single cell transcriptome sequencing analysis (10X Genomics)
86
Structured Review
10X Genomics
single cell transcriptome sequencing analysis
Single Cell Transcriptome Sequencing Analysis, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+cell+transcriptome+sequencing+analysis/high+in+platform+plex+situ/pm39923572-122-14-12
Average 86 stars, based on 1 article reviews
Single Cell Transcriptome Sequencing Analysis, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+cell+transcriptome+sequencing+analysis/high+in+platform+plex+situ/pm39923572-122-14-12
Average 86 stars, based on 1 article reviews
single cell transcriptome sequencing analysis - by Bioz Stars,
2026-11
86/100 stars
Images
Related Articles
Amplification:Article Title: Intrinsic coordination of dynamic molecular signatures shape the human prefrontal cortex Article Snippet: .. Briefly, one-sixth of the amplified cDNA from each GEX capture was used as input per 100 μL PCR reaction for amplification of the CROP-seq scaffold, using KAPA HiFi HotStart ReadyMix for 25 cycles with the following primers: TruSeqR2-CROP_F3_1: 5′- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGGAGAACCACCTTGTTG-3′ prtlTruSeqR1_1: 5′-ACACTCTTTCCCTACACGACG-3′ For samples captured using the Polymerase Chain Reaction:Article Title: Intrinsic coordination of dynamic molecular signatures shape the human prefrontal cortex Article Snippet: .. Briefly, one-sixth of the amplified cDNA from each GEX capture was used as input per 100 μL PCR reaction for amplification of the CROP-seq scaffold, using KAPA HiFi HotStart ReadyMix for 25 cycles with the following primers: TruSeqR2-CROP_F3_1: 5′- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGGAGAACCACCTTGTTG-3′ prtlTruSeqR1_1: 5′-ACACTCTTTCCCTACACGACG-3′ For samples captured using the Single Cell:Article Title: ZNF683 + NK cells govern chemotherapy sensitivity in advanced HPSCC via reshaping immune microenvironment Article Snippet: .. The 10x Genomics Article Title: ADGRG6 Promotes Pancreatic Adenocarcinoma Progression Through the NF-κB/STAT6 Axis and Modulation of the Tumor Immune Microenvironment Article Snippet: .. Both datasets utilized a Article Title: Live imaging and multimodal profiling reveal transdifferentiation of a cochlear supporting cell subpopulation upon Notch inhibition. Article Snippet: .. Single- cell multiomics, library prep and data analysis Twenty- four hours after compound E or DMSO treatment, cultured organs were collected and dissociated for single- Article Title: A triple-node heart-brain neuroimmune loop underlying myocardial infarction. Article Snippet: Article Gene Expression:Article Title: ZNF683 + NK cells govern chemotherapy sensitivity in advanced HPSCC via reshaping immune microenvironment Article Snippet: .. The 10x Genomics Expressing:Article Title: ADGRG6 Promotes Pancreatic Adenocarcinoma Progression Through the NF-κB/STAT6 Axis and Modulation of the Tumor Immune Microenvironment Article Snippet: .. Both datasets utilized a Cell Culture:Article Title: Live imaging and multimodal profiling reveal transdifferentiation of a cochlear supporting cell subpopulation upon Notch inhibition. Article Snippet: .. Single- cell multiomics, library prep and data analysis Twenty- four hours after compound E or DMSO treatment, cultured organs were collected and dissociated for single- other:Article Title: Multiscale domain identification for spatial transcriptomics via persistent homology Article Snippet: |