels were analyzed by Image J software (right). GAPDH and SP1 were served as loading controls of cytoplasmic and nuclear extractions, respectively. (B) HepG2 cells were transfected with STAT3-luciferase reporter plasmid with a PRL-CMV construct for 48 h, and then treated with EEAC at indicated concentrations for another 24 h. Transcriptional activity of STAT3 was measured by the dual-luciferase reporter assay. Data were shown as mean ± SD of three independent experiments. ∗∗ P < 0.01 vs. the control.
    Figure Legend Snippet: EEAC reduces STAT3 nuclear pool and suppresses STAT3-luciferase reporter activity in human HCC cells. (A) Protein levels of STAT3 in cytoplasmic and nuclear extracts. HepG2 cells were treated with indicated concentrations of EEAC for 24 h. Protein levels of STAT3 were determined by Western blot analyses (left) and relative expression levels were analyzed by Image J software (right). GAPDH and SP1 were served as loading controls of cytoplasmic and nuclear extractions, respectively. (B) HepG2 cells were transfected with STAT3-luciferase reporter plasmid with a PRL-CMV construct for 48 h, and then treated with EEAC at indicated concentrations for another 24 h. Transcriptional activity of STAT3 was measured by the dual-luciferase reporter assay. Data were shown as mean ± SD of three independent experiments. ∗∗ P < 0.01 vs. the control.

    Techniques Used: Luciferase, Activity Assay, Western Blot, Expressing, Software, Transfection, Plasmid Preparation, Construct, Reporter Assay

    EEAC downregulates protein levels of STAT3-targeted molecules. HepG2 (A) and SMMC-7721 (B) cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of Bcl-2, Bcl-xL, MMP-2 and MMP-9 were determined by immunoblotting. The relative protein levels were analyzed by Image J software and shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.
    Figure Legend Snippet: EEAC downregulates protein levels of STAT3-targeted molecules. HepG2 (A) and SMMC-7721 (B) cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of Bcl-2, Bcl-xL, MMP-2 and MMP-9 were determined by immunoblotting. The relative protein levels were analyzed by Image J software and shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.

    Techniques Used: Western Blot, Software

    Over-activation of STAT3 in HepG2 cells diminishes the cytotoxic effects of EEAC. (A) Protein levels of STAT3 and p-STAT3. HepG2 cells were transiently transfected with either an empty vector or an STAT3C-expressing construct for 48 h, and then total cell lysates were extracted for Western blot analyses. (B) After transfection, HepG2 cells were treated with EEAC for 48 h, the cell viability was determined by the MTT assay. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05 vs. cells transfected with the empty vector.
    Figure Legend Snippet: Over-activation of STAT3 in HepG2 cells diminishes the cytotoxic effects of EEAC. (A) Protein levels of STAT3 and p-STAT3. HepG2 cells were transiently transfected with either an empty vector or an STAT3C-expressing construct for 48 h, and then total cell lysates were extracted for Western blot analyses. (B) After transfection, HepG2 cells were treated with EEAC for 48 h, the cell viability was determined by the MTT assay. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05 vs. cells transfected with the empty vector.

    Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Expressing, Construct, Western Blot, MTT Assay

    EEAC suppresses tumor growth in SMMC-7721 cell-bearing mice. Nude mice bearing SMMC-7721 xenograft were treated with EEAC for 18 days. (A) Tumor volume. (B) Representative tumors removed from mice. Tumor weights were recorded. In (A,B) , data were presented as mean ± SEM, n = 6. (C) TUNEL assays for apoptosis in tumor tissues collected from three individual mice. (D) Western blot analyses for protein levels of p-STAT3, STAT3, p-JAK2 and JAK2 (left panel) and the relative protein levels were analyzed by Image J software (right panel). Data were shown as mean ± SEM, n = 3. ∗ P < 0.05, ∗∗ P < 0.01 vs. vehicle control.
    Figure Legend Snippet: EEAC suppresses tumor growth in SMMC-7721 cell-bearing mice. Nude mice bearing SMMC-7721 xenograft were treated with EEAC for 18 days. (A) Tumor volume. (B) Representative tumors removed from mice. Tumor weights were recorded. In (A,B) , data were presented as mean ± SEM, n = 6. (C) TUNEL assays for apoptosis in tumor tissues collected from three individual mice. (D) Western blot analyses for protein levels of p-STAT3, STAT3, p-JAK2 and JAK2 (left panel) and the relative protein levels were analyzed by Image J software (right panel). Data were shown as mean ± SEM, n = 3. ∗ P < 0.05, ∗∗ P < 0.01 vs. vehicle control.

    Techniques Used: TUNEL Assay, Western Blot, Software

    Related Articles

    Luciferase:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Activity Assay:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Plasmid Preparation:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    Control:

    Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism
    Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg luciferase reporter plasmids and 80 ng of Renilla luciferase plasmid pRL-SV40 (Promega) as an internal control in 12 well plates. ..

    other:

    Article Title:
    Article Snippet: The plasmids for enhancer activity analysis were generated from pNL1.1 (Promega, N1001) (Supplemental Fig. S9B), and the plasmid served as the internal reference was generated from pGL4.10 (Promega, E6651) by insert a promoter of BmNPV ie-1 before luc2 (Supplemental Fig. S9A), which enables stable expression of the reference luciferase in BmN cells.

    Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas
    Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into pGL3-basic luciferase rep plasmid (Promega Corporation) to form EGR1 luciferase reporters.

    Article Title: Folie 1
    Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, rRluc renilla luciferase Promega (E691A) pGL3-TGFb1 pGL3 Human TGFb1 promoter luciferase RRID:Addgene_ 101762 References: 1.

    Article Title:
    Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and pGL4.45[luc2P/ISRE/Hygro] (Promega) (100 ng) were transfected with Mirus TransIT-LT1 into 5x106 HEK293T cells in a 10 cm2 dish in DMEM high glucose with 5% FBS per manufacturer guidelines.

    Article Title:
    Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by FuGENE HD Transfection Reagent 212 (Promega) into Sf9 cells.

    Article Title:
    Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega).

    Article Title:
    Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into SH-SY5Y cells (7.5×105) using FuGENE HD Transfection Reagent (Promega) in a 6-well culture plate.



    Similar Products

    96
    OriGene stat3 expression construct
    Stat3 Expression Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/pCMV6-XL4+Mammalian+Expression+Vector/pm42162632-58-3-16
    Average 96 stars, based on 1 article reviews
    stat3 expression construct - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc expression vectors encoding stat3
    Expression Vectors Encoding Stat3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/Stat3+(A662C%2CN664C%2CV667L)-pcw107-V5+(Plasmid+%2364555)/pmc12234153-460-0-12
    Average 93 stars, based on 1 article reviews
    expression vectors encoding stat3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc stat3 expression vectors with different tags
    Stat3 Expression Vectors With Different Tags, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/pcdna3+1/pmc10907978-141-5-9
    Average 90 stars, based on 1 article reviews
    stat3 expression vectors with different tags - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc stat3 expression vectors
    ( A and B ) Expression of ZDHHC7 and LYPLA2 genes in HCC (N = 369) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). (A) Kaplan-Meier curves of ZDHHC7 and LYPLA2 genes were performed in Gepia using HCC samples. (B) Expression of ZDHHC7 and LYPLA2 genes in different stages of HCC patients (N = 369) were performed in Gepia. ( C ) Differentially expressed ZDHHC7 and LYPLA2 genes in HCC (N = 369) and normal liver (N = 50) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). TPM, Transcripts Per Million. ( D ) Human cDNA reverse transcripts from 30 patients with HCC (Cohort 1), and ZDHHC7 were analyzed using rtPCR. N = 30 HCC patients. ( E ) Volcano plot of differentially expressed genes (DEGs) in HCC (N = 369) and normal liver (N = 50) samples from TCGA data was visualized. An over 1.41-fold increase and decrease in DEGs in HCC are shown in red and green respectively. ( F ) Venn diagram of both ZDHHC7 and LYPLA2 correlated genes was performed using HCC (N = 369) samples from TCGA data (the absolute Spearman’s correlation R value is above 0.5). ( G ) HCC cells were transfected with indicated <t>Flag-STAT3,DHHC7</t> WT, or catalytic mutant counterparts. The cells were labeled with or without Alk14. STAT3 was pulled down, followed by in-gel fluorescence or western blot analyses (left) and quantified (right) as indicated. CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. ( H ) Western blots of ZDHHC7 knockdown HCC and control cells (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( I ) Colony formation assay of ZDHHC7 knockdown HCC cells and control cells was performed and colony numbers were counted and normalized (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. ** p < 0.01, by Two-tailed unpaired student’s t-test.
    Stat3 Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/Stat3+(A662C%2CN664C%2CV667L)-pcw107-V5+(Plasmid+%2364555)/pmc10907978-141-0-9
    Average 93 stars, based on 1 article reviews
    stat3 expression vectors - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Shanghai Genechem Ltd adeno-associated virus 9 vectors expressing mouse stat3 shrna
    ( A and B ) Expression of ZDHHC7 and LYPLA2 genes in HCC (N = 369) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). (A) Kaplan-Meier curves of ZDHHC7 and LYPLA2 genes were performed in Gepia using HCC samples. (B) Expression of ZDHHC7 and LYPLA2 genes in different stages of HCC patients (N = 369) were performed in Gepia. ( C ) Differentially expressed ZDHHC7 and LYPLA2 genes in HCC (N = 369) and normal liver (N = 50) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). TPM, Transcripts Per Million. ( D ) Human cDNA reverse transcripts from 30 patients with HCC (Cohort 1), and ZDHHC7 were analyzed using rtPCR. N = 30 HCC patients. ( E ) Volcano plot of differentially expressed genes (DEGs) in HCC (N = 369) and normal liver (N = 50) samples from TCGA data was visualized. An over 1.41-fold increase and decrease in DEGs in HCC are shown in red and green respectively. ( F ) Venn diagram of both ZDHHC7 and LYPLA2 correlated genes was performed using HCC (N = 369) samples from TCGA data (the absolute Spearman’s correlation R value is above 0.5). ( G ) HCC cells were transfected with indicated <t>Flag-STAT3,DHHC7</t> WT, or catalytic mutant counterparts. The cells were labeled with or without Alk14. STAT3 was pulled down, followed by in-gel fluorescence or western blot analyses (left) and quantified (right) as indicated. CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. ( H ) Western blots of ZDHHC7 knockdown HCC and control cells (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( I ) Colony formation assay of ZDHHC7 knockdown HCC cells and control cells was performed and colony numbers were counted and normalized (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. ** p < 0.01, by Two-tailed unpaired student’s t-test.
    Adeno Associated Virus 9 Vectors Expressing Mouse Stat3 Shrna, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/pcdna3+1/pm37898396-87-0-16
    Average 90 stars, based on 1 article reviews
    adeno-associated virus 9 vectors expressing mouse stat3 shrna - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology shrna stat3 expressing vectors construction
    ( A and B ) Expression of ZDHHC7 and LYPLA2 genes in HCC (N = 369) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). (A) Kaplan-Meier curves of ZDHHC7 and LYPLA2 genes were performed in Gepia using HCC samples. (B) Expression of ZDHHC7 and LYPLA2 genes in different stages of HCC patients (N = 369) were performed in Gepia. ( C ) Differentially expressed ZDHHC7 and LYPLA2 genes in HCC (N = 369) and normal liver (N = 50) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). TPM, Transcripts Per Million. ( D ) Human cDNA reverse transcripts from 30 patients with HCC (Cohort 1), and ZDHHC7 were analyzed using rtPCR. N = 30 HCC patients. ( E ) Volcano plot of differentially expressed genes (DEGs) in HCC (N = 369) and normal liver (N = 50) samples from TCGA data was visualized. An over 1.41-fold increase and decrease in DEGs in HCC are shown in red and green respectively. ( F ) Venn diagram of both ZDHHC7 and LYPLA2 correlated genes was performed using HCC (N = 369) samples from TCGA data (the absolute Spearman’s correlation R value is above 0.5). ( G ) HCC cells were transfected with indicated <t>Flag-STAT3,DHHC7</t> WT, or catalytic mutant counterparts. The cells were labeled with or without Alk14. STAT3 was pulled down, followed by in-gel fluorescence or western blot analyses (left) and quantified (right) as indicated. CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. ( H ) Western blots of ZDHHC7 knockdown HCC and control cells (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( I ) Colony formation assay of ZDHHC7 knockdown HCC cells and control cells was performed and colony numbers were counted and normalized (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. ** p < 0.01, by Two-tailed unpaired student’s t-test.
    Shrna Stat3 Expressing Vectors Construction, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/Stat3/ppr0746723-65-0-15
    Average 96 stars, based on 1 article reviews
    shrna stat3 expressing vectors construction - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    Thermo Fisher stat3 expression vector pls15
    a Schematic representation of CC-functionalised GEMS receptor resulting in activation of target genes, upon dimerization. CC peptides are N-terminally fused, through linker α x to the extracellular and transmembrane domains of the erythropoietin receptor (EpoR) cluster that can induce transgene expression following activation of an intracellular signalling pathway. Complementary CC modules are indicated as A:A’, B:B’ and Γ:Γ’ (see Supplementary Table S1). Downstream receptor signalling can be modulated by exchanging the intracellular activation domains (indicated here as switch A, B and C) and desired output can be expressed by replacing the reporter gene to a transgene of choice. b Receptor activation can be achieved by soluble ditopic CC ligands (upper-left panel) the properties of which can be utilised to achieve Boolean logic gate operators (AND/OR – upper-right panel). Intercellular communication (bottom panel) can be achieved by engineering sender cells that express the ligand under the control of an ON/OFF switch and a receiver cell population expressing the cognate receptor and reporter genes. c Schematic overview of the reporter system to monitor receptor activation using JAK/STAT (Janus kinase/signal transducer and activator of transcription) intracellular signalling (left panel). Each receptor monomer bears a cognate CC (A and A’ with linker α 2 ) that can cause the receptor to heterodimerize. Phosphorylated <t>STAT3</t> results in the production of the reporter protein: human placental secreted alkaline phosphatase (SEAP). SEAP catalyses the hydrolysis of a chromogenic substrate (p-Nitrophenylphosphate (pNPP) (see Methods and Supplementary Figure S1). Substrate conversion is only observed when the cognate receptors A:A’ are expressed on the cell surface, while non-cognate pairs (A:B) do not result in receptor activation and subsequent substrate conversion (right panel). The experiment is performed in independent triplicates; solid line indicates the mean and shaded area indicates standard deviation. d Normalised SEAP activity in HEK293T cells transiently transfected with receptor pairs with varied linker lengths α x of zero, four, eight and 27 amino acids (aa; GS or GSS repeats, Supplementary Table S2 and Supplementary Figures S2 and S3b). SEAP activity was measured 48 hours following transfection (see Methods). Only the correct combination of cognate CCs (A:A’) results in receptor activation, while non-cognate pairs (A:A, A’:A’ and A:B) result in no activation. Bars indicate mean activity; individual data points represent independent triplicates. SEAP activity is normalised with respect to the SEAP activity of the A:A’ receptor heterodimer with linker α 2 .
    Stat3 Expression Vector Pls15, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/SUCROSE+EP%2FBP%2FNF+12KG/bio_rxiv__2023__01__18__524631-180-35-55
    Average 99 stars, based on 1 article reviews
    stat3 expression vector pls15 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    Danaher Inc fluorescent protein egfp fusion protein expression vector pcoron1000 egfp stat3
    a Schematic representation of CC-functionalised GEMS receptor resulting in activation of target genes, upon dimerization. CC peptides are N-terminally fused, through linker α x to the extracellular and transmembrane domains of the erythropoietin receptor (EpoR) cluster that can induce transgene expression following activation of an intracellular signalling pathway. Complementary CC modules are indicated as A:A’, B:B’ and Γ:Γ’ (see Supplementary Table S1). Downstream receptor signalling can be modulated by exchanging the intracellular activation domains (indicated here as switch A, B and C) and desired output can be expressed by replacing the reporter gene to a transgene of choice. b Receptor activation can be achieved by soluble ditopic CC ligands (upper-left panel) the properties of which can be utilised to achieve Boolean logic gate operators (AND/OR – upper-right panel). Intercellular communication (bottom panel) can be achieved by engineering sender cells that express the ligand under the control of an ON/OFF switch and a receiver cell population expressing the cognate receptor and reporter genes. c Schematic overview of the reporter system to monitor receptor activation using JAK/STAT (Janus kinase/signal transducer and activator of transcription) intracellular signalling (left panel). Each receptor monomer bears a cognate CC (A and A’ with linker α 2 ) that can cause the receptor to heterodimerize. Phosphorylated <t>STAT3</t> results in the production of the reporter protein: human placental secreted alkaline phosphatase (SEAP). SEAP catalyses the hydrolysis of a chromogenic substrate (p-Nitrophenylphosphate (pNPP) (see Methods and Supplementary Figure S1). Substrate conversion is only observed when the cognate receptors A:A’ are expressed on the cell surface, while non-cognate pairs (A:B) do not result in receptor activation and subsequent substrate conversion (right panel). The experiment is performed in independent triplicates; solid line indicates the mean and shaded area indicates standard deviation. d Normalised SEAP activity in HEK293T cells transiently transfected with receptor pairs with varied linker lengths α x of zero, four, eight and 27 amino acids (aa; GS or GSS repeats, Supplementary Table S2 and Supplementary Figures S2 and S3b). SEAP activity was measured 48 hours following transfection (see Methods). Only the correct combination of cognate CCs (A:A’) results in receptor activation, while non-cognate pairs (A:A, A’:A’ and A:B) result in no activation. Bars indicate mean activity; individual data points represent independent triplicates. SEAP activity is normalised with respect to the SEAP activity of the A:A’ receptor heterodimer with linker α 2 .
    Fluorescent Protein Egfp Fusion Protein Expression Vector Pcoron1000 Egfp Stat3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/Fusion/pmc02875382-99-5-20
    Average 96 stars, based on 1 article reviews
    fluorescent protein egfp fusion protein expression vector pcoron1000 egfp stat3 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Genechem gv141-tf (foxa2, sox17, bhlha15, klf4, sp1, ddit3, arid3b, klf1, and stat3) over-expression vectors
    a Schematic representation of CC-functionalised GEMS receptor resulting in activation of target genes, upon dimerization. CC peptides are N-terminally fused, through linker α x to the extracellular and transmembrane domains of the erythropoietin receptor (EpoR) cluster that can induce transgene expression following activation of an intracellular signalling pathway. Complementary CC modules are indicated as A:A’, B:B’ and Γ:Γ’ (see Supplementary Table S1). Downstream receptor signalling can be modulated by exchanging the intracellular activation domains (indicated here as switch A, B and C) and desired output can be expressed by replacing the reporter gene to a transgene of choice. b Receptor activation can be achieved by soluble ditopic CC ligands (upper-left panel) the properties of which can be utilised to achieve Boolean logic gate operators (AND/OR – upper-right panel). Intercellular communication (bottom panel) can be achieved by engineering sender cells that express the ligand under the control of an ON/OFF switch and a receiver cell population expressing the cognate receptor and reporter genes. c Schematic overview of the reporter system to monitor receptor activation using JAK/STAT (Janus kinase/signal transducer and activator of transcription) intracellular signalling (left panel). Each receptor monomer bears a cognate CC (A and A’ with linker α 2 ) that can cause the receptor to heterodimerize. Phosphorylated <t>STAT3</t> results in the production of the reporter protein: human placental secreted alkaline phosphatase (SEAP). SEAP catalyses the hydrolysis of a chromogenic substrate (p-Nitrophenylphosphate (pNPP) (see Methods and Supplementary Figure S1). Substrate conversion is only observed when the cognate receptors A:A’ are expressed on the cell surface, while non-cognate pairs (A:B) do not result in receptor activation and subsequent substrate conversion (right panel). The experiment is performed in independent triplicates; solid line indicates the mean and shaded area indicates standard deviation. d Normalised SEAP activity in HEK293T cells transiently transfected with receptor pairs with varied linker lengths α x of zero, four, eight and 27 amino acids (aa; GS or GSS repeats, Supplementary Table S2 and Supplementary Figures S2 and S3b). SEAP activity was measured 48 hours following transfection (see Methods). Only the correct combination of cognate CCs (A:A’) results in receptor activation, while non-cognate pairs (A:A, A’:A’ and A:B) result in no activation. Bars indicate mean activity; individual data points represent independent triplicates. SEAP activity is normalised with respect to the SEAP activity of the A:A’ receptor heterodimer with linker α 2 .
    Gv141 Tf (Foxa2, Sox17, Bhlha15, Klf4, Sp1, Ddit3, Arid3b, Klf1, And Stat3) Over Expression Vectors, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+vector/stat3+shrna/pmc09120683-137-0-16
    Average 90 stars, based on 1 article reviews
    gv141-tf (foxa2, sox17, bhlha15, klf4, sp1, ddit3, arid3b, klf1, and stat3) over-expression vectors - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    ( A and B ) Expression of ZDHHC7 and LYPLA2 genes in HCC (N = 369) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). (A) Kaplan-Meier curves of ZDHHC7 and LYPLA2 genes were performed in Gepia using HCC samples. (B) Expression of ZDHHC7 and LYPLA2 genes in different stages of HCC patients (N = 369) were performed in Gepia. ( C ) Differentially expressed ZDHHC7 and LYPLA2 genes in HCC (N = 369) and normal liver (N = 50) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). TPM, Transcripts Per Million. ( D ) Human cDNA reverse transcripts from 30 patients with HCC (Cohort 1), and ZDHHC7 were analyzed using rtPCR. N = 30 HCC patients. ( E ) Volcano plot of differentially expressed genes (DEGs) in HCC (N = 369) and normal liver (N = 50) samples from TCGA data was visualized. An over 1.41-fold increase and decrease in DEGs in HCC are shown in red and green respectively. ( F ) Venn diagram of both ZDHHC7 and LYPLA2 correlated genes was performed using HCC (N = 369) samples from TCGA data (the absolute Spearman’s correlation R value is above 0.5). ( G ) HCC cells were transfected with indicated Flag-STAT3,DHHC7 WT, or catalytic mutant counterparts. The cells were labeled with or without Alk14. STAT3 was pulled down, followed by in-gel fluorescence or western blot analyses (left) and quantified (right) as indicated. CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. ( H ) Western blots of ZDHHC7 knockdown HCC and control cells (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( I ) Colony formation assay of ZDHHC7 knockdown HCC cells and control cells was performed and colony numbers were counted and normalized (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. ** p < 0.01, by Two-tailed unpaired student’s t-test.

    Journal: Science signaling

    Article Title: STAT3 palmitoylation initiates a positive feedback loop that promotes the malignancy of hepatocellular carcinoma cells in mice

    doi: 10.1126/scisignal.add2282

    Figure Lengend Snippet: ( A and B ) Expression of ZDHHC7 and LYPLA2 genes in HCC (N = 369) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). (A) Kaplan-Meier curves of ZDHHC7 and LYPLA2 genes were performed in Gepia using HCC samples. (B) Expression of ZDHHC7 and LYPLA2 genes in different stages of HCC patients (N = 369) were performed in Gepia. ( C ) Differentially expressed ZDHHC7 and LYPLA2 genes in HCC (N = 369) and normal liver (N = 50) samples from TCGA data were visualized using Gepia ( http://gepia.cancer-pku.cn/ ). TPM, Transcripts Per Million. ( D ) Human cDNA reverse transcripts from 30 patients with HCC (Cohort 1), and ZDHHC7 were analyzed using rtPCR. N = 30 HCC patients. ( E ) Volcano plot of differentially expressed genes (DEGs) in HCC (N = 369) and normal liver (N = 50) samples from TCGA data was visualized. An over 1.41-fold increase and decrease in DEGs in HCC are shown in red and green respectively. ( F ) Venn diagram of both ZDHHC7 and LYPLA2 correlated genes was performed using HCC (N = 369) samples from TCGA data (the absolute Spearman’s correlation R value is above 0.5). ( G ) HCC cells were transfected with indicated Flag-STAT3,DHHC7 WT, or catalytic mutant counterparts. The cells were labeled with or without Alk14. STAT3 was pulled down, followed by in-gel fluorescence or western blot analyses (left) and quantified (right) as indicated. CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. ( H ) Western blots of ZDHHC7 knockdown HCC and control cells (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( I ) Colony formation assay of ZDHHC7 knockdown HCC cells and control cells was performed and colony numbers were counted and normalized (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. ** p < 0.01, by Two-tailed unpaired student’s t-test.

    Article Snippet: STAT3 expression vectors with different tags were obtained from Addgene (Watertown, MA, USA).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Transfection, Mutagenesis, Labeling, Fluorescence, Western Blot, Staining, Knockdown, Control, Colony Assay, Two Tailed Test

    ( A ) HCC cells were transfected with control or Flag-CDK5 plasmids. Endogenous HIF1α was pulled down and western blot was performed. N = 3 biological replicates over 3 independent experiments. ( B ) HCC cells treated with CHX as indicated, with or without dinaciclib. Endogenous HIF1α was measured by western blot (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( C ) HCC cells were treated with dinaciclib, with or without MG132. Endogenous protein was measured by western blot (top) and quantified (bottom). N = 3 biological replicates over 3 independent experiments. ( D ) WT and CDK5 knockout (KO) cells with or without CDK5 overexpression (OE) were treated with MG132. Endogenous protein targets were visualized by western blot analyses (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. ( E ) HCC cells were treated with indicated concentrations of dinaciclib. Endogenous protein was measured by western blot (top) and quantified (bottom). N = 3 biological replicates over 3 independent experiments. ( F and G ) WT and CDK5 KO HCC cells were transfected with Flag-STAT3 WT and labeled with Alk14. After treatment with inhibitors (2BP, dinaciclib or echinomycin), STAT3 was pulled down and palmitoylation of STAT3 was measured by in-gel fluorescence including coomassie brilliant blue (CBB) staining of STAT3 (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. * p < 0.05, ** p < 0.01, by Two-tailed unpaired student’s t-test.

    Journal: Science signaling

    Article Title: STAT3 palmitoylation initiates a positive feedback loop that promotes the malignancy of hepatocellular carcinoma cells in mice

    doi: 10.1126/scisignal.add2282

    Figure Lengend Snippet: ( A ) HCC cells were transfected with control or Flag-CDK5 plasmids. Endogenous HIF1α was pulled down and western blot was performed. N = 3 biological replicates over 3 independent experiments. ( B ) HCC cells treated with CHX as indicated, with or without dinaciclib. Endogenous HIF1α was measured by western blot (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( C ) HCC cells were treated with dinaciclib, with or without MG132. Endogenous protein was measured by western blot (top) and quantified (bottom). N = 3 biological replicates over 3 independent experiments. ( D ) WT and CDK5 knockout (KO) cells with or without CDK5 overexpression (OE) were treated with MG132. Endogenous protein targets were visualized by western blot analyses (top) and quantified (bottom) as indicated. N = 3 biological replicates over 3 independent experiments. ( E ) HCC cells were treated with indicated concentrations of dinaciclib. Endogenous protein was measured by western blot (top) and quantified (bottom). N = 3 biological replicates over 3 independent experiments. ( F and G ) WT and CDK5 KO HCC cells were transfected with Flag-STAT3 WT and labeled with Alk14. After treatment with inhibitors (2BP, dinaciclib or echinomycin), STAT3 was pulled down and palmitoylation of STAT3 was measured by in-gel fluorescence including coomassie brilliant blue (CBB) staining of STAT3 (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. * p < 0.05, ** p < 0.01, by Two-tailed unpaired student’s t-test.

    Article Snippet: STAT3 expression vectors with different tags were obtained from Addgene (Watertown, MA, USA).

    Techniques: Transfection, Control, Western Blot, Knock-Out, Over Expression, Labeling, Fluorescence, Staining, Two Tailed Test

    ( A ) The core hypoxia-response element (HRE) recognized by HIF1 and the sequence of the predicted HIF1 binding site in the promoter region of ZDHHC7 . ( B ) Relative luciferase activity was analyzed after ZDHHC7 reporter plasmids were cotransfected with HIF1α or echinomycin treatment as indicated in 293T cells. N = 3 biological replicates over 3 independent experiments. ( C ) ZDHHC7 reporter plasmids were mutated as indicated (Δ1 and Δ2) and the relative luciferase activity was analyzed after plasmids were transfected with or without HIF1α as indicated in 293T cells. N = 6/3/3/3 biological replicates over 3 independent experiments. ( D ) HepG2 cells were transfected with HIF1α plasmid or treated with echinomycin . ZDHHC7 mRNA was analyzed by rtPCR. N = 3 biological replicates over 3 independent experiments. ( E ) Control and HIF1α knockdown HCC cells were harvested and endogenous protein was measured by western blot (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( F ) HepG2 cells were treated with echinomycin as indicated. Cells were harvested, and ZDHHC7 mRNA was analyzed by rtPCR. N = 3 biological replicates over 3 independent experiments. ( G ) 293T cells were transfected with Flag-STAT3 WT and labeled with Alk14. After treating with the indicated inhibitor, STAT3 was pulled down and the palmitoylation of STAT3 was visualized by in-gel fluorescence (left) and quantified (right). CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. * p < 0.05, ** p < 0.01, NS not significant, by Two-tailed unpaired student’s t-test.

    Journal: Science signaling

    Article Title: STAT3 palmitoylation initiates a positive feedback loop that promotes the malignancy of hepatocellular carcinoma cells in mice

    doi: 10.1126/scisignal.add2282

    Figure Lengend Snippet: ( A ) The core hypoxia-response element (HRE) recognized by HIF1 and the sequence of the predicted HIF1 binding site in the promoter region of ZDHHC7 . ( B ) Relative luciferase activity was analyzed after ZDHHC7 reporter plasmids were cotransfected with HIF1α or echinomycin treatment as indicated in 293T cells. N = 3 biological replicates over 3 independent experiments. ( C ) ZDHHC7 reporter plasmids were mutated as indicated (Δ1 and Δ2) and the relative luciferase activity was analyzed after plasmids were transfected with or without HIF1α as indicated in 293T cells. N = 6/3/3/3 biological replicates over 3 independent experiments. ( D ) HepG2 cells were transfected with HIF1α plasmid or treated with echinomycin . ZDHHC7 mRNA was analyzed by rtPCR. N = 3 biological replicates over 3 independent experiments. ( E ) Control and HIF1α knockdown HCC cells were harvested and endogenous protein was measured by western blot (left) and quantified (right). N = 3 biological replicates over 3 independent experiments. ( F ) HepG2 cells were treated with echinomycin as indicated. Cells were harvested, and ZDHHC7 mRNA was analyzed by rtPCR. N = 3 biological replicates over 3 independent experiments. ( G ) 293T cells were transfected with Flag-STAT3 WT and labeled with Alk14. After treating with the indicated inhibitor, STAT3 was pulled down and the palmitoylation of STAT3 was visualized by in-gel fluorescence (left) and quantified (right). CBB was the coomassie brilliant blue staining of STAT3. N = 3 biological replicates over 3 independent experiments. Data represent the Mean ± SEM. * p < 0.05, ** p < 0.01, NS not significant, by Two-tailed unpaired student’s t-test.

    Article Snippet: STAT3 expression vectors with different tags were obtained from Addgene (Watertown, MA, USA).

    Techniques: Sequencing, Binding Assay, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Control, Knockdown, Western Blot, Labeling, Fluorescence, Staining, Two Tailed Test

    ( A ) Human HCC tissues from 85 patients (Cohort 2) were analyzed using IHC. The correlation between DHHC7, HIF1α and p-STAT3 abundance were analyzed. N = 85 HCC patients. Indicated P value was calculated by Pearson correlation analysis. ( B ) Kaplan-Meier curves of DHHC7, HIF1α, p-STAT3 and CDK5 for HCC patients’ overall survival were performed, and the P value of each Kaplan-Meier curves were visualized. N = 85 HCC patients. ( C ) Working model of the DHHC7-STAT3-HIF1α positive feedback loop. In HCC cells, the palmitoyltransferase DHHC7 increased the transcriptional activity of STAT3 and the transcription of its target gene HIF1A by palmitoylating STAT3 on Cys108. Conversely, as a transcription factor, HIF1α directly promotes ZDHHC7 gene expression. This creates a cycle between DHHC7 and HIF1α which is induced by STAT3 palmitoylation (left). The inhibition of DHHC7-HIF1α cycle blocks the malignancy of hepatic carcinoma cells (right).

    Journal: Science signaling

    Article Title: STAT3 palmitoylation initiates a positive feedback loop that promotes the malignancy of hepatocellular carcinoma cells in mice

    doi: 10.1126/scisignal.add2282

    Figure Lengend Snippet: ( A ) Human HCC tissues from 85 patients (Cohort 2) were analyzed using IHC. The correlation between DHHC7, HIF1α and p-STAT3 abundance were analyzed. N = 85 HCC patients. Indicated P value was calculated by Pearson correlation analysis. ( B ) Kaplan-Meier curves of DHHC7, HIF1α, p-STAT3 and CDK5 for HCC patients’ overall survival were performed, and the P value of each Kaplan-Meier curves were visualized. N = 85 HCC patients. ( C ) Working model of the DHHC7-STAT3-HIF1α positive feedback loop. In HCC cells, the palmitoyltransferase DHHC7 increased the transcriptional activity of STAT3 and the transcription of its target gene HIF1A by palmitoylating STAT3 on Cys108. Conversely, as a transcription factor, HIF1α directly promotes ZDHHC7 gene expression. This creates a cycle between DHHC7 and HIF1α which is induced by STAT3 palmitoylation (left). The inhibition of DHHC7-HIF1α cycle blocks the malignancy of hepatic carcinoma cells (right).

    Article Snippet: STAT3 expression vectors with different tags were obtained from Addgene (Watertown, MA, USA).

    Techniques: Activity Assay, Gene Expression, Inhibition

    a Schematic representation of CC-functionalised GEMS receptor resulting in activation of target genes, upon dimerization. CC peptides are N-terminally fused, through linker α x to the extracellular and transmembrane domains of the erythropoietin receptor (EpoR) cluster that can induce transgene expression following activation of an intracellular signalling pathway. Complementary CC modules are indicated as A:A’, B:B’ and Γ:Γ’ (see Supplementary Table S1). Downstream receptor signalling can be modulated by exchanging the intracellular activation domains (indicated here as switch A, B and C) and desired output can be expressed by replacing the reporter gene to a transgene of choice. b Receptor activation can be achieved by soluble ditopic CC ligands (upper-left panel) the properties of which can be utilised to achieve Boolean logic gate operators (AND/OR – upper-right panel). Intercellular communication (bottom panel) can be achieved by engineering sender cells that express the ligand under the control of an ON/OFF switch and a receiver cell population expressing the cognate receptor and reporter genes. c Schematic overview of the reporter system to monitor receptor activation using JAK/STAT (Janus kinase/signal transducer and activator of transcription) intracellular signalling (left panel). Each receptor monomer bears a cognate CC (A and A’ with linker α 2 ) that can cause the receptor to heterodimerize. Phosphorylated STAT3 results in the production of the reporter protein: human placental secreted alkaline phosphatase (SEAP). SEAP catalyses the hydrolysis of a chromogenic substrate (p-Nitrophenylphosphate (pNPP) (see Methods and Supplementary Figure S1). Substrate conversion is only observed when the cognate receptors A:A’ are expressed on the cell surface, while non-cognate pairs (A:B) do not result in receptor activation and subsequent substrate conversion (right panel). The experiment is performed in independent triplicates; solid line indicates the mean and shaded area indicates standard deviation. d Normalised SEAP activity in HEK293T cells transiently transfected with receptor pairs with varied linker lengths α x of zero, four, eight and 27 amino acids (aa; GS or GSS repeats, Supplementary Table S2 and Supplementary Figures S2 and S3b). SEAP activity was measured 48 hours following transfection (see Methods). Only the correct combination of cognate CCs (A:A’) results in receptor activation, while non-cognate pairs (A:A, A’:A’ and A:B) result in no activation. Bars indicate mean activity; individual data points represent independent triplicates. SEAP activity is normalised with respect to the SEAP activity of the A:A’ receptor heterodimer with linker α 2 .

    Journal: bioRxiv

    Article Title: Engineering a Scalable and Orthogonal Platform for Synthetic Communication in Mammalian Cells

    doi: 10.1101/2023.01.18.524631

    Figure Lengend Snippet: a Schematic representation of CC-functionalised GEMS receptor resulting in activation of target genes, upon dimerization. CC peptides are N-terminally fused, through linker α x to the extracellular and transmembrane domains of the erythropoietin receptor (EpoR) cluster that can induce transgene expression following activation of an intracellular signalling pathway. Complementary CC modules are indicated as A:A’, B:B’ and Γ:Γ’ (see Supplementary Table S1). Downstream receptor signalling can be modulated by exchanging the intracellular activation domains (indicated here as switch A, B and C) and desired output can be expressed by replacing the reporter gene to a transgene of choice. b Receptor activation can be achieved by soluble ditopic CC ligands (upper-left panel) the properties of which can be utilised to achieve Boolean logic gate operators (AND/OR – upper-right panel). Intercellular communication (bottom panel) can be achieved by engineering sender cells that express the ligand under the control of an ON/OFF switch and a receiver cell population expressing the cognate receptor and reporter genes. c Schematic overview of the reporter system to monitor receptor activation using JAK/STAT (Janus kinase/signal transducer and activator of transcription) intracellular signalling (left panel). Each receptor monomer bears a cognate CC (A and A’ with linker α 2 ) that can cause the receptor to heterodimerize. Phosphorylated STAT3 results in the production of the reporter protein: human placental secreted alkaline phosphatase (SEAP). SEAP catalyses the hydrolysis of a chromogenic substrate (p-Nitrophenylphosphate (pNPP) (see Methods and Supplementary Figure S1). Substrate conversion is only observed when the cognate receptors A:A’ are expressed on the cell surface, while non-cognate pairs (A:B) do not result in receptor activation and subsequent substrate conversion (right panel). The experiment is performed in independent triplicates; solid line indicates the mean and shaded area indicates standard deviation. d Normalised SEAP activity in HEK293T cells transiently transfected with receptor pairs with varied linker lengths α x of zero, four, eight and 27 amino acids (aa; GS or GSS repeats, Supplementary Table S2 and Supplementary Figures S2 and S3b). SEAP activity was measured 48 hours following transfection (see Methods). Only the correct combination of cognate CCs (A:A’) results in receptor activation, while non-cognate pairs (A:A, A’:A’ and A:B) result in no activation. Bars indicate mean activity; individual data points represent independent triplicates. SEAP activity is normalised with respect to the SEAP activity of the A:A’ receptor heterodimer with linker α 2 .

    Article Snippet: The next day, cells were transfected with 500 ng plasmid DNA (193.8 ng per receptor dimer for a total of 387.6 ng, 96.1 ng STAT3-induced secreted alkaline phosphatase (SEAP) reporter plasmid pLS13 and 16.3 ng STAT3 expression vector pLS15; see Supplementary Table S2) for five hours, using 1.25 μl of the transfection reagent lipofectamine 2000 (Life Technologies) in a total of 200 μl Opti-MEM™ I reduced serum medium (Thermo Fisher Scientific), according to manufacturer’s instructions.

    Techniques: Activation Assay, Expressing, Standard Deviation, Activity Assay, Transfection