Review



anti phospho stat3 tyr705 rabbit monoclonal antibody  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc anti phospho stat3 tyr705 rabbit monoclonal antibody
    a HCT116 was transfected with pcDNA3.1-VMP1 vector for 48 h, the mRNA expression level of VMP1 and miR-21 was measured by qPCR. b HCT116 was transfected with the small activating RNA (saRNA) targeting VMP1 promoter for 48 h, then the mRNA expression of VMP1 was measured by qPCR. c HCT116 was transfected with saRNA-158 for 48 h, the mRNA and protein expression level of VMP1 was measured by Western blot and qPCR, miR-21 expression and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. d HCT116 was transfected with pEGFP-C3-hGLI3 vector for 48 h, the mRNA expression level of GLI3, VMP1, miR-21, and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. e HCT116 was transfected with <t>pEGFP-N1-STAT3</t> vector for 48 h, the mRNA expression level of STAT3, VMP1, and the number of pri-miR-21 were measured by qPCR. f HCT116 was transfected with saRNA-158 and pEGFP-C3-hGLI3 vector, then CHIP-qPCR analyses using phospho-STAT3 <t>(Tyr705)</t> special antibody were performed. Primer specific for the binding sites of STAT3 to the pri-miR-21 promoter region. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.
    Anti Phospho Stat3 Tyr705 Rabbit Monoclonal Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 6136 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/Phospho-Stat3+(Tyr705)+XP+Rabbit+mAb/pmc07736343-183-12-21
    Average 98 stars, based on 6136 article reviews
    anti phospho stat3 tyr705 rabbit monoclonal antibody - by Bioz Stars, 2026-10
    98/100 stars

    Images

    1) Product Images from "An autoregulatory feedback loop of miR-21/VMP1 is responsible for the abnormal expression of miR-21 in colorectal cancer cells"

    Article Title: An autoregulatory feedback loop of miR-21/VMP1 is responsible for the abnormal expression of miR-21 in colorectal cancer cells

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-020-03265-4

    a HCT116 was transfected with pcDNA3.1-VMP1 vector for 48 h, the mRNA expression level of VMP1 and miR-21 was measured by qPCR. b HCT116 was transfected with the small activating RNA (saRNA) targeting VMP1 promoter for 48 h, then the mRNA expression of VMP1 was measured by qPCR. c HCT116 was transfected with saRNA-158 for 48 h, the mRNA and protein expression level of VMP1 was measured by Western blot and qPCR, miR-21 expression and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. d HCT116 was transfected with pEGFP-C3-hGLI3 vector for 48 h, the mRNA expression level of GLI3, VMP1, miR-21, and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. e HCT116 was transfected with pEGFP-N1-STAT3 vector for 48 h, the mRNA expression level of STAT3, VMP1, and the number of pri-miR-21 were measured by qPCR. f HCT116 was transfected with saRNA-158 and pEGFP-C3-hGLI3 vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Primer specific for the binding sites of STAT3 to the pri-miR-21 promoter region. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.
    Figure Legend Snippet: a HCT116 was transfected with pcDNA3.1-VMP1 vector for 48 h, the mRNA expression level of VMP1 and miR-21 was measured by qPCR. b HCT116 was transfected with the small activating RNA (saRNA) targeting VMP1 promoter for 48 h, then the mRNA expression of VMP1 was measured by qPCR. c HCT116 was transfected with saRNA-158 for 48 h, the mRNA and protein expression level of VMP1 was measured by Western blot and qPCR, miR-21 expression and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. d HCT116 was transfected with pEGFP-C3-hGLI3 vector for 48 h, the mRNA expression level of GLI3, VMP1, miR-21, and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR. e HCT116 was transfected with pEGFP-N1-STAT3 vector for 48 h, the mRNA expression level of STAT3, VMP1, and the number of pri-miR-21 were measured by qPCR. f HCT116 was transfected with saRNA-158 and pEGFP-C3-hGLI3 vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Primer specific for the binding sites of STAT3 to the pri-miR-21 promoter region. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.

    Techniques Used: Transfection, Plasmid Preparation, Expressing, Western Blot, ChIP-qPCR, Binding Assay

    a RKO was transfected with pCIP-caTfeb vector and the construct dual-luciferase vectors, pmiRGLO-VMP1 promoter (−1000/+100) or pmiRGLO-pri-miR-21 promoter (−1000/+100), the luciferase activity was measured. b Luciferase report assay using the construct vector carrying the VMP1 promoter region, in which the predicted most likely three binding site (−648/−639, −560/−551, −33/−24, the upstream of the transcription start site of VMP1) with TFEB was mutant. c DNA Agar-gel electrophoresis from CHIP-qPCR assay, the amount of immunoprecipitated DNA isolated from TFEB special antibody/protein G magnetic beads was measured by qPCR. Primer specific for VMP1 promoter region (−116/+27). NC: negative control, PC: positive control, Group1: cells with no treat, Group2: cells with glucose starvation. d The mRNA expression level of TFEB, VMP1, miR-21 and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR, the protein expression level of TFEB and VMP1 were measured by Western blot after overexpression of the constitutively active TFEB by pCIP-caTfeb vector in RKO cells. e RKO was transfected with pCIP-caTfeb vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.
    Figure Legend Snippet: a RKO was transfected with pCIP-caTfeb vector and the construct dual-luciferase vectors, pmiRGLO-VMP1 promoter (−1000/+100) or pmiRGLO-pri-miR-21 promoter (−1000/+100), the luciferase activity was measured. b Luciferase report assay using the construct vector carrying the VMP1 promoter region, in which the predicted most likely three binding site (−648/−639, −560/−551, −33/−24, the upstream of the transcription start site of VMP1) with TFEB was mutant. c DNA Agar-gel electrophoresis from CHIP-qPCR assay, the amount of immunoprecipitated DNA isolated from TFEB special antibody/protein G magnetic beads was measured by qPCR. Primer specific for VMP1 promoter region (−116/+27). NC: negative control, PC: positive control, Group1: cells with no treat, Group2: cells with glucose starvation. d The mRNA expression level of TFEB, VMP1, miR-21 and the number of pri-miR-21 and VMP1-miR-21 transcripts were measured by qPCR, the protein expression level of TFEB and VMP1 were measured by Western blot after overexpression of the constitutively active TFEB by pCIP-caTfeb vector in RKO cells. e RKO was transfected with pCIP-caTfeb vector, then CHIP-qPCR analyses using phospho-STAT3 (Tyr705) special antibody were performed. Data are presented as mean ± SD. *** P < 0.001, ** P < 0.01, * P < 0.05.

    Techniques Used: Transfection, Plasmid Preparation, Construct, Luciferase, Activity Assay, Binding Assay, Mutagenesis, Nucleic Acid Electrophoresis, ChIP-qPCR, Immunoprecipitation, Isolation, Magnetic Beads, Negative Control, Positive Control, Expressing, Western Blot, Over Expression

    When TFEB was activated and transported into the nuclear in cells, VMP1 transcript was upregulated and VMP1-miR-21 transcript was down-regulated, Meanwhile, pri-miR-21 transcript was also reduced due to the binding of transcription factors to pri-miR-21 promoter were blocked by TFEB-induced high transcriptional activation of VMP1, such as STAT3 (dashed lines). When VMP1 transcription was inhibited by TFEB phosphorylation, both VMP1-miR-21 and pri-miR-21 transcripts were increased. Subsequently, the high expression of miR-21 increased phosphorylation of AKT by inhibiting PTEN, and then phosphorylated AKT promoted phosphorylation of TFEB and repressed its nuclear translocation, leading to VMP1 transcription was further inhibited and miR-21 transcription was further increased (solid lines).
    Figure Legend Snippet: When TFEB was activated and transported into the nuclear in cells, VMP1 transcript was upregulated and VMP1-miR-21 transcript was down-regulated, Meanwhile, pri-miR-21 transcript was also reduced due to the binding of transcription factors to pri-miR-21 promoter were blocked by TFEB-induced high transcriptional activation of VMP1, such as STAT3 (dashed lines). When VMP1 transcription was inhibited by TFEB phosphorylation, both VMP1-miR-21 and pri-miR-21 transcripts were increased. Subsequently, the high expression of miR-21 increased phosphorylation of AKT by inhibiting PTEN, and then phosphorylated AKT promoted phosphorylation of TFEB and repressed its nuclear translocation, leading to VMP1 transcription was further inhibited and miR-21 transcription was further increased (solid lines).

    Techniques Used: Binding Assay, Activation Assay, Phospho-proteomics, Expressing, Translocation Assay

    Related Articles

    Blocking Assay:

    Article Title: Kaempferol ameliorates gestational diabetes mellitus by regulating STAT3-associated AIM2 inflammasome activation and ferroptotic injury in trophoblasts
    Article Snippet: .. Following blocking, the membranes were incubated overnight at 4°C with primary antibodies, including AIM2 (1:1000, catalog number ab93015, Abcam), Glutathione Peroxidase 4 (GPX4, 1:1000, 52455, Cell Signaling Technology, CST), solute carrier family 7 member 11 (SLC7A11, 1:1000, 23276, CST), phospho-STAT3 (p-STAT3, 1:1000, 9145, CST), STAT3 (1:1000, 12640, CST), pro-IL-1β (1:1000, 12703, CST), IL-1β (1:1000, ab283818, Abcam), cleaved caspase-1 (1:1000, 4199, CST), pro-caspase-1 (1:1000, 24232, CST), STAT1 (1:1000, 9172T, CST), phospho-STAT1 (p-STAT1, 1:1000, 9177S, CST), IRF1 (1:1000, 9172T, CST) and β-actin (1:1000, 4967S, CST). .. After three washes with TBST, the membranes were incubated with a secondary antibody (1:5000, ab288151, Abcam) for 2 hours.

    Incubation:

    Article Title: Kaempferol ameliorates gestational diabetes mellitus by regulating STAT3-associated AIM2 inflammasome activation and ferroptotic injury in trophoblasts
    Article Snippet: .. Following blocking, the membranes were incubated overnight at 4°C with primary antibodies, including AIM2 (1:1000, catalog number ab93015, Abcam), Glutathione Peroxidase 4 (GPX4, 1:1000, 52455, Cell Signaling Technology, CST), solute carrier family 7 member 11 (SLC7A11, 1:1000, 23276, CST), phospho-STAT3 (p-STAT3, 1:1000, 9145, CST), STAT3 (1:1000, 12640, CST), pro-IL-1β (1:1000, 12703, CST), IL-1β (1:1000, ab283818, Abcam), cleaved caspase-1 (1:1000, 4199, CST), pro-caspase-1 (1:1000, 24232, CST), STAT1 (1:1000, 9172T, CST), phospho-STAT1 (p-STAT1, 1:1000, 9177S, CST), IRF1 (1:1000, 9172T, CST) and β-actin (1:1000, 4967S, CST). .. After three washes with TBST, the membranes were incubated with a secondary antibody (1:5000, ab288151, Abcam) for 2 hours.

    Article Title: KLF4 Protects Against Sepsis-Induced Coagulopathy via Inhibition of the AKT/mTOR/STAT3 Signaling Pathway
    Article Snippet: .. The PVDF membranes were blocked with 5% skimmed milk for 2 h at room temperature, followed by incubation with thrombin (ab314480, 1:1000, Abcam), PAI-1 (ab222754, 1:1000, Abcam), TF (DF6400, 1:2000, affinity), GAPDH (AF7021, 1:5000, affinity), Tubulin (AF7011,1:1000, affinity), p-AKT (4060S, 1:2000, CST), AKT (4691S, 1:1000, CST), p-mTOR (5536S, 1:2000, CST), mTOR (2983S, 1:1000, CST), KLF4 (4038T, 1:1000, CST), p-STAT3 (9145T, 1:2000, CST) and STAT3 (9139T, 1:1000, CST) were incubated at 4°C overnight. .. The next day, the membranes were incubated with HRPlabeled affinity-pure goat anti-rabbit IgG (H+L) (SA00001-2, 1:15000, Proteintech) or HRP-labeled affinity-pure goat anti-mouse IgG (H+L) (SA00001-1, 1:15000, Proteintech) for 1 h at room temperature.

    Article Title: PER2 knockdown drives immunotherapy resistance in gastric cancer via metabolic reprogramming of myeloid-derived suppressor cells.
    Article Snippet: Equal amounts of protein (30 μg) were separated by SDS-PAGE and transferred to PVDF membranes (ISEQ00010, Millipore, USA). .. Membranes were blocked with 5% non-fat milk (P0216, Beyotime, China) at room temperature for 1 hour, followed by overnight incubation at 4°C with the following primary antibodies: anti-phosphorylated STAT3 (p-STAT3) (9145S, Cell Signaling Technology, USA, 1:2000), anti-HK2 (2867T, Cell Signaling Technology, USA, 1:1000), anti-PFKFB3 (ab181861, Abcam, USA, 1:1000), anti-LDHA (2012S, Cell Signaling Technology, USA, 1:1000), and anti-β-tubulin (2128S, Cell Signaling Technology, USA, 1:1000). .. The next day, membranes were incubated for 1 hour with HRP-conjugated goat anti-rabbit secondary antibody (ab6721, Abcam, USA, 1:5000).

    Article Title: Qingjin Pingchuan formula attenuates pulmonary inflammation by reprogramming neutrophil SHP1-JAK2/SRC-STAT3 signaling.
    Article Snippet: Background: The Qingjin Pingchuan Formula (QJPC), a multi-herb traditional Chinese medicine prescription, is clinically employed for severe community-acquired pneumonia (SCAP), though its underlying molecular mechanisms remain incompletely understood.. Purpose: This study aimed to elucidate the anti-inflammatory effects of QJPC and its impact on neutrophilmediated signaling pathways.. Methods: An integrative strategy combining network pharmacology, single-cell RNA sequencing (scRNA-seq), and experimental validation was applied.

    Cell-Signaling:

    Article Title: Kaempferol ameliorates gestational diabetes mellitus by regulating STAT3-associated AIM2 inflammasome activation and ferroptotic injury in trophoblasts
    Article Snippet: .. Following blocking, the membranes were incubated overnight at 4°C with primary antibodies, including AIM2 (1:1000, catalog number ab93015, Abcam), Glutathione Peroxidase 4 (GPX4, 1:1000, 52455, Cell Signaling Technology, CST), solute carrier family 7 member 11 (SLC7A11, 1:1000, 23276, CST), phospho-STAT3 (p-STAT3, 1:1000, 9145, CST), STAT3 (1:1000, 12640, CST), pro-IL-1β (1:1000, 12703, CST), IL-1β (1:1000, ab283818, Abcam), cleaved caspase-1 (1:1000, 4199, CST), pro-caspase-1 (1:1000, 24232, CST), STAT1 (1:1000, 9172T, CST), phospho-STAT1 (p-STAT1, 1:1000, 9177S, CST), IRF1 (1:1000, 9172T, CST) and β-actin (1:1000, 4967S, CST). .. After three washes with TBST, the membranes were incubated with a secondary antibody (1:5000, ab288151, Abcam) for 2 hours.

    Article Title: Tissue-specific inflammation induces cell state plasticity with oncogenic addiction in mucosal melanoma
    Article Snippet: Anti-HER3/ErbB3 , Cell Signaling , 12708. .. Anti-Phospho-STAT3 (Tyr705) , Cell Signaling , 9145. .. Anti-GP100 , HUABIO , HA721719.

    Article Title: ET-1-induced CTGF expression is mediated by STAT3 activation through casein kinase 2α' and p300 but not casein kinase 2α in human lung fibroblasts.
    Article Snippet: Endothelin-1 (ET-1) is a critical mediator of airway remodeling and subepithelial fibrosis in patients with asthma.. However, the roles of casein kinase 2 (CK2), p300, and STAT3 signaling pathways in ET-1-induced connective tissue growth factor (CTGF) expression remain poorly understood.. In WI-38 cells (human lung fibroblasts), pharmacological inhibitors of CK2 (apigenin and 4, 5, 6, 7-tetrabromobenzotriazole (TBB)) markedly attenuated ET-1-induced CTGF expression, and ET-1 promoted nuclear translocation of CK2.

    Article Title: Omaveloxolone functions as a molecular crowbar-like degrader of STING to alleviate aging-related inflammation
    Article Snippet: .. Antibodies used included anti-p-STING (Ser366) (Cell Signaling Technology, CST, 50907), anti-p-STING (Ser365) (CST, 72971), antiSTING (CST, 13647), anti-p-TBK1 (Ser172) (CST, 5483), anti-TBK1 (CST, 3504), anti-p-IRF3 (Ser396) (CST, 29047), anti-IRF3 (CST, 11904), antiNF-κB p-p65 (Ser536) (CST, 3033), anti-NF-κB p65 (CST, 8242), anti-pSTAT3 (Tyr705) (CST, 9145), anti-STAT3 (CST, 12640), anti-NRF2 (CST, 12721), anti-HA-Tag (CST, 3724), anti-Flag-Tag (CST, 2368), anti-MycTag (CST, 2278), anti-K27-linkage specific ubiquitin (Abcam, ab181537), anti-β-Actin (CST, 4970), anti-GAPDH (CST, 2118), anti-β-Tubulin (Starter, S0B0238), anti-HUWE1 (CST, 5695), anti-TRIM25 (CST, 13773), anti-MID1 (Immunoway, YT2760), anti-RNF219 (Proteintech, 24988-1- a Age (months) 22 23 24 25 10 mg kg-1 OMA (once every two days) 10 mg kg-1 H-151 (daily) Treatment break 10 mg kg-1 OMA (once every two days) 10 mg kg-1 H-151 (daily) End of the study 2.0 1.5 1.0 0.5 0.0 Il6 Tnf Gbp 2 Il1b Ccl 5 Ifi44 Ccl 4 R el at iv e m R N A le ve ls in li v e r 2.5 H-1 51 0 2 4 6 8 H an gi ng ti m e (s ) Ve hic le OM A Ccl 4 Ccl 5 Ifi44 Irf7 Isg1 5 Gbp 2 Cxc l10 Ifit2 3.0 2.0 1.0 0.0R el at iv e m R N A le ve ls in b ra in Br ai n, N eu N DAPI | NeuN | Synaptophysin Yo un g , V eh i c le Ag ed , O M A A g e d , V eh ic le A g ed , H - 1 5 1 Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA Ki dn ey Li ve r Br ai n, IB A1 Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMAf Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA p-STING STING p-TBK1 TBK1 ACTB Young Vehicle Aged Vehicle Aged OMA Aged H-151 b c d e h i g Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA 2.0 1.5 1.0 0.5 0.0 Isg1 5 Ifitm 3 Cxc l10 Cxc l9 Il1b B2m Ccl 5 Il6 Tnf Irf7 R el at iv e m R N A l e ve ls in k i d ne y kDa -35 -35 -70 -70 -40 P = 0.0003 P < 0.0001 P = 0.0007 P = 0.0005 P = 0.0007 P = 0.0001 P = 0.0010 P = 0.0010 P = 0.0039 P = 0.0032 P = 0.0273 P = 0.0160 P = 0.0139 P = 0.0072 P = 0.0007 P = 0.0008 P < 0.0001 P < 0.0001 P = 0.0003 P = 0.0002 P = 0.0009 P = 0.0004 P = 0.0006 P = 0.0002 P = 0.0107 P = 0.0052 P = 0.0062 P = 0.0002 P = 0.0003 P = 0.0001 P = 0.0022 P = 0.0015 P = 0.0033 P = 0.0013 P = 0.0051 P = 0.0018 P = 0.0010 P = 0.0045 P = 0.0063 P = 0.0027 P = 0.0941 P = 0.0753 P = 0.0832 P = 0.0320 P = 0.1623 P = 0.0444 P = 0.0817 P = 0.0305 P = 0.0584 P = 0.0409 P = 0.0102 P = 0.0038 Nature Communications Article in Press AP), HRP-conjugated anti-rabbit IgG (Promega, W4011), HRPconjugated anti-mouse IgG (Promega, W4021). ..

    Sequencing:

    Article Title: Apc-deficient pituitary stem cells drive adamantinomatous craniopharyngioma through senescence-associated inflammation.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalogue number Experimental models Rosa26CAGLoxpSTOPLoxpTdTomato Jax-Lab stock #007905 ApcLoxp(Exon15)/Loxp(Exon15) Jax-Lab stock #029275 © The Author(s) EMBO Molecular Medicine 15 Reagent/resource Reference or source Identifier or catalogue number ApcLoxp(Exon1-15)/Loxp(Exon1-15) Jax-Lab stock #009045 Tcf/Lef-1:H2B-GFP Jax-Lab stock #032838 Sox2CreERT2/+ Jax-Lab stock #017593 Ctnnb1LoxP(exon3)/+ M Taketo (Harada, N. et al, 1999) Provided by M Taketo (Harada, N. et al, 1999) Antibodies Rabbit αphosphorylated-histone H3 (α-pHH3) 1:500 dilution, Millipore, 06-570 Millipore 06-570 Rabbit α-PRL 1:500 dilution The National Hormone and Peptide Program (NHPP), Harbour-UCLA Medical Centre Rabbit α-LH 1:500 dilution The National Hormone and Peptide Program (NHPP), Harbour-UCLA Medical Centre Rabbit α-TSH 1:500 dilution The National Hormone and Peptide Program (NHPP), Harbour-UCLA Medical Centre Rabbit α-GH 1:500 dilution The National Hormone and Peptide Program (NHPP), Harbour-UCLA Medical Centre Rabbit α-Pomc 1:500 dilution The National Hormone and Peptide Program (NHPP), Harbour-UCLA Medical Centre Rabbit α-GSU 1:500 dilution The National Hormone and Peptide Program (NHPP), Harbour-UCLA Medical Centre Goat α-Sox2 1:200 dilution, Statech, GT15098 Statech, GT15098 Rabbit α-Sox9 1:500 dilution Millipore (AB5535) Mouse α-β-Catenin 1:300 dilution, SIGMA, C7082 SIGMA (C7082) Chicken α-GFP 1:100 Abcam (ab13970) Abcam (ab13970) Mouse α-APC CT (clone C-APC 28.9) 1:1000 Millipore (MAB3786) Millipore (MAB3786) Rabbit α-p21 [EPR18021] 1:1000 (Abcam) ab188224 Abcam (ab188224) Rabbit α-pSTAT3 1:300 Cell Signalling Cell Signalling (9145) Rabbit α-NF-kB (p65) 1:300 (Abcam) ab16502 Abcam (ab16502) Rabbit α-β-Catenin 1:300 (Abcam) Abcam (ab16051) Rat α-CDKN2A/ p16INK4a antibody [PABLO33B]) 1:300 (Abcam) ab241543 Abcam (ab241543) Mouse α-H2A.X phosphor (Ser 139) 1:150 Biolegend G13402 Biolegend (G13402) Reagent/resource Reference or source Identifier or catalogue number Mouse α-β-Actin 1:5000 Merck A5441 Merck (A5441) Rabbit α-Vinculin 1:1000 dilution Abcam (ab129002) Biotinylated goat antirabbit antibody 1:300 dilution, Vector Laboratories, BA-1000 Vector Laboratories (BA-1000) Biotinylated horse antigoat antibody 1:200 dilution, Vector Laboratories, BA-9500 Vector Laboratories (BA-9500) Donkey anti-goat antibody, Alexa Fluor 568 1:300, Invitrogen, A-11057 Invitrogen (A11057) Goat anti-mouse antibody, Alexa Fluor 488 1:300, Invitrogen, A-11001 Invitrogen (A11001) Goat-anti-mouse IRDye 800CW (1:1000) 926-32210 LI-COR 926-32210 LICOR Goat-anti-Rabbit IRDye 680RD (1:1000) 926-68071 LI-COR 926-68071 LICOR Oligonucleotides and other sequence-based reagents Apc (exon 15) FW: ACGAAGACCACAGGCAAATC REV: CCACAAAGTTCCACATGCATTAC Merck Axin2 FW: ACGAAGACCACAGGCAAATC REV: CCACAAAGTTCCACATGCATTAC Merck Lef1 FW: ACTGTCAGGCGACACTTCCATG REV: GTGCTCCTGTTTGACCTGAGGT Merck Wnt7a FW: TTCGCCAAGGTCTTCGTGGATG REV: TACAGGAGCCTGACACACCATG Merck Ccl2 FW: TTAAAAACCTGGATCGGAACCAA REV: GTCTGGACCCATTCCTTCTTGG Merck Fgf3 FW: GCAAGCTCTACTGCGCTACCAA REV: CACTTCCACCGCAGTAATCTCC Merck Ccl3 FW: TGTACCATGACACTCTGCAAC REV: CAACGATGAATTGGCGTGGAA Merck Notum FW: CGTGGTACACTCAAGGATGTGC REV: GCCTTATGGCTGTCATGGAAGC Merck Gh FW: TCAGAATGCCCAGGCTGCTTTC REV: ACTGGATGAGCAGCAGCGAGAA Merck Tsh FW: GAGAGTGTGCCTACTGCCTG REV: ACAGACATCCTGAGAGAGTGC Merck Prl FW: CTCAGGCCATCTTGGAGAAG REV: TCGGAGAGAAGTCTGGCAGT Merck p21 (Cdkn1a) FW: GTCGCTGTCTTGCACTCTGG RE: CTCTTGCAGAAGACCAATCTGC Merck Software R version 4.3.0 (2023- 04-21) https://www.r-project.org NA 16 EMBO Molecular Medicine © The Author(s) Reagent/resource Reference or source Identifier or catalogue number GraphPad PRISM 11.0.1 (99) GraphPad PRISM Photoshop 2025 Adobe Other .. The transgenic lines Rosa26CAGLoxpSTOPLoxpTdTomato (stock #007905) (Madisen et al, 2010), ApcLoxp(Exon15)/Loxp(Exon15) (stock #029275) (RobanusMaandag et al, 2010), ApcLoxp(Exon1-15)/Loxp(Exon1-15) (stock #009045) (Cheung et al, 2010), Tcf/Lef-1:H2B-GFP (stock #032838) (FerrerVaquer et al, 2010) and the Sox2CreERT2/+ (stock #017593) (Arnold et al, 2011) were obtained from the JAX-lab and have been previously described.

    Ubiquitin Proteomics:

    Article Title: Omaveloxolone functions as a molecular crowbar-like degrader of STING to alleviate aging-related inflammation
    Article Snippet: .. Antibodies used included anti-p-STING (Ser366) (Cell Signaling Technology, CST, 50907), anti-p-STING (Ser365) (CST, 72971), antiSTING (CST, 13647), anti-p-TBK1 (Ser172) (CST, 5483), anti-TBK1 (CST, 3504), anti-p-IRF3 (Ser396) (CST, 29047), anti-IRF3 (CST, 11904), antiNF-κB p-p65 (Ser536) (CST, 3033), anti-NF-κB p65 (CST, 8242), anti-pSTAT3 (Tyr705) (CST, 9145), anti-STAT3 (CST, 12640), anti-NRF2 (CST, 12721), anti-HA-Tag (CST, 3724), anti-Flag-Tag (CST, 2368), anti-MycTag (CST, 2278), anti-K27-linkage specific ubiquitin (Abcam, ab181537), anti-β-Actin (CST, 4970), anti-GAPDH (CST, 2118), anti-β-Tubulin (Starter, S0B0238), anti-HUWE1 (CST, 5695), anti-TRIM25 (CST, 13773), anti-MID1 (Immunoway, YT2760), anti-RNF219 (Proteintech, 24988-1- a Age (months) 22 23 24 25 10 mg kg-1 OMA (once every two days) 10 mg kg-1 H-151 (daily) Treatment break 10 mg kg-1 OMA (once every two days) 10 mg kg-1 H-151 (daily) End of the study 2.0 1.5 1.0 0.5 0.0 Il6 Tnf Gbp 2 Il1b Ccl 5 Ifi44 Ccl 4 R el at iv e m R N A le ve ls in li v e r 2.5 H-1 51 0 2 4 6 8 H an gi ng ti m e (s ) Ve hic le OM A Ccl 4 Ccl 5 Ifi44 Irf7 Isg1 5 Gbp 2 Cxc l10 Ifit2 3.0 2.0 1.0 0.0R el at iv e m R N A le ve ls in b ra in Br ai n, N eu N DAPI | NeuN | Synaptophysin Yo un g , V eh i c le Ag ed , O M A A g e d , V eh ic le A g ed , H - 1 5 1 Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA Ki dn ey Li ve r Br ai n, IB A1 Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMAf Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA p-STING STING p-TBK1 TBK1 ACTB Young Vehicle Aged Vehicle Aged OMA Aged H-151 b c d e h i g Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA Young, Vehicle Aged, Vehicle Aged, H-151 Aged, OMA 2.0 1.5 1.0 0.5 0.0 Isg1 5 Ifitm 3 Cxc l10 Cxc l9 Il1b B2m Ccl 5 Il6 Tnf Irf7 R el at iv e m R N A l e ve ls in k i d ne y kDa -35 -35 -70 -70 -40 P = 0.0003 P < 0.0001 P = 0.0007 P = 0.0005 P = 0.0007 P = 0.0001 P = 0.0010 P = 0.0010 P = 0.0039 P = 0.0032 P = 0.0273 P = 0.0160 P = 0.0139 P = 0.0072 P = 0.0007 P = 0.0008 P < 0.0001 P < 0.0001 P = 0.0003 P = 0.0002 P = 0.0009 P = 0.0004 P = 0.0006 P = 0.0002 P = 0.0107 P = 0.0052 P = 0.0062 P = 0.0002 P = 0.0003 P = 0.0001 P = 0.0022 P = 0.0015 P = 0.0033 P = 0.0013 P = 0.0051 P = 0.0018 P = 0.0010 P = 0.0045 P = 0.0063 P = 0.0027 P = 0.0941 P = 0.0753 P = 0.0832 P = 0.0320 P = 0.1623 P = 0.0444 P = 0.0817 P = 0.0305 P = 0.0584 P = 0.0409 P = 0.0102 P = 0.0038 Nature Communications Article in Press AP), HRP-conjugated anti-rabbit IgG (Promega, W4011), HRPconjugated anti-mouse IgG (Promega, W4021). ..



    Similar Products

    stat3 expression construct  (OriGene)
    96
    OriGene stat3 expression construct
    Stat3 Expression Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pCMV6-XL4+Mammalian+Expression+Vector/pm42162632-58-3-16
    Average 96 stars, based on 1 article reviews
    stat3 expression construct - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    stat3 expression construct plegfp wt stat3 oncogene  (Addgene inc)
    93
    Addgene inc stat3 expression construct plegfp wt stat3 oncogene
    Stat3 Expression Construct Plegfp Wt Stat3 Oncogene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pLEGFP-WT-STAT3+(Plasmid+%2371450)/pm40247082-88-0-8
    Average 93 stars, based on 1 article reviews
    stat3 expression construct plegfp wt stat3 oncogene - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    lentiviral expression constructs human stat3  (Shanghai Genechem Ltd)
    90
    Shanghai Genechem Ltd lentiviral expression constructs human stat3
    A , B Role of <t>ELK1,</t> STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.
    Lentiviral Expression Constructs Human Stat3, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pcdna3+1/pmc11904182-358-6-35
    Average 90 stars, based on 1 article reviews
    lentiviral expression constructs human stat3 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    stat3-expression construct nm_139276  (Genechem)
    90
    Genechem stat3-expression construct nm_139276
    A , B Role of <t>ELK1,</t> STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.
    Stat3 Expression Construct Nm 139276, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/stat3+shrna/pmc11008271-159-0-13
    Average 90 stars, based on 1 article reviews
    stat3-expression construct nm_139276 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    shrna stat3 expressing vectors construction  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology shrna stat3 expressing vectors construction
    A , B Role of <t>ELK1,</t> STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.
    Shrna Stat3 Expressing Vectors Construction, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/Stat3/ppr0746723-65-0-15
    Average 96 stars, based on 1 article reviews
    shrna stat3 expressing vectors construction - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    green fluorescence protein gfp labeled stat3 expression construct  (OriGene)
    96
    OriGene green fluorescence protein gfp labeled stat3 expression construct
    Figure 2. Analysis of <t>STAT3</t> in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).
    Green Fluorescence Protein Gfp Labeled Stat3 Expression Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/pCMV6-XL4+Mammalian+Expression+Vector/pm35884913-46-1-16
    Average 96 stars, based on 1 article reviews
    green fluorescence protein gfp labeled stat3 expression construct - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    flag stat3c catalog 8722 expression constructs  (Addgene inc)
    93
    Addgene inc flag stat3c catalog 8722 expression constructs
    Figure 2. Analysis of <t>STAT3</t> in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).
    Flag Stat3c Catalog 8722 Expression Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/Stat3-C+Flag+pRc%2FCMV+(Plasmid+%238722)/10__1172_slash_jci134217-286-7-15
    Average 93 stars, based on 1 article reviews
    flag stat3c catalog 8722 expression constructs - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    constitutively active stat3 expression construct stat3-c flag prc/cmv  (Addgene inc)
    90
    Addgene inc constitutively active stat3 expression construct stat3-c flag prc/cmv
    Shikonin inhibited <t>STAT3</t> signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.
    Constitutively Active Stat3 Expression Construct Stat3 C Flag Prc/Cmv, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/stat3+cdna+kiaa1524/pmc07267064-85-1-11
    Average 90 stars, based on 1 article reviews
    constitutively active stat3 expression construct stat3-c flag prc/cmv - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    construct expressing constitutively active stat3 mutant pstat3-c  (Addgene inc)
    90
    Addgene inc construct expressing constitutively active stat3 mutant pstat3-c
    Shikonin inhibited <t>STAT3</t> signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.
    Construct Expressing Constitutively Active Stat3 Mutant Pstat3 C, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stat3+expression+construct/stat3+cdna+kiaa1524/pm29901084-53-4-14
    Average 90 stars, based on 1 article reviews
    construct expressing constitutively active stat3 mutant pstat3-c - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A , B Role of ELK1, STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.

    Journal: Cell Death & Disease

    Article Title: Both direct and indirect suppression of MCL1 synergizes with BCLXL inhibition in preclinical models of gastric cancer

    doi: 10.1038/s41419-025-07481-8

    Figure Lengend Snippet: A , B Role of ELK1, STAT3 and SRF in regulating the transcriptional activity of MCL1 under basal conditions and in response to HER2-targeting drugs. SNU-216 cells expressing empty vector or the indicated transcriptional factors were left untreated or treated with 100 ng/ml trastuzumab ( A ) or 200 nM lapatinib ( B ) for 72 h or 48 h, respectively. The levels of MCL1 mRNA were determined using RT-qPCR. C Effect of HER2-targeting drugs on STAT3 and SRF expression. SNU-216, NCI-N87 and GCIY were treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. The protein levels of p-STAT3, total STAT3, and SRF were determined by Western blotting. D , E Dual luciferase reporter assays to identify the binding site(s) of STAT3 and SRF in the MCL1 promoter. Left: diagram depicting the putative binding sites of STAT3 ( D ) or SRF ( E ) in the MCL1 promoter predicted by the JASPAR database. Right: Dual luciferase reporter assays conducted in HEK293T. F Reduced binding of STATS and SRF in the MCL1 promoter upon HER2-targeting drug treatments. SNU-216 cells were left untreated or treated with 100 ng/ml trastuzumab or 200 nM lapatinib for 72 h or 48 h, respectively. ChIP was conducted using specific antibodies against STAT3, SRF, and an IgG isotype control. G Co-IP analysis of the interaction of endogenous STAT3 and SRF in SNU-216 cells. H Direct interaction of exogenous STAT3 and SRF. HEK293T cells were transiently transfected with HA-tagged STAT3, Flag-tagged SRF, either individually or both. Equivalent lysates were immunoprecipitated with anti-HA or anti-Flag antibody and immunoblotted with the indicated antibodies. I Effect of overexpressing or deleting STAT3 on SRF expression. The mRNA (left) and protein (right) levels of SRF in SNU-216 cells with STAT3 overexpression or depletion were determined. J Similar experiments to those in panel I were conducted to detect the effect of manipulating SRF on STAT3 expression in SNU-216 cells. K Reduced binding of STAT3 in the SRF promoter upon HER2-targeting drug treatments. Similar experiments to those in ( F ) were conducted. L Depletion of STAT3 attenuated the binding of SRF in the MCL1 promoter. Similar experiments to those in ( F ) were performed in SNU-216 cells engineered to express sg STAT3 . ChIP was conducted at 72 h after addition of DOX to induce the deletion of STAT3 . 2 sgRNAs were tested. M , N Deleting STAT3 enhanced the sensitivity of GC lines to BCLXL inhibition. SNU-216 ( M ) and GCIY ( N ) cells inducibly expressing sg STAT3 or the sgRNA empty vector were treated with DOX alone, or in combination with indicated concentrations of BCLXLi. Cell viability was determined 48 h later. Two-way ANOVA was used for statistical significance. O STAT3 inhibitor synergized with BCLXLi in GC cell lines, regardless of their p-STAT3 levels. GC cell lines with high p-STAT3 levels (HGC-27, MKN45 and AGS) and the ones with low p-STAT3 levels (SNU-216, NCI-N87, GCIY) were treated with indicated concentrations of BCLXLi and STAT3 inhibitor and cell viability was determined 48 h later. Data in ( A ), ( B ), ( D ), ( E ), ( I , left ), ( J , left ), ( M – O ) represent the means ± SD of ≥3 independent experiments; data in panel ( C ), ( F – H ), ( I , right ), ( J , right ), ( K ) and ( L ) are representatives of 2 independent experiments.

    Article Snippet: The GV492 lentiviral expression constructs of human ELK1, ELK3, ELK4, STAT3, SRF, as well as the GV366 (C-terminally HA-tagged) and GV657 (C-terminally Flag-tagged) constructs for transient expression of human STAT3 and SRF were purchased from Shanghai Genechem Co., Ltd.

    Techniques: Activity Assay, Expressing, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Luciferase, Binding Assay, Control, Co-Immunoprecipitation Assay, Transfection, Immunoprecipitation, Over Expression, Inhibition

    Figure 2. Analysis of STAT3 in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).

    Journal: Biomedicines

    Article Title: Downregulation of STAT3 in Epstein-Barr Virus-Positive Hodgkin Lymphoma.

    doi: 10.3390/biomedicines10071608

    Figure Lengend Snippet: Figure 2. Analysis of STAT3 in HL cell lines. (A) RQ-PCR analysis of STAT3 in eight HL cell lines (left). Western blot analysis of three HL cell lines for STAT3, phospho (P)-STAT3 and alpha-tubulin (TUBA) as control (right). (B) Immuno-cytological microscopy of untreated AM-HLH cells (left) stained for STAT3 (green) and the nucleus (blue). Forced expression of GFP-labeled STAT3 in transfected AM- HLH (right). White arrowheads indicate transfected nuclei demonstrating reduced STAT3 protein in the nucleus as compared to the cytoplasm. The light blue arrowhead indicates a non-transfected cell. (C) Western blot analysis of IL6-treated AM-HLH for STAT3, P-STAT3 and TUBA (left). Immuno- cytological microscopy of IL6-treated AM-HLH cells stained for STAT3 (green) and the nucleus (blue) (middle). RQ-PCR analysis of HLX in IL6-treated AM-HLH after 4 h (right). (D) Immuno-cytological microscopy of control and TSA-treated L-540 cells stained for STAT3 (green) and the nucleus (blue). (E) RQ-PCR analysis of HLX in L-540 (left) AM-HLH (right) treated with TSA. Statistical significance was assessed by t-test and derived p-values indicated by asterisks (** p < 0.01, *** p < 0.001, n.s., not significant).

    Article Snippet: A green fluorescence protein (GFP)-labeled STAT3 expression construct was cloned into vector pCMV6-XL4 and obtained from Origene (Wiesbaden, Germany).

    Techniques: Western Blot, Control, Microscopy, Staining, Expressing, Labeling, Transfection, Derivative Assay

    Figure 4. Knockdown and stimulation studies in AM-HLH and L-540. (A) SiRNA-mediated knock- down of IRF4 in AM-HLH resulted in elevated expression of STAT3 as analyzed by RQ-PCR (left). The

    Journal: Biomedicines

    Article Title: Downregulation of STAT3 in Epstein-Barr Virus-Positive Hodgkin Lymphoma.

    doi: 10.3390/biomedicines10071608

    Figure Lengend Snippet: Figure 4. Knockdown and stimulation studies in AM-HLH and L-540. (A) SiRNA-mediated knock- down of IRF4 in AM-HLH resulted in elevated expression of STAT3 as analyzed by RQ-PCR (left). The

    Article Snippet: A green fluorescence protein (GFP)-labeled STAT3 expression construct was cloned into vector pCMV6-XL4 and obtained from Origene (Wiesbaden, Germany).

    Techniques: Knockdown, Expressing

    Figure 6. Summary of the results from this study showing a gene regulatory network around STAT3. Genomic amplifications targeting particular genes are highlighted by a red background. Elevated genes are indicated in red, low level expressed genes in green while medium level expressed genes are shown in black. Functional consequences including immune escape, EBV activity, proliferation and survival are highlighted by a blue background. Bold lines indicate relationships demonstrated in this study while slight lines refer to published data.

    Journal: Biomedicines

    Article Title: Downregulation of STAT3 in Epstein-Barr Virus-Positive Hodgkin Lymphoma.

    doi: 10.3390/biomedicines10071608

    Figure Lengend Snippet: Figure 6. Summary of the results from this study showing a gene regulatory network around STAT3. Genomic amplifications targeting particular genes are highlighted by a red background. Elevated genes are indicated in red, low level expressed genes in green while medium level expressed genes are shown in black. Functional consequences including immune escape, EBV activity, proliferation and survival are highlighted by a blue background. Bold lines indicate relationships demonstrated in this study while slight lines refer to published data.

    Article Snippet: A green fluorescence protein (GFP)-labeled STAT3 expression construct was cloned into vector pCMV6-XL4 and obtained from Origene (Wiesbaden, Germany).

    Techniques: Functional Assay, Activity Assay

    Shikonin inhibited STAT3 signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Inhibition of the STAT3 Signaling Pathway Contributes to the Anti-Melanoma Activities of Shikonin

    doi: 10.3389/fphar.2020.00748

    Figure Lengend Snippet: Shikonin inhibited STAT3 signaling pathway in melanoma cells. (A) Cells were treated with indicated concentration of shikonin for 24 h, expression levels of STAT3 and p-STAT3 were determined by the Western blot analysis (upper), and relative expression levels were analyzed by Image J software (bottom). (B) Cells were treated with 2 μM shikonin for 24 h, and then incubated with DSS. Changes in STAT3 dimerization were evaluated by immunoblotting. The arrows indicated the dimer (D) and the monomer (M) STAT3. The representative results (upper) and the relative expression levels of dimer STAT3 (bottom) were shown. (C, D) Cells were treated with indicated concentration of shikonin for 24 h, and then the intracellular distribution of STAT3 was analyzed by immunofluorescence assay (C) and immunoblotting (D) . Relative expression levels of cytosolic and nuclear STAT3 were also shown (bottom). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01.

    Article Snippet: Constitutively active STAT3 expression construct STAT3-C Flag pRc/CMV was obtained from Addgene (USA).

    Techniques: Concentration Assay, Expressing, Western Blot, Software, Incubation, Immunofluorescence

    Shikonin down-regulated protein levels and inhibited enzymatic activities of STAT3-targeted molecules in melanoma cells. A375 and A2058 cells were treated with indicated concentrations of shikonin for 24 h, and then total cell lysates were collected, expression levels of (A) Mcl-1, Bcl-2, (B) MMP-2, (D) Twist, Vimentin, and N-cadherin were evaluated by Western blot analysis (left) and relative expression levels were analyzed by Image J software (right). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01. (C) The enzymatic activities of MMP-2 and MMP-9 were determined by gelatinase zymography.

    Journal: Frontiers in Pharmacology

    Article Title: Inhibition of the STAT3 Signaling Pathway Contributes to the Anti-Melanoma Activities of Shikonin

    doi: 10.3389/fphar.2020.00748

    Figure Lengend Snippet: Shikonin down-regulated protein levels and inhibited enzymatic activities of STAT3-targeted molecules in melanoma cells. A375 and A2058 cells were treated with indicated concentrations of shikonin for 24 h, and then total cell lysates were collected, expression levels of (A) Mcl-1, Bcl-2, (B) MMP-2, (D) Twist, Vimentin, and N-cadherin were evaluated by Western blot analysis (left) and relative expression levels were analyzed by Image J software (right). Data were shown as mean ± SD from three independent experiments, * P < 0.05 and ** P < 0.01. (C) The enzymatic activities of MMP-2 and MMP-9 were determined by gelatinase zymography.

    Article Snippet: Constitutively active STAT3 expression construct STAT3-C Flag pRc/CMV was obtained from Addgene (USA).

    Techniques: Expressing, Western Blot, Software, Zymography

    Overexpression of STAT3 in human melanoma A375 cells reduced shikonin-mediated cell growth, migration, and invasion inhibition. A375 cells were transiently transfected with an empty vector or a STAT3C-expressing construct for 24 h, and then (A) the expression level of STAT3 in A375-STAT3C cells and A375-EV cells were examined by immunoblotting. (B–D) A375-EV or A375-STAT3C cells were incubated with shikonin for 48 h or 24 h, and then (B) cell proliferation, (C) cell migratory, and (D) cell invasive abilities were measured. Representative photographs of migrated cells (left) and quantification of these cells (right) were shown. Data were mean ± SD from three independent experiments, ## P < 0.01, * P < 0.05, and ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Inhibition of the STAT3 Signaling Pathway Contributes to the Anti-Melanoma Activities of Shikonin

    doi: 10.3389/fphar.2020.00748

    Figure Lengend Snippet: Overexpression of STAT3 in human melanoma A375 cells reduced shikonin-mediated cell growth, migration, and invasion inhibition. A375 cells were transiently transfected with an empty vector or a STAT3C-expressing construct for 24 h, and then (A) the expression level of STAT3 in A375-STAT3C cells and A375-EV cells were examined by immunoblotting. (B–D) A375-EV or A375-STAT3C cells were incubated with shikonin for 48 h or 24 h, and then (B) cell proliferation, (C) cell migratory, and (D) cell invasive abilities were measured. Representative photographs of migrated cells (left) and quantification of these cells (right) were shown. Data were mean ± SD from three independent experiments, ## P < 0.01, * P < 0.05, and ** P < 0.01.

    Article Snippet: Constitutively active STAT3 expression construct STAT3-C Flag pRc/CMV was obtained from Addgene (USA).

    Techniques: Over Expression, Migration, Inhibition, Transfection, Plasmid Preparation, Expressing, Construct, Western Blot, Incubation