Review



lentivirus expressing shrna constructs  (Merck & Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Merck & Co lentivirus expressing shrna constructs
    A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting <t>siRNA</t> (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.
    Lentivirus Expressing Shrna Constructs, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pmc12325171-221-19-30?v=Merck+%26+Co
    Average 86 stars, based on 1 article reviews
    lentivirus expressing shrna constructs - by Bioz Stars, 2026-08
    86/100 stars

    Images

    1) Product Images from "The LRP4/YAP axis drives the radiation-tolerant persister (RTP) cell state in breast cancer"

    Article Title: The LRP4/YAP axis drives the radiation-tolerant persister (RTP) cell state in breast cancer

    Journal: Theranostics

    doi: 10.7150/thno.101393

    A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting siRNA (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.
    Figure Legend Snippet: A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting siRNA (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.

    Techniques Used: Functional Assay, High Content Screening, Staining, Labeling, Biomarker Discovery, Positive Control, Negative Control

    LRP4/YAP axis inhibition radiosensitizes iCSC. A-B . Proportion of cells ( A , SUM159; B , S68) presenting a nuclear location of YAP in each cell subpopulations five days post-irradiation, with representative images of YAP staining (in green) in each cell subpopulations on the right panel. Nuclei are counterstained with DAPi (in blue). C . Pre-ranked GSEA interrogating differential expression between iCSC and late non-CSC and YAP/TAZ target genes. D . Western blot of markers related to YAP/TAZ signaling and its activation in SUM159 and S68 cells silenced for LRP4 (shLRP4) compared to the non-targeting shRNA (shCTRL). The mean intensities are indicated below each band for each condition. E . Heat map representing the mRNA expression of the LRP4, ALDH1A1, and YAP/TAZ target genes in SUM159 and S68 silenced for LRP4 (siLRP4) compared to the non-targeting siRNA (siCTRL). Each row represents three independent replicates per conditions (R1, R2, and R3). F . Proportion of SUM159 cells presenting a nuclear location of YAP in late non-CSC and iCSC following LRP4 silencing (siLRP4) compared to a non-targeting siRNA (siCTRL). G-H . SUM159 ( G ) and S68 cells ( H ), following LRP4 silencing (shLRP4) compared to a non-targeting siRNA (shCTRL), were exposed to various dose of radiation therapy and subjected to clonogenic survival assays ( G ), with representative images (right panels). I . Patient-derived xenograft organoid (PDXO) size distribution for CRCM389 cells WT (shCTRL) or silenced for LRP4 (shLRP4) following irradiation (RT) and compared to untreated condition (CTRL) (left panel). Representative pictures of PDXO-CRCM389 7 days post-treatment (right panel). Statistical test used is Student's t-test. Data represent mean ± SD. ns (not significant), *p<0.05, **p<0.01, ***p<0.001. J . Kaplan-Meier tumor-free survival curves of mice xenografted with 100,000-200,000 SUM159 irradiated cells silenced for LRP4 (shLRP4) compared to the control (shCTRL). p-value and hazard ration (HR) estimated according to Log-rank (Mantel-Cox) test.
    Figure Legend Snippet: LRP4/YAP axis inhibition radiosensitizes iCSC. A-B . Proportion of cells ( A , SUM159; B , S68) presenting a nuclear location of YAP in each cell subpopulations five days post-irradiation, with representative images of YAP staining (in green) in each cell subpopulations on the right panel. Nuclei are counterstained with DAPi (in blue). C . Pre-ranked GSEA interrogating differential expression between iCSC and late non-CSC and YAP/TAZ target genes. D . Western blot of markers related to YAP/TAZ signaling and its activation in SUM159 and S68 cells silenced for LRP4 (shLRP4) compared to the non-targeting shRNA (shCTRL). The mean intensities are indicated below each band for each condition. E . Heat map representing the mRNA expression of the LRP4, ALDH1A1, and YAP/TAZ target genes in SUM159 and S68 silenced for LRP4 (siLRP4) compared to the non-targeting siRNA (siCTRL). Each row represents three independent replicates per conditions (R1, R2, and R3). F . Proportion of SUM159 cells presenting a nuclear location of YAP in late non-CSC and iCSC following LRP4 silencing (siLRP4) compared to a non-targeting siRNA (siCTRL). G-H . SUM159 ( G ) and S68 cells ( H ), following LRP4 silencing (shLRP4) compared to a non-targeting siRNA (shCTRL), were exposed to various dose of radiation therapy and subjected to clonogenic survival assays ( G ), with representative images (right panels). I . Patient-derived xenograft organoid (PDXO) size distribution for CRCM389 cells WT (shCTRL) or silenced for LRP4 (shLRP4) following irradiation (RT) and compared to untreated condition (CTRL) (left panel). Representative pictures of PDXO-CRCM389 7 days post-treatment (right panel). Statistical test used is Student's t-test. Data represent mean ± SD. ns (not significant), *p<0.05, **p<0.01, ***p<0.001. J . Kaplan-Meier tumor-free survival curves of mice xenografted with 100,000-200,000 SUM159 irradiated cells silenced for LRP4 (shLRP4) compared to the control (shCTRL). p-value and hazard ration (HR) estimated according to Log-rank (Mantel-Cox) test.

    Techniques Used: Inhibition, Irradiation, Staining, Quantitative Proteomics, Western Blot, Activation Assay, shRNA, Expressing, Derivative Assay, Control



    Similar Products

    lentiviral constructs plko rfp shctrl  (Addgene inc)
    93
    Addgene inc lentiviral constructs plko rfp shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/bio_rxiv__2025__07__16__665171-165-0-3?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-08
    93/100 stars
    		  Buy from Supplier
    shctrl constructs  (OriGene)
    96
    OriGene shctrl constructs
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pm38873940-270-3-8?v=OriGene
    Average 96 stars, based on 1 article reviews
    shctrl constructs - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    thenontargeting (shctrl) shrna construct (shc002)  (Millipore)
    90
    Millipore thenontargeting (shctrl) shrna construct (shc002)
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Thenontargeting (Shctrl) Shrna Construct (Shc002), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/10__1158_slash_0008___5472__can___21___1114-60-0-6?v=Millipore
    Average 90 stars, based on 1 article reviews
    thenontargeting (shctrl) shrna construct (shc002) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    shrna construct shctrl  (Thermo Fisher)
    90
    Thermo Fisher shrna construct shctrl
    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
    Shrna Construct Shctrl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pmc08235627-77-1-26?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    shrna construct shctrl - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    shctrl shrna construct (shc002)  (Millipore)
    90
    Millipore shctrl shrna construct (shc002)
    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
    Shctrl Shrna Construct (Shc002), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/us10308698-333-1-9?v=Millipore
    Average 90 stars, based on 1 article reviews
    shctrl shrna construct (shc002) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    tripz-shctrl construct  (Thermo Fisher)
    90
    Thermo Fisher tripz-shctrl construct
    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
    Tripz Shctrl Construct, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pm30415143-59-3-5?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    tripz-shctrl construct - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Journal: bioRxiv

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

    doi: 10.1101/2025.07.16.665171

    Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

    Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection

    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

    Journal: Cancers

    Article Title: Dual Role of Integrin Alpha-6 in Glioblastoma: Supporting Stemness in Proneural Stem-Like Cells While Inducing Radioresistance in Mesenchymal Stem-Like Cells

    doi: 10.3390/cancers13123055

    Figure Lengend Snippet: Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

    Article Snippet: Non-targeting shRNA construct (shCTRL; source clone ID: RHS4348) and shITGA6 plasmid mapping against ITGA6 exon 15 (target sequence: AGGATATTGCTTTAGAAAT; source clone ID: V3LHS_326014) were purchased from Thermo-Scientific.

    Techniques: Western Blot, shRNA, MANN-WHITNEY, Marker