Review



negative control shrna  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    OriGene negative control shrna
    Figure 1. Downregulation of Nup358 expression in cortical neurons. Cortical neurons transfected at 5 DIV, with <t>shRNA</t> constructs co-expressing GFP to downregulate Nup358 (shNup358). As a control, neurons were transfected with a non-targeted shRNA <t>construct</t> <t>(shCTRL).</t> Immunostaining was conducted for Nup358 (red), and the nuclei are labeled with DAPI (blue). Asterisks are used to mark the transfected neuronal cells (green) with a substantial decrease in the Nup358 signal compared to the control untransfected cells. Scale bar: 10 µm.
    Negative Control Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 199 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pm37763196-35-1-5?v=OriGene
    Average 96 stars, based on 199 article reviews
    negative control shrna - by Bioz Stars, 2026-07
    96/100 stars

    Images

    1) Product Images from "Nucleoporin Nup358 Downregulation Tunes the Neuronal Excitability in Mouse Cortical Neurons."

    Article Title: Nucleoporin Nup358 Downregulation Tunes the Neuronal Excitability in Mouse Cortical Neurons.

    Journal: Life (Basel, Switzerland)

    doi: 10.3390/life13091791

    Figure 1. Downregulation of Nup358 expression in cortical neurons. Cortical neurons transfected at 5 DIV, with shRNA constructs co-expressing GFP to downregulate Nup358 (shNup358). As a control, neurons were transfected with a non-targeted shRNA construct (shCTRL). Immunostaining was conducted for Nup358 (red), and the nuclei are labeled with DAPI (blue). Asterisks are used to mark the transfected neuronal cells (green) with a substantial decrease in the Nup358 signal compared to the control untransfected cells. Scale bar: 10 µm.
    Figure Legend Snippet: Figure 1. Downregulation of Nup358 expression in cortical neurons. Cortical neurons transfected at 5 DIV, with shRNA constructs co-expressing GFP to downregulate Nup358 (shNup358). As a control, neurons were transfected with a non-targeted shRNA construct (shCTRL). Immunostaining was conducted for Nup358 (red), and the nuclei are labeled with DAPI (blue). Asterisks are used to mark the transfected neuronal cells (green) with a substantial decrease in the Nup358 signal compared to the control untransfected cells. Scale bar: 10 µm.

    Techniques Used: Expressing, Transfection, shRNA, Construct, Control, Immunostaining, Labeling



    Similar Products

    lentiviral constructs plko rfp shctrl  (Addgene inc)
    93
    Addgene inc lentiviral constructs plko rfp shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/bio_rxiv__2025__07__16__665171-165-0-3?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    shctrl constructs  (OriGene)
    96
    OriGene shctrl constructs
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pm38873940-270-3-8?v=OriGene
    Average 96 stars, based on 1 article reviews
    shctrl constructs - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    thenontargeting (shctrl) shrna construct (shc002)  (Millipore)
    90
    Millipore thenontargeting (shctrl) shrna construct (shc002)
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Thenontargeting (Shctrl) Shrna Construct (Shc002), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/10__1158_slash_0008___5472__can___21___1114-60-0-6?v=Millipore
    Average 90 stars, based on 1 article reviews
    thenontargeting (shctrl) shrna construct (shc002) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    shrna construct shctrl  (Thermo Fisher)
    90
    Thermo Fisher shrna construct shctrl
    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
    Shrna Construct Shctrl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pmc08235627-77-1-26?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    shrna construct shctrl - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    shctrl shrna construct (shc002)  (Millipore)
    90
    Millipore shctrl shrna construct (shc002)
    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
    Shctrl Shrna Construct (Shc002), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/us10308698-333-1-9?v=Millipore
    Average 90 stars, based on 1 article reviews
    shctrl shrna construct (shc002) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    tripz-shctrl construct  (Thermo Fisher)
    90
    Thermo Fisher tripz-shctrl construct
    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based <t>shRNA</t> silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of <t>normalized</t> <t>shCTRL</t> samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.
    Tripz Shctrl Construct, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/shctrl+constructs/pm30415143-59-3-5?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    tripz-shctrl construct - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Journal: bioRxiv

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

    doi: 10.1101/2025.07.16.665171

    Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

    Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection

    Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

    Journal: Cancers

    Article Title: Dual Role of Integrin Alpha-6 in Glioblastoma: Supporting Stemness in Proneural Stem-Like Cells While Inducing Radioresistance in Mesenchymal Stem-Like Cells

    doi: 10.3390/cancers13123055

    Figure Lengend Snippet: Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

    Article Snippet: Non-targeting shRNA construct (shCTRL; source clone ID: RHS4348) and shITGA6 plasmid mapping against ITGA6 exon 15 (target sequence: AGGATATTGCTTTAGAAAT; source clone ID: V3LHS_326014) were purchased from Thermo-Scientific.

    Techniques: Western Blot, shRNA, MANN-WHITNEY, Marker