renilla luciferase expression vector prl-cmv (Promega)
Structured Review

Renilla Luciferase Expression Vector Prl Cmv, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stat3+expression+vector/pgl3+basic/pmc06304454-89-8-20
Average 90 stars, based on 1 article reviews
Images
1) Product Images from "Antrodia camphorata Mycelia Exert Anti-liver Cancer Effects and Inhibit STAT3 Signaling in vitro and in vivo"
Article Title: Antrodia camphorata Mycelia Exert Anti-liver Cancer Effects and Inhibit STAT3 Signaling in vitro and in vivo
Journal: Frontiers in Pharmacology
doi: 10.3389/fphar.2018.01449
Figure Legend Snippet: EEAC inhibits activation and lowers mRNA level of STAT3 in human HCC cells. Cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of (A) p-STAT3 and STAT3 and (B) p-JAK2 and JAK2 were determined by Western blot analyses. The relative protein levels were analyzed by Image J software. (C) mRNA levels of STAT3 (upper panel) and JAK2 (lower panel) in HepG2 and SMMC-7721 cells were detected by qRT-PCR. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.
Techniques Used: Activation Assay, Western Blot, Software, Quantitative RT-PCR
Figure Legend Snippet: EEAC reduces STAT3 nuclear pool and suppresses STAT3-luciferase reporter activity in human HCC cells. (A) Protein levels of STAT3 in cytoplasmic and nuclear extracts. HepG2 cells were treated with indicated concentrations of EEAC for 24 h. Protein levels of STAT3 were determined by Western blot analyses (left) and relative expression levels were analyzed by Image J software (right). GAPDH and SP1 were served as loading controls of cytoplasmic and nuclear extractions, respectively. (B) HepG2 cells were transfected with STAT3-luciferase reporter plasmid with a PRL-CMV construct for 48 h, and then treated with EEAC at indicated concentrations for another 24 h. Transcriptional activity of STAT3 was measured by the dual-luciferase reporter assay. Data were shown as mean ± SD of three independent experiments. ∗∗ P < 0.01 vs. the control.
Techniques Used: Luciferase, Activity Assay, Western Blot, Expressing, Software, Transfection, Plasmid Preparation, Construct, Reporter Assay
Figure Legend Snippet: EEAC downregulates protein levels of STAT3-targeted molecules. HepG2 (A) and SMMC-7721 (B) cells were treated with indicated concentrations of EEAC for 24 h, and then protein levels of Bcl-2, Bcl-xL, MMP-2 and MMP-9 were determined by immunoblotting. The relative protein levels were analyzed by Image J software and shown as mean ± SD of three independent experiments. ∗ P < 0.05, ∗∗ P < 0.01 vs. the corresponding control.
Techniques Used: Western Blot, Software
Figure Legend Snippet: Over-activation of STAT3 in HepG2 cells diminishes the cytotoxic effects of EEAC. (A) Protein levels of STAT3 and p-STAT3. HepG2 cells were transiently transfected with either an empty vector or an STAT3C-expressing construct for 48 h, and then total cell lysates were extracted for Western blot analyses. (B) After transfection, HepG2 cells were treated with EEAC for 48 h, the cell viability was determined by the MTT assay. Data were shown as mean ± SD of three independent experiments. ∗ P < 0.05 vs. cells transfected with the empty vector.
Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Expressing, Construct, Western Blot, MTT Assay
Figure Legend Snippet: EEAC suppresses tumor growth in SMMC-7721 cell-bearing mice. Nude mice bearing SMMC-7721 xenograft were treated with EEAC for 18 days. (A) Tumor volume. (B) Representative tumors removed from mice. Tumor weights were recorded. In (A,B) , data were presented as mean ± SEM, n = 6. (C) TUNEL assays for apoptosis in tumor tissues collected from three individual mice. (D) Western blot analyses for protein levels of p-STAT3, STAT3, p-JAK2 and JAK2 (left panel) and the relative protein levels were analyzed by Image J software (right panel). Data were shown as mean ± SEM, n = 3. ∗ P < 0.05, ∗∗ P < 0.01 vs. vehicle control.
Techniques Used: TUNEL Assay, Western Blot, Software
Related Articles
Luciferase:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Activity Assay:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Plasmid Preparation:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg Control:Article Title: Proline hydroxylation of CREB-regulated transcriptional coactivator 2 controls hepatic glucose metabolism Article Snippet: .. Dual luciferase activity assays—HEK293T cells were co-transfected with 0.5 μg of empty vector or plasmids encoding CRTC2 variants as indicated, along with 0.5 μg other:Article Title: Article Snippet: The plasmids for enhancer activity analysis were generated from Article Title: Egr-1 promotes the proliferation and migration of vascular smooth muscle cells by transcriptionally activating Egr-2 in arteriovenous fistulas Article Snippet: Rat EGR1 promoter (~1.3 Kb; PCR-amplified from rat VSMCs) cloned into Article Title: Folie 1 Article Snippet: Vendor Bulk anti-TGFB1,2,3 In Vivo 1D11.1 Human, Mouse, Bovine, Chicken Mouse IgG1 10μg/gBW AB_292143 6 Ichorbio Mouse IgG1 Isotype Control HKSP - Mouse IgG1 10μg/gBW AB_292138 2 Ichorbio Anti-mouse CD8 in vivo YTS169 Mouse Rat IgG2b 12,5μg/g BW AB_292144 5 Ichorbio Anti-mouse CD4 in vivo GK1.5 Mouse Rat IgG2b 12,5μg/g BW AB_292144 4 Ichorbio Rat IgG2b Isotype Control in vivo 1-2 - Rat IgG2b 12,5μg/g BW AB_292137 8 Ichorbio Supplementary Table S3: Primers used for RT-qPCR Target gene Direction Sequence (5’3’) GC [%] Length TM hu-TGF-β1 Fwd ATTCCTGGCGATACCTCAGC 55 20 59,4 hu-TGF-β1 Rev CGGTAGTGAACCCGTTGATG 55 20 59,4 hu-GAPDH Fwd GTCAGTGGTGGACCTGACCT 60 20 61,4 hu-GAPDH Rev TGAGCTTGACAAAGTGGTCG 50 20 57,3 Supplementary Table S4: Expression vectors Name Backbone Insert (cDNA) Selection marker RRID/parentage pMIG pMSCV empty IRES-GFP RRID:Addgene_ 9044 pMIG-CALRWT pMSCV Human CALRWT IRES-GFP Provided by Ann Mullally pMIG-CALRins5 pMSCV Human CALRins5 IRES-GFP Provided by Ann Mullally 9 pMIG-CALRdel52 pMSCV Human CALRdel52 IRES-GFP Provided by Ann Mullally pMSCV-MPL pMSCV Human MPL PKG- hygromycin resistance gene Provided by Ann Mullally pMIG-JAK2WT pMSCV Human JAK2WT IRES-GFP Provided by Justus Duyster pMIG-JAK2V617F pMSCV Human JAK2V617F IRES-GFP Provided by Justus Duyster pMSCV-EpoR pMSCV Human EPOR neomycin resistance gene In-house pMIG-STAT3WT pMX Human STAT3WT IRES-GFP In-house pMIGSTAT3V640F pMX Human STAT3V640F IRES-GFP In-house pGL4.73[ hRluc/SV40] pGL4 SV40 early enhancer, Article Title: Article Snippet: RIG-I ubiquitination assays Purification of GST-RIG-I 2CARD from mammalian cells was done as previously described (8, 11). pEBGRIG-I 2CARD (4 μg) and pcDNA4 carrying indicated gene or pCAGGS-NS1 (Influenza A virus, 10 μg) (7) and Article Title: Article Snippet: The constructed pGL3-ELO11 reporter plasmid was cotransfected 211 with the pac-dsxM or pac-dsxF expression plasmid by Article Title: Article Snippet: A total of 24 h after gene KD in 6-well culture plates, 2 μg TOPFlash and 0.5 μg pRL (Promega, E2261) plasmids were transfected into Article Title: Article Snippet: A total of 2 μg of DKK1 promoter and 0.5 μg of pRL (Promega, E2261) plasmids were transfected into |

