iκbα double nickase plasmid h (Santa Cruz Biotechnology)
Santa Cruz Biotechnology is a verified supplier 
91
Structured Review
Santa Cruz Biotechnology
iκbα double nickase plasmid h
Iκbα Double Nickase Plasmid H, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+program+for+dna+sequencing/I%CE%BAB-%CE%B1+Double+Nickase+Plasmid/pmc10314122-444-67-73
Average 91 stars, based on 1 article reviews
Iκbα Double Nickase Plasmid H, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+program+for+dna+sequencing/I%CE%BAB-%CE%B1+Double+Nickase+Plasmid/pmc10314122-444-67-73
Average 91 stars, based on 1 article reviews
iκbα double nickase plasmid h - by Bioz Stars,
2026-11
91/100 stars
Images
1) Product Images from "Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas"
Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas
Journal: Cell Reports Medicine
doi: 10.1016/j.xcrm.2023.101082
Figure Legend Snippet:
Techniques Used: Plasmid Preparation, Recombinant, Transfection, Activation Assay, Methylation, Marker, DNA Methylation Assay, Sequencing, Empire Assay, Software
Related Articles
Knockdown:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with IkBa Double Nickase Plasmid (h) (sc-400034-NIC, Santa Cruz)—consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20-nucleotide (nt) guide RNA (gRNA)—using plasmid transfection medium (sc-108062) and Ultra-Cruz transfection reagent (sc-395739) at 1:1.5 ratio and were incubated for 72 h. After incubation, cells were screened for GFP-positivity to select for successfully transfected cells. .. Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with Stable Transfection:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with IkBa Double Nickase Plasmid (h) (sc-400034-NIC, Santa Cruz)—consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20-nucleotide (nt) guide RNA (gRNA)—using plasmid transfection medium (sc-108062) and Ultra-Cruz transfection reagent (sc-395739) at 1:1.5 ratio and were incubated for 72 h. After incubation, cells were screened for GFP-positivity to select for successfully transfected cells. .. Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with Mutagenesis:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with IkBa Double Nickase Plasmid (h) (sc-400034-NIC, Santa Cruz)—consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20-nucleotide (nt) guide RNA (gRNA)—using plasmid transfection medium (sc-108062) and Ultra-Cruz transfection reagent (sc-395739) at 1:1.5 ratio and were incubated for 72 h. After incubation, cells were screened for GFP-positivity to select for successfully transfected cells. .. Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with Transfection:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with IkBa Double Nickase Plasmid (h) (sc-400034-NIC, Santa Cruz)—consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20-nucleotide (nt) guide RNA (gRNA)—using plasmid transfection medium (sc-108062) and Ultra-Cruz transfection reagent (sc-395739) at 1:1.5 ratio and were incubated for 72 h. After incubation, cells were screened for GFP-positivity to select for successfully transfected cells. .. Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with Control:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with IkBa Double Nickase Plasmid (h) (sc-400034-NIC, Santa Cruz)—consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20-nucleotide (nt) guide RNA (gRNA)—using plasmid transfection medium (sc-108062) and Ultra-Cruz transfection reagent (sc-395739) at 1:1.5 ratio and were incubated for 72 h. After incubation, cells were screened for GFP-positivity to select for successfully transfected cells. .. Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with Concentration Assay:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with CRISPR:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Knock-Out:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with IkBa Double Nickase Plasmid (h) (sc-400034-NIC, Santa Cruz)—consisting of a pair of plasmids each encoding a D10A mutated Cas9 nuclease and a target-specific 20-nucleotide (nt) guide RNA (gRNA)—using plasmid transfection medium (sc-108062) and Ultra-Cruz transfection reagent (sc-395739) at 1:1.5 ratio and were incubated for 72 h. After incubation, cells were screened for GFP-positivity to select for successfully transfected cells. .. Knockdown and knockout of NFKBIA For near-complete knockdown of NFKBIA, G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1-(R132H) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA, astrocytes were transfected with Plasmid Preparation:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: .. IκB-α Double Nickase Plasmid (h) , Santa Cruz , Cat# Incubation:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas Article Snippet: Pictures were taken using appropriate fluorescent filters on a Zeiss AXIO Observer D1 microscope. .. For near-complete knockdown of NFKBIA , G418-resistant primary human astrocytes transduced to stably express wildtype IDH1 or mutant IDH1- ( R132H ) were transfected with Accell human NFKBIA small interfering (si)RNA or non-targeting control siRNA (Dharmacon), at 20nM concentration using lipofectamine 2000 reagent (Invitrogen) at 1:1 ratio for 48 h. For complete clustered regularly interspaced short palindromic repeats (CRISPR) knockout of NFKBIA , astrocytes were transfected with other:Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a |