software; algorithm prism 9 software (GraphPad Software Inc)

GraphPad Software Inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

GraphPad Software Inc software; algorithm prism 9 software
KEY RESOURCES TABLE

Software; Algorithm Prism 9 Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software%2C+algorithm+prism+9/software++algorithm+prism+9/pmc11182612-402-159-163
Average 90 stars, based on 1 article reviews

software; algorithm prism 9 software - by Bioz Stars, 2026-09

90/100 stars

Images

1) Product Images from "Convergence of clinically relevant manipulations on dopamine-regulated prefrontal activity underlying stress-coping responses"

Article Title: Convergence of clinically relevant manipulations on dopamine-regulated prefrontal activity underlying stress-coping responses

Journal: Biological psychiatry

doi: 10.1016/j.biopsych.2021.11.008

Figure Legend Snippet: KEY RESOURCES TABLE

Techniques Used: Virus, Software

Western Blot:

Article Title: The Calpain-7 protease functions together with the ESCRT-III protein IST1 within the midbody to regulate the timing and completion of abscission
Article Snippet: Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line (Homo sapiens) Hela- N Maureen Powers Lab HeLa cells selected for transfectability Cell line (Homo sapiens) HEK293T ATCC CRL- 3216 Antibody Anti- FLAG (M2, mouse monoclonal) Sigma F1804 WB (1:5000) Antibody Anti- MYC (4A6, mouse monoclonal) Millipore 05- 724 WB (1:2500) Antibody Anti- RFP (rat monoclonal) ChromoTek 5F8 IF (1:500) Antibody Anti- RFP (mouse monoclonal) ChromoTek 6G6 WB (1:1000) Antibody Anti- alpha- tubulin (DM1A, mouse monoclonal) Cell Signaling Technologies DM1A IF (1:2000) Antibody Anti- alpha- Tubulin (chicken polyclonal) Synaptic Systems 302 206 IF (1:1000) Antibody Anti- CAPN7 (rabbit polyclonal) Proteintech Cat# 26985- 1- AP IF (1:500) WB (1:4000) Antibody Anti- IST1 (rabbit polyclonal) Sundquist Lab/Covance UT560 IF (1:1000) Paine et al. eLife 2023;12:e84515. .. DOI: https://doi.org/10.7554/eLife.84515 15 of 25 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti- NUP153 (SA1) (mouse monoclonal) Brian Burke WB (1:50) Antibody Anti- NUP50 (rabbit polyclonal) Mackay et al., 2010 WB (1:2500) Antibody Anti- GAPDH (mouse monoclonal) Millipore Sequence- based reagent siNT Mackay et al., 2010 siRNA GCAAAUCUCCGAUCGUAGA Sequence- based reagent siCAPN7 Wenzel et al., 2022 siRNA GCACCCAUACCUUUACAUU Sequence- based reagent siNUP153 Mackay et al., 2010 siRNA GGACUUGUUAGAUCUAGUU Chemical compound, drug Doxycycline Hyclate Sigma 324385 1–2 μg/mL Chemical compound, drug Thymidine CalBiochem CAS 50- 89- 5 2 mM Chemical compound, drug Oregon Green 488 maleimide Life Technologies/Molecular Probes O6034 Fluorescent label for peptides Software, algorithm Fiji NIH RRID:SCR_002285 Software, algorithm Prism 9 GraphPad Continued .. All plasmids created for this study were made by Gibson Assembly (Gibson et al., 2009) using vectors linearized by restriction enzymes (New England Biolabs). pCA528 bacterial expression plasmids expressing His6- SUMO- tagged fusion proteins with a native N- terminus after tag cleavage were linearized with BsaI and BamHI. pCAG- OSF mammalian expression plasmids that encoded proteins for co- IP binding assays were linearized with KpnI and XhoI. pLVX vectors used for generating inducible cell lines were linearized by BamHI and MluI.

Sequencing:

Software:

other:

Article Title: Synaptic cell adhesion molecule Cdh6 identifies a class of sensory neurons with novel functions in colonic motility
Article Snippet: resource Designation Source or reference Identifiers Additional information Antibody Donkey anti- sheep AF- 488 (polyclonal) Invitrogen #A11015, RRID:AB_141362 IF(1:1000) Antibody Donkey anti- rabbit AF- 488 (polyclonal) Invitrogen #A21206, RRID:AB_2535792 IF(1:1000) Peptide, recombinant protein Streptavidin AF- 546 Invitrogen #S11225 IF(1:500) Sequence- based reagent RNAscope probe Mm- Cdh6 Advanced Cell Diagnostics Cat #519541 Sequence- based reagent RNAscope probe Mm- Cdh8 Advanced Cell Diagnostics Cat #485461 Sequence- based reagent RNAscope probe Mm- Nmu Advanced Cell Diagnostics Cat #446831 Sequence- based reagent RNAscope probe Mm- Calcb Advanced Cell Diagnostics Cat #425511 Sequence- based reagent RNAscope probe Mm- eGFP Advanced Cell Diagnostics Cat #400281 Commercial assay or kit RNAscope Multiplex Fluorescent V2 Assay kit with RNA- Protein Co- detection Ancillary Kit Advanced Cell Diagnostics Cat #323100 Chemical compound, drug Protease XIV Sigma #P5417 Chemical compound, drug Collagenase Worthington #CLS- 4 Chemical compound, drug Dispase Sigma #D4693 Chemical compound, drug ZD7288 Sigma- Aldrich #73777 Chemical compound, drug Cesium chloride Sigma- Aldrich #C4036 Chemical compound, drug Tetrodotoxin citrate Alomone Labs #T- 550 Software, algorithm Imaris Filament Tracer Bitplane, Oxford Instruments Software, algorithm LabChart 7, 8 AD Instruments Software, algorithm Prism 9 GraphPad Continued

Article Title: Convergence of clinically relevant manipulations on dopamine-regulated prefrontal activity underlying stress-coping responses
Article Snippet: Resource Type Specific Reagent or Resource Source or Reference Identifiers Additional Information Organism/Strain Mouse: C57BL/6J, males/females The Jackson Laboratory JAX:000664 Organism/Strain Mouse: B6-CamKII::TtA, males/females The Jackson Laboratory JAX: 00310 Organism/Strain Mouse: tetO-Disc1dn, males/females The Jackson Laboratory JAX: 008790 Organism/Strain Mouse: DRD2 loxP/loxP The Jackson Laboratory JAX: 020631 Organism/Strain Mouse:TH::Cre +/−, males/females www.gensat.org line FI12 Organism/Strain Mouse: D2::Cre +/−, males www.gensat.org Line ER44 Organism/Strain Mouse: Crl:CD1(ICR), males Charles River strain: 022 Retired Breeders Bacterial or Viral Strain AAV5-CaMKII-GCaMP6f Upenn Virus Core Bacterial or Viral Strain AAV5-Ef1-DIO-ChR2-eYFP Upenn Virus Core Bacterial or Viral Strain AAV5-Ef1-DIO-eYFP Upenn Virus Core Bacterial or Viral Strain AAV5-Syn-Cre-mCherry Upenn Virus Core Bacterial or Viral Strain AAV5-Syn-mCherry Upenn Virus Core Chemical Compound or Drug (-)Quinpirole Sigma-Aldrich Chemical Compound or Drug (±)-SKF 38393 Sigma-Aldrich Chemical Compound or Drug (±)-Sulpiride Sigma-Aldrich Software; Algorithm ImageJ National Institutes of Health https://imagej.nih.gov/ij/index.html Software; Algorithm ImageJ Plugin: cvMatch_Template Tseng et al, Lab Chip, 2011 https://sites.google.com/site/qingzongtseng/template-matching-ij-plugin Software; Algorithm MATLAB_R2019B Mathworks R2019B https://www.mathworks.com/products Software; Algorithm Prism 9 software GraphPad Software v9.0.0 https://www.graphpad.com/scientific-software/prism Open in a separate window KEY RESOURCES TABLE

Article Title: Adhesion-based capture stabilizes nascent microvilli at epithelial cell junctions.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines LLC-PK1-CL4 Gift from Dr. Carolyn Slayman (Yale University) N/A CACO-2BBE ATCC Cat# CRL-2102 Experimental models: Organisms/strains CDHR2-EGFP mouse Vanderbilt Genome Editing Resource N/A Oligonucleotides CDHR2-Fwd: ATGGCCCAGCTATGGCTG This paper N/A CDHR2-Rev: CAGGTCCGTGGTGTCCAGG This paper N/A gRNA Exon 4(1) Sense: CACCGTAATGTCATCCGGAATACTG This paper N/A gRNA Exon 4(1) Antisense: AAACCAGTATTCCGGATGACATTAC This paper N/A gRNA Exon 4(2) Sense: CACCGGCCAACCTTCTGGACTACG This paper N/A gRNA Exon 4(2) Antisense: AAACCGTAGTCCAGAAGGTTGGCC This paper N/A CDHR2 KO Seq Fwd (cells): GTTTTCATGTCTTGGCCCTTCTAAC This paper N/A CDHR2 KO Seq Rev (cells): CTGTGTGACCAAAAATGGACAAGTG This paper N/A Cdhr2 Fwd1 (mouse): AACCCACCTGTACCACCCTTG This paper N/A Cdhr2 eGFP Fwd (mouse): CCGACAACCACTACCTGAGCAC This paper N/A Cdhr2 Rev1 (mouse): GTATTGGGAACAGGATGGAGGTC This paper N/A Recombinant DNA pmCherry-Espin (ESPN) Gift from Dr. James Bartles, NWU N/A pLVX-mCherry-Espin (ESPN) Gaeta et al.20 N/A pEGFP-N3-CDHR2 (PCDH24-EGFP) Crawley et al.11 N/A pmCherry-N3-CDHR2 Tyska Laboratory N/A pEGFP-N3-CDHR5 Tyska Laboratory N/A pmCherry-N3-CDHR5 Tyska Laboratory N/A pHALO-N3-CDHR2 This paper N/A pLentiCRISPRv2 Addgene Cat# 52961 Software and algorithms FIJI https://fiji.sc N/A NIS AR Elements Analysis Nikon N/A Prism 9 GraphPad N/A Benchling CRISPR Guide design tool Benchling N/A Inference of CRISPR Edits (ICE) Synthego N/A BioRender Biorender N/A Other MycoAlert PLUS Mycoplasma Detection Kit Lonza Cat# LT07-710 MycoStrip - Mycoplasma Detection Kit InvivoGen Cat# rep-mys-50 pCR 8/GW/TOPO TA Cloning Kit Invitrogen Cat# K250020 Gateway Vector Conversion System Invitrogen Cat# 11828029 35 mm #1.5 glass bottom dishes CellVis Cat# D35-20-1.5-N e2 Developmental Cell 58, 2048–2062.e1–e7, October 23, 2023

Review