Review



smartseq2 v4 kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    TaKaRa smartseq2 v4 kit
    Highlights:
    Smartseq2 V4 Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 3231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/pmc07255058-12-0-4
    Average 98 stars, based on 3231 article reviews
    smartseq2 v4 kit - by Bioz Stars, 2026-09
    98/100 stars

    Images

    1) Product Images from "Reprogramming axial level identity to rescue neural crest-related congenital heart defects"

    Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

    Journal: Developmental cell

    doi: 10.1016/j.devcel.2020.04.005

    Highlights:
    Figure Legend Snippet: Highlights:

    Techniques Used: Isolation, Hybridization, Software

    Related Articles

    Sequencing:

    Article Title: Leptospiral dissemination is restrained by liver macrophages through Clec4d-driven capture via C/EBPβ activation.
    Article Snippet: Total RNA was then extracted from these purified Kupffer cells using TRIzol reagent (TaKaRa, Japan). .. Sequencing libraries were constructed from low-input RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, Japan). ..

    Article Title: Transcriptome profiling of bovine preantral follicles during early folliculogenesis
    Article Snippet: Total RNA from each replicate was extracted using the miRNeasy Tissue/Cells Advanced Micro Kit (Qiagen Srl, Milan, Italy) and eluted in RNase-free water following the manufacturer’s instructions. .. RNA samples were processed at the Centre of Genomic Regulation, Barcelona, Spain, for library preparation and sequencing. cDNA was generated using SMART-Seq v4 Ultra Low Input RNA kit (Clontech Laboratories, Mountain View, CA, USA). .. The libraries were prepared using NEBNext ® Ultra DNA Library Prep for the Illumina ® kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's protocol, starting with the cDNA obtained.

    Article Title: Shifting IRES versus Cap-initiated translation during homeostatic stem cell differentiation and stress
    Article Snippet: Libraries were prepared using the MANTIS Liquid Handler (Formulatrix) and the Biomek FXP Single Arm System with Span-8 Pipettor (Beckman Coulter, A31843). .. Full-length cDNA was prepared using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio USA Inc.), and sequencing libraries were prepared using the Nextera XT DNA Library Preparation Kit (Illumina). .. Reads were mapped to reference genome mm10 with ENSEMBL annotation using STAR version 2.5.4a ( , ).

    Article Title: Modular genetic architecture underlies human hand and foot evolution.
    Article Snippet: .. For cDNA library preparation and sequencing, samples were normalized to a single concentration and libraries were prepared using the Takara SMART-Seq v4 Ultra Low Input RNA Kit following the manufacturer’s protocols. ..

    Article Title: Immune receptor LAG3 regulates microglia function during Alzheimer's disease.
    Article Snippet: Jo ur na l P re -p ro of For T-cell infiltration, isolated cells were resuspended in FACS buffer and stained for 10 min at 4°C with the following antibodies: anti-CD45-PE (clone 30-F11), anti-CD4-FITC (clone GK1.5), and anti-CD8α-APC (clone 53-6.7), all from BioLegend. .. Flow cytometric analysis was performed using a BD LSRFortessa instrument (BD Biosciences) and data were analyzed with FlowJo software. cDNA library preparation and RNA sequencing Total RNA from CD11b+ CD45low purified hippocampal microglia was extracted using RNeasy Plus Mini Kit (Qiagen) and stored at -80°C. cDNA was generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara). .. The cDNA libraries were prepared using the Nextera XT DNA Library Prep Kit and Nextera XT index Kit (Illumina) and sequenced by the NIEHS Epigenomics and DNA Sequencing Core Facility using a NextSeq 500 NGS system (Illumina).

    Article Title: A high dimensionality approach reveals immunopathogenic responses driving severe pediatric acute respiratory distress syndrome.
    Article Snippet: .. Total RNA was isolated using the PicoPure RNA-Isolation kit (Arcuturus, Ambion) and cDNA was generated with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech, USA), according to manufacturers’ protocols. .. Illumina-ready cDNA libraries were generated from amplified cDNA using the Nextera XT DNA Library Prep Kit (Illumina, USA) and multiplexed for 2×150 bp-sequencing.

    Article Title: Single-type neuron transcriptomics uncovers cell-type-specific regulators of host defense in Caenorhabditis elegans
    Article Snippet: The cells were then sorted through our Beckman-Coulter CytoFlex SRT cell sorter with a 100-micron diameter nozzle to enrich GFP-labeled ASH neurons ( ). .. Non-fluorescent cells from wild-type N2 animals were used as a reference to exclude autofluorescent cells. cDNA was synthesized directly from neuronal cells by using SMART-Seq Ultra Low Input RNA Kit v4 (Takara Bio). cDNA library was constructed using Nextera XT DNA Library Preparation Kit (Illumina), followed by sequencing on an Illumina NovaSeq 6000 sequencer. ..

    Construct:

    Article Title: Leptospiral dissemination is restrained by liver macrophages through Clec4d-driven capture via C/EBPβ activation.
    Article Snippet: Total RNA was then extracted from these purified Kupffer cells using TRIzol reagent (TaKaRa, Japan). .. Sequencing libraries were constructed from low-input RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, Japan). ..

    Article Title: Single-type neuron transcriptomics uncovers cell-type-specific regulators of host defense in Caenorhabditis elegans
    Article Snippet: The cells were then sorted through our Beckman-Coulter CytoFlex SRT cell sorter with a 100-micron diameter nozzle to enrich GFP-labeled ASH neurons ( ). .. Non-fluorescent cells from wild-type N2 animals were used as a reference to exclude autofluorescent cells. cDNA was synthesized directly from neuronal cells by using SMART-Seq Ultra Low Input RNA Kit v4 (Takara Bio). cDNA library was constructed using Nextera XT DNA Library Preparation Kit (Illumina), followed by sequencing on an Illumina NovaSeq 6000 sequencer. ..

    Generated:

    Article Title: Transcriptome profiling of bovine preantral follicles during early folliculogenesis
    Article Snippet: Total RNA from each replicate was extracted using the miRNeasy Tissue/Cells Advanced Micro Kit (Qiagen Srl, Milan, Italy) and eluted in RNase-free water following the manufacturer’s instructions. .. RNA samples were processed at the Centre of Genomic Regulation, Barcelona, Spain, for library preparation and sequencing. cDNA was generated using SMART-Seq v4 Ultra Low Input RNA kit (Clontech Laboratories, Mountain View, CA, USA). .. The libraries were prepared using NEBNext ® Ultra DNA Library Prep for the Illumina ® kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer's protocol, starting with the cDNA obtained.

    Article Title: Immune receptor LAG3 regulates microglia function during Alzheimer's disease.
    Article Snippet: Jo ur na l P re -p ro of For T-cell infiltration, isolated cells were resuspended in FACS buffer and stained for 10 min at 4°C with the following antibodies: anti-CD45-PE (clone 30-F11), anti-CD4-FITC (clone GK1.5), and anti-CD8α-APC (clone 53-6.7), all from BioLegend. .. Flow cytometric analysis was performed using a BD LSRFortessa instrument (BD Biosciences) and data were analyzed with FlowJo software. cDNA library preparation and RNA sequencing Total RNA from CD11b+ CD45low purified hippocampal microglia was extracted using RNeasy Plus Mini Kit (Qiagen) and stored at -80°C. cDNA was generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara). .. The cDNA libraries were prepared using the Nextera XT DNA Library Prep Kit and Nextera XT index Kit (Illumina) and sequenced by the NIEHS Epigenomics and DNA Sequencing Core Facility using a NextSeq 500 NGS system (Illumina).

    Article Title: A high dimensionality approach reveals immunopathogenic responses driving severe pediatric acute respiratory distress syndrome.
    Article Snippet: .. Total RNA was isolated using the PicoPure RNA-Isolation kit (Arcuturus, Ambion) and cDNA was generated with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech, USA), according to manufacturers’ protocols. .. Illumina-ready cDNA libraries were generated from amplified cDNA using the Nextera XT DNA Library Prep Kit (Illumina, USA) and multiplexed for 2×150 bp-sequencing.

    DNA Library Preparation:

    Article Title: Shifting IRES versus Cap-initiated translation during homeostatic stem cell differentiation and stress
    Article Snippet: Libraries were prepared using the MANTIS Liquid Handler (Formulatrix) and the Biomek FXP Single Arm System with Span-8 Pipettor (Beckman Coulter, A31843). .. Full-length cDNA was prepared using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio USA Inc.), and sequencing libraries were prepared using the Nextera XT DNA Library Preparation Kit (Illumina). .. Reads were mapped to reference genome mm10 with ENSEMBL annotation using STAR version 2.5.4a ( , ).

    Article Title: Single-type neuron transcriptomics uncovers cell-type-specific regulators of host defense in Caenorhabditis elegans
    Article Snippet: The cells were then sorted through our Beckman-Coulter CytoFlex SRT cell sorter with a 100-micron diameter nozzle to enrich GFP-labeled ASH neurons ( ). .. Non-fluorescent cells from wild-type N2 animals were used as a reference to exclude autofluorescent cells. cDNA was synthesized directly from neuronal cells by using SMART-Seq Ultra Low Input RNA Kit v4 (Takara Bio). cDNA library was constructed using Nextera XT DNA Library Preparation Kit (Illumina), followed by sequencing on an Illumina NovaSeq 6000 sequencer. ..

    cDNA Library Assay:

    Article Title: Modular genetic architecture underlies human hand and foot evolution.
    Article Snippet: .. For cDNA library preparation and sequencing, samples were normalized to a single concentration and libraries were prepared using the Takara SMART-Seq v4 Ultra Low Input RNA Kit following the manufacturer’s protocols. ..

    Article Title: Immune receptor LAG3 regulates microglia function during Alzheimer's disease.
    Article Snippet: Jo ur na l P re -p ro of For T-cell infiltration, isolated cells were resuspended in FACS buffer and stained for 10 min at 4°C with the following antibodies: anti-CD45-PE (clone 30-F11), anti-CD4-FITC (clone GK1.5), and anti-CD8α-APC (clone 53-6.7), all from BioLegend. .. Flow cytometric analysis was performed using a BD LSRFortessa instrument (BD Biosciences) and data were analyzed with FlowJo software. cDNA library preparation and RNA sequencing Total RNA from CD11b+ CD45low purified hippocampal microglia was extracted using RNeasy Plus Mini Kit (Qiagen) and stored at -80°C. cDNA was generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara). .. The cDNA libraries were prepared using the Nextera XT DNA Library Prep Kit and Nextera XT index Kit (Illumina) and sequenced by the NIEHS Epigenomics and DNA Sequencing Core Facility using a NextSeq 500 NGS system (Illumina).

    Article Title: Single-type neuron transcriptomics uncovers cell-type-specific regulators of host defense in Caenorhabditis elegans
    Article Snippet: The cells were then sorted through our Beckman-Coulter CytoFlex SRT cell sorter with a 100-micron diameter nozzle to enrich GFP-labeled ASH neurons ( ). .. Non-fluorescent cells from wild-type N2 animals were used as a reference to exclude autofluorescent cells. cDNA was synthesized directly from neuronal cells by using SMART-Seq Ultra Low Input RNA Kit v4 (Takara Bio). cDNA library was constructed using Nextera XT DNA Library Preparation Kit (Illumina), followed by sequencing on an Illumina NovaSeq 6000 sequencer. ..

    Concentration Assay:

    Article Title: Modular genetic architecture underlies human hand and foot evolution.
    Article Snippet: .. For cDNA library preparation and sequencing, samples were normalized to a single concentration and libraries were prepared using the Takara SMART-Seq v4 Ultra Low Input RNA Kit following the manufacturer’s protocols. ..

    Software:

    Article Title: Immune receptor LAG3 regulates microglia function during Alzheimer's disease.
    Article Snippet: Jo ur na l P re -p ro of For T-cell infiltration, isolated cells were resuspended in FACS buffer and stained for 10 min at 4°C with the following antibodies: anti-CD45-PE (clone 30-F11), anti-CD4-FITC (clone GK1.5), and anti-CD8α-APC (clone 53-6.7), all from BioLegend. .. Flow cytometric analysis was performed using a BD LSRFortessa instrument (BD Biosciences) and data were analyzed with FlowJo software. cDNA library preparation and RNA sequencing Total RNA from CD11b+ CD45low purified hippocampal microglia was extracted using RNeasy Plus Mini Kit (Qiagen) and stored at -80°C. cDNA was generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara). .. The cDNA libraries were prepared using the Nextera XT DNA Library Prep Kit and Nextera XT index Kit (Illumina) and sequenced by the NIEHS Epigenomics and DNA Sequencing Core Facility using a NextSeq 500 NGS system (Illumina).

    RNA Sequencing:

    Article Title: Immune receptor LAG3 regulates microglia function during Alzheimer's disease.
    Article Snippet: Jo ur na l P re -p ro of For T-cell infiltration, isolated cells were resuspended in FACS buffer and stained for 10 min at 4°C with the following antibodies: anti-CD45-PE (clone 30-F11), anti-CD4-FITC (clone GK1.5), and anti-CD8α-APC (clone 53-6.7), all from BioLegend. .. Flow cytometric analysis was performed using a BD LSRFortessa instrument (BD Biosciences) and data were analyzed with FlowJo software. cDNA library preparation and RNA sequencing Total RNA from CD11b+ CD45low purified hippocampal microglia was extracted using RNeasy Plus Mini Kit (Qiagen) and stored at -80°C. cDNA was generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara). .. The cDNA libraries were prepared using the Nextera XT DNA Library Prep Kit and Nextera XT index Kit (Illumina) and sequenced by the NIEHS Epigenomics and DNA Sequencing Core Facility using a NextSeq 500 NGS system (Illumina).

    Purification:

    Article Title: Immune receptor LAG3 regulates microglia function during Alzheimer's disease.
    Article Snippet: Jo ur na l P re -p ro of For T-cell infiltration, isolated cells were resuspended in FACS buffer and stained for 10 min at 4°C with the following antibodies: anti-CD45-PE (clone 30-F11), anti-CD4-FITC (clone GK1.5), and anti-CD8α-APC (clone 53-6.7), all from BioLegend. .. Flow cytometric analysis was performed using a BD LSRFortessa instrument (BD Biosciences) and data were analyzed with FlowJo software. cDNA library preparation and RNA sequencing Total RNA from CD11b+ CD45low purified hippocampal microglia was extracted using RNeasy Plus Mini Kit (Qiagen) and stored at -80°C. cDNA was generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara). .. The cDNA libraries were prepared using the Nextera XT DNA Library Prep Kit and Nextera XT index Kit (Illumina) and sequenced by the NIEHS Epigenomics and DNA Sequencing Core Facility using a NextSeq 500 NGS system (Illumina).

    Isolation:

    Article Title: A high dimensionality approach reveals immunopathogenic responses driving severe pediatric acute respiratory distress syndrome.
    Article Snippet: .. Total RNA was isolated using the PicoPure RNA-Isolation kit (Arcuturus, Ambion) and cDNA was generated with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech, USA), according to manufacturers’ protocols. .. Illumina-ready cDNA libraries were generated from amplified cDNA using the Nextera XT DNA Library Prep Kit (Illumina, USA) and multiplexed for 2×150 bp-sequencing.

    Synthesized:

    Article Title: Single-type neuron transcriptomics uncovers cell-type-specific regulators of host defense in Caenorhabditis elegans
    Article Snippet: The cells were then sorted through our Beckman-Coulter CytoFlex SRT cell sorter with a 100-micron diameter nozzle to enrich GFP-labeled ASH neurons ( ). .. Non-fluorescent cells from wild-type N2 animals were used as a reference to exclude autofluorescent cells. cDNA was synthesized directly from neuronal cells by using SMART-Seq Ultra Low Input RNA Kit v4 (Takara Bio). cDNA library was constructed using Nextera XT DNA Library Preparation Kit (Illumina), followed by sequencing on an Illumina NovaSeq 6000 sequencer. ..



    Similar Products

    98
    TaKaRa smartseq2 v4 kit takara clontech
    Highlights:
    Smartseq2 V4 Kit Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/pmc07255058-845-99-102
    Average 98 stars, based on 1 article reviews
    smartseq2 v4 kit takara clontech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    TaKaRa smartseq2 v4 kit
    Highlights:
    Smartseq2 V4 Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/pmc07255058-12-0-4
    Average 98 stars, based on 1 article reviews
    smartseq2 v4 kit - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    TaKaRa 212 smartseq2 v4 kit takara clontech
    Highlights:
    212 Smartseq2 V4 Kit Takara Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+Ultra+Low+Input+RNA+Kit+for+Sequencing/gandhi_shashank__2021__molecular_mechanisms_underlying_cardiac_neural_crest_development_in_avian_embryos-3759-0-4
    Average 98 stars, based on 1 article reviews
    212 smartseq2 v4 kit takara clontech - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    98
    TaKaRa smartseq2 kit
    Highlights:
    Smartseq2 Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartseq2+v4+kit/SMART-Seq+v4+PLUS+Kit/pm32242021-386-12-14
    Average 98 stars, based on 1 article reviews
    smartseq2 kit - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    Image Search Results


    Highlights:

    Journal: Developmental cell

    Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

    doi: 10.1016/j.devcel.2020.04.005

    Figure Lengend Snippet: Highlights:

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse IgG1 anti-Pax7 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_528428 Rabbit anti-Sox2 Abcam Cat#ab97959; RRID: AB_2341193 Mouse IgG2b anti-MF20 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2147781 Mouse IgM anti-HNK1 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2314644 Mouse IgG2a anti-SMA Sigma Cat#3879S; RRID: AB_2255011 Mouse IgG2b anti-HuC/D Invitrogen Cat# A21271; RRID: AB_221448 Goat IgG anti-GFP Rockland Cat# 600-101-215; RRID: AB_218182 Mouse IgG2a anti-V5 Invitrogen Cat#R960–25; RRID: AB_2556564 Rabbit anti-RFP MBL Cat#PM005; RRID: AB_591279 Critical Commercial Assays RNAqueous Micro Total RNA isolation kit Ambion Cat#AM1931 SmartSeq2 V4 kit Takara Clontech Cat#634889 Nextera XT DNA library preparation kit Illumina Cat#FC-131–1024 Qubit High sensitivity DNA kit ThermoFisher Scientific Cat# {"type":"entrez-protein","attrs":{"text":"Q32854","term_id":"75280861","term_text":"Q32854"}} Q32854 NEB Next High-Fidelity 2X PCR Master Mix New England Biolabs Cat#M0543S NextSeq 500/550 High Output Kit v2 (75 cycles) Illumina Cat#FC-404–2005 Endofree maxi prep kit Macharey Nagel Cat#740426.50 Agencourt AMPure XP beads Beckman Coulter Cat#A63880 illustra MicroSpin G-50 Columns GE Healthcare Life Sciences Cat# 27533001 Hybridization Chain Reaction Molecular Technologies NA Deposited Data Raw and analyzed data This paper BioProject ID PRJNA515142 Software and Algorithms Fiji/ImageJ ( Schindelin et al., 2012 ) https://imagej.nih.gov/ij/ Bowtie2 ( Langmead and Salzberg, 2012 ) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml Samtools http://samtools.sourceforge.net/ HTSeq-count https://htseq.readthedocs.io/en/release_0.11.1/count.html Seurat ( Butler et al., 2018 ) https://satijalab.org/seurat/ Oligonucleotides GCAGGTGTAGTTGCAATATC This paper Tgif1.1.gRNA GTTGGTCCCCCGCCGTGAGA This paper Tgif1.2.gRNA GGGTCATGTTGAGCATTTGG This paper Sox8.1.gRNA gTCCACCTTAGCGCCCAGCG This paper Sox8.2.gRNA GACGCGACGCCCATCCTCAA This paper Sox8.3.gRNA GGCCTCAACCATGAAGGCGG This paper Ets1.1.gRNA GACCTTCAGTGGCTTCGCAA This paper Ets1.2.gRNA GAGAGACGCACGTGCGGGAC This paper Ets1.3.gRNA GAAAGTCAGGCGCTAGCTCC This paper Ets1.4.gRNA Open in a separate window Highlights: Ablations reveal laterality differences in neural crest contributions to the heart Transcriptional profiling reveals Tgif1 as critical for outflow tract morphogenesis Sox8, Tgif1 , and Ets1 comprise a regulatory subcircuit for cardiac crest specification Expression of subcircuit genes in trunk reprograms them toward cardiac crest-like fate

    Techniques: Isolation, Hybridization, Software

    Highlights:

    Journal: Developmental cell

    Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

    doi: 10.1016/j.devcel.2020.04.005

    Figure Lengend Snippet: Highlights:

    Article Snippet: SmartSeq2 V4 kit , Takara Clontech , Cat#634889.

    Techniques: Isolation, Hybridization, Software