Review



human setd2 catalytic domain  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc human setd2 catalytic domain
    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Human Setd2 Catalytic Domain, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/SETD2+(Plasmid+%2325348)/pmc12969715-226-9-13
    Average 91 stars, based on 8 article reviews
    human setd2 catalytic domain - by Bioz Stars, 2026-09
    91/100 stars

    Images

    1) Product Images from "The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation"

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    Journal: The Journal of Biological Chemistry

    doi: 10.1016/j.jbc.2026.111259

    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of SETD2 catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Figure Legend Snippet: The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of SETD2 catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.

    Techniques Used: Mutagenesis, Activity Assay, In Vitro, Binding Assay, Sequencing, Residue, Methylation, Recombinant, Purification, Staining, Autoradiography, Control, Thermal Shift Assay, Fluorescence, Liquid Chromatography

    The L1609P mutation results in low levels of the H3K36me3 mark and in low expression of SETD2 in CRISPR/Cas9-engineered HEK293T cells and in transfected HEK293T-SETD2 KO cells . A , endogenous H3K36me3 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : the H3K36me3 mark was detected by immunofluorescence using an anti-H3K36me3 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with 10 μm scale bars. Right panel : Histones from CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant were extracted and H3K36me3 levels were determined by Western blotting using a an anti-H3K36me3 antibody. Ponceau Red staining of extracted histones is shown. B , endogenous SETD2 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : Cells were fixed and SETD2 was detected using an anti-SETD2 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with scale bars of 10 μm. Right panel : SETD2 was detected in cell extracts by Western blot using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. C , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 L1609P were transfected with GFP-SETD2 WT or GFP-SETD2 L1609P plasmids. Nontransfected CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were used as controls. Ectopic GFP-SETD2 expression and H3K36me3 mark levels were detected by Western blot using anti-GFP or anti-H3K36me3 antibodies, respectively. Ponceau Red staining of cellular histones or extracts on membranes are shown. D , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were treated with MG132 or DMSO. Endogenous SETD2 WT and SETD2 L1609P expression levels were detected by Western blotting using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. SETD2, SET-domain containing protein 2.
    Figure Legend Snippet: The L1609P mutation results in low levels of the H3K36me3 mark and in low expression of SETD2 in CRISPR/Cas9-engineered HEK293T cells and in transfected HEK293T-SETD2 KO cells . A , endogenous H3K36me3 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : the H3K36me3 mark was detected by immunofluorescence using an anti-H3K36me3 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with 10 μm scale bars. Right panel : Histones from CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant were extracted and H3K36me3 levels were determined by Western blotting using a an anti-H3K36me3 antibody. Ponceau Red staining of extracted histones is shown. B , endogenous SETD2 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : Cells were fixed and SETD2 was detected using an anti-SETD2 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with scale bars of 10 μm. Right panel : SETD2 was detected in cell extracts by Western blot using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. C , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 L1609P were transfected with GFP-SETD2 WT or GFP-SETD2 L1609P plasmids. Nontransfected CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were used as controls. Ectopic GFP-SETD2 expression and H3K36me3 mark levels were detected by Western blot using anti-GFP or anti-H3K36me3 antibodies, respectively. Ponceau Red staining of cellular histones or extracts on membranes are shown. D , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were treated with MG132 or DMSO. Endogenous SETD2 WT and SETD2 L1609P expression levels were detected by Western blotting using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. SETD2, SET-domain containing protein 2.

    Techniques Used: Mutagenesis, Expressing, CRISPR, Transfection, Immunofluorescence, Staining, Western Blot

    Overall structure of the ternary complex of SETD2 L1609P mutant bound to H3K36M peptide and SAM cofactor . A , left panel : cartoon representation of SETD2 WT (PDB: 5JJY ) ( cyan ) bound to H3K36M peptide ( orange ) and the SAH cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 L1609 and H3M36 residues are represented by yellow and orange sticks , respectively. The close-up view shows the region around residue L1609 with the H3K36M peptide (residues 29–42, orange ) and the SAH cofactor ( black sticks ). Zinc atoms are shown in gray . Right panel : cartoon representation of the SETD2 L1609P mutant (PDB: 8RZU ) ( salmon ) bound to the H3K36M peptide ( green ) and the SAM cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 P1609 and H3M36 residues are shown as yellow and green sticks , respectively. The close-up view shows the region around the residue P1609 with the H3K36M peptide (residues 29–39, green ) and the SAM cofactor ( black sticks ). B , left panel : cartoon representation of the characteristic triangular shape of the SET domain formed by 3 β-sheets (β1-β2; β3-β8-β7; β4-β6-β5 strands) of SETD2 WT in complex with the H3K36M peptide (residues 29–42 in orange) (PDB: 5JJY ). The β-sheet composed of β4-β6-β5 strands is boxed and the SETD2 L1609 residue is shown in yellow . Right panel : cartoon representation of the triangular β-sheet structure of the SET domain of the SETD2 L1609P mutant ( salmon ) in complex with the H3K36M peptide (residues 29–39, green ) (PDB: 8RZU ). The β5-strand in SETD2 WT adopts a loop conformation in the structure of the SETD2 L1609P mutant ( boxed ). The P1609 residue in mutant SETD2 is shown in yellow . SETD2, SET-domain containing protein 2.
    Figure Legend Snippet: Overall structure of the ternary complex of SETD2 L1609P mutant bound to H3K36M peptide and SAM cofactor . A , left panel : cartoon representation of SETD2 WT (PDB: 5JJY ) ( cyan ) bound to H3K36M peptide ( orange ) and the SAH cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 L1609 and H3M36 residues are represented by yellow and orange sticks , respectively. The close-up view shows the region around residue L1609 with the H3K36M peptide (residues 29–42, orange ) and the SAH cofactor ( black sticks ). Zinc atoms are shown in gray . Right panel : cartoon representation of the SETD2 L1609P mutant (PDB: 8RZU ) ( salmon ) bound to the H3K36M peptide ( green ) and the SAM cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 P1609 and H3M36 residues are shown as yellow and green sticks , respectively. The close-up view shows the region around the residue P1609 with the H3K36M peptide (residues 29–39, green ) and the SAM cofactor ( black sticks ). B , left panel : cartoon representation of the characteristic triangular shape of the SET domain formed by 3 β-sheets (β1-β2; β3-β8-β7; β4-β6-β5 strands) of SETD2 WT in complex with the H3K36M peptide (residues 29–42 in orange) (PDB: 5JJY ). The β-sheet composed of β4-β6-β5 strands is boxed and the SETD2 L1609 residue is shown in yellow . Right panel : cartoon representation of the triangular β-sheet structure of the SET domain of the SETD2 L1609P mutant ( salmon ) in complex with the H3K36M peptide (residues 29–39, green ) (PDB: 8RZU ). The β5-strand in SETD2 WT adopts a loop conformation in the structure of the SETD2 L1609P mutant ( boxed ). The P1609 residue in mutant SETD2 is shown in yellow . SETD2, SET-domain containing protein 2.

    Techniques Used: Mutagenesis, Residue

    Effects of the SETD2 L1609P mutation on the conformations of neighboring residues of SETD2 and the H3K36M peptide. A , the left panel shows a cartoon overlay of the β5-β6 hairpin of SETD2 WT (PDB: 5JJY ) ( cyan ) and SETD2 L1609P mutant ( salmon ) structures. The H3K36M peptide is shown in orange and green for SETD2 WT and SETD2 L1609P, respectively. The side chains of residues L1609 and P1609 residues are shown as sticks ( yellow CPK). The middle panel shows a close-up view of the hairpin residues (1609–1613) of SETD2 WT ( cyan ) and SETD2 L1609P ( salmon ). The side chains are shown in CPK sticks . The right panel shows the β5-β6 hairpin residues of SETD2 WT ( top ) and SETD2 L1609P ( bottom ) in sticks . Dashes represent the distance between Cα of residues K1610 and E1613 residues. B , conformational remodeling of residues K1610 and K1639 of SETD2 and residue K37 of H3 induced by the L1609P mutation. Left panel shows residues SETD2 L1609 ( yellow ), K1610 (cyan), K1639 ( cyan ), and H3K37 ( orange ) in spheres and sticks in the SETD2 WT structure (PDB: 5JJY ). Middle panel shows residues SETD2 P1609 ( yellow ), K1610 ( salmon ), K1639 ( salmon ), and H3K37 ( green ) in spheres and sticks in the SETD2 L1609P structure. The right panel shows residues P1609 ( yellow ) and K1610 ( salmon ) from the SETD2 L1609P structure and residues K1639 ( cyan ) and H3K37 ( orange ) from the SETD2 WT structure. Steric clashes between side chains are shown in boxes . The orientations are the same in all three panels and were obtained by superimposing the SETD2 WT and L1609P main chains. C , surface representation of the SETD2 substrate-binding region. H3K36M peptides are shown as sticks. The left panel shows the SETD2 WT structure (PDB: 5JJY ) in light cyan . The SETD2 L1609 residue is shown in yellow . The SETD2 K1610 and K1639 residues are shown in blue . H3K36M peptide residues diffracting in both WT and L1609P structures (residues A29–H39) are shown in green . H3K36M peptide residues observed only in the SETD2 WT structure (residues R40-R42) are shown in transparent orange . The right panel shows the SETD2 L1609P structure in light pink . The SETD2 P1609 residue is shown in yellow . The K1610 and K1639 residues are shown in purple . H3K36M peptide residues observed in the SETD2 L1609P structure (A29–H39) are shown in green . SETD2, SET-domain containing protein 2.
    Figure Legend Snippet: Effects of the SETD2 L1609P mutation on the conformations of neighboring residues of SETD2 and the H3K36M peptide. A , the left panel shows a cartoon overlay of the β5-β6 hairpin of SETD2 WT (PDB: 5JJY ) ( cyan ) and SETD2 L1609P mutant ( salmon ) structures. The H3K36M peptide is shown in orange and green for SETD2 WT and SETD2 L1609P, respectively. The side chains of residues L1609 and P1609 residues are shown as sticks ( yellow CPK). The middle panel shows a close-up view of the hairpin residues (1609–1613) of SETD2 WT ( cyan ) and SETD2 L1609P ( salmon ). The side chains are shown in CPK sticks . The right panel shows the β5-β6 hairpin residues of SETD2 WT ( top ) and SETD2 L1609P ( bottom ) in sticks . Dashes represent the distance between Cα of residues K1610 and E1613 residues. B , conformational remodeling of residues K1610 and K1639 of SETD2 and residue K37 of H3 induced by the L1609P mutation. Left panel shows residues SETD2 L1609 ( yellow ), K1610 (cyan), K1639 ( cyan ), and H3K37 ( orange ) in spheres and sticks in the SETD2 WT structure (PDB: 5JJY ). Middle panel shows residues SETD2 P1609 ( yellow ), K1610 ( salmon ), K1639 ( salmon ), and H3K37 ( green ) in spheres and sticks in the SETD2 L1609P structure. The right panel shows residues P1609 ( yellow ) and K1610 ( salmon ) from the SETD2 L1609P structure and residues K1639 ( cyan ) and H3K37 ( orange ) from the SETD2 WT structure. Steric clashes between side chains are shown in boxes . The orientations are the same in all three panels and were obtained by superimposing the SETD2 WT and L1609P main chains. C , surface representation of the SETD2 substrate-binding region. H3K36M peptides are shown as sticks. The left panel shows the SETD2 WT structure (PDB: 5JJY ) in light cyan . The SETD2 L1609 residue is shown in yellow . The SETD2 K1610 and K1639 residues are shown in blue . H3K36M peptide residues diffracting in both WT and L1609P structures (residues A29–H39) are shown in green . H3K36M peptide residues observed only in the SETD2 WT structure (residues R40-R42) are shown in transparent orange . The right panel shows the SETD2 L1609P structure in light pink . The SETD2 P1609 residue is shown in yellow . The K1610 and K1639 residues are shown in purple . H3K36M peptide residues observed in the SETD2 L1609P structure (A29–H39) are shown in green . SETD2, SET-domain containing protein 2.

    Techniques Used: Mutagenesis, Residue, Binding Assay

    Details of H3K36M peptide recognition by SETD2 L1609P mutant . A , the left panel shows a clipped surface representation of the SETD2 WT-H3K36M peptide complex (PDB: 5JJY ). Peptide residues (residues A29–R42) are represented by sticks . The right panel shows a clipped surface representation of the SETD2 L1609P-H3K36M peptide complex. Peptide residues (A29–H39) are represented by sticks . The structures of the SETD2-H3K36M peptide complexes are shown in the same orientation after superimposition of the main chains. B , upper panel : Structural alignment of H3K36M peptides (residues A29–H39) in SETD2 WT (PDB: 5JJY ) ( orange ) and SETD2 L1609P ( green ) structures. Lower panel : Differences between SETD2-H3K36M peptide interactions in SETD2 WT and SETD2 L1609P complexes. Residue interactions across the binding interface of SETD2 WT or SETD2 L1609P mutant with H3K36M peptide were determined using LIGPLOT . Residues are represented by sticks . Residues involved in SETD2-H3K36M peptide interactions (nonbonded and hydrogen bonds) are represented by sticks and spheres . Dashes represent hydrogen bond. The lower left panel shows the SETD2 WT ( cyan )-H3M36 ( orange ) interacting residues that are specific for the SETD2 WT complex and not present in the SETD2 L1609P complex. These interactions are listed in a table ( bottom left ). The lower right panel shows SETD2 L1609P ( salmon )-H3K36M ( green ) peptide interacting residues that are specific for the SETD2 L1609P complex and not present in the SETD2 WT complex. These interactions are listed in a table ( bottom right ). SETD2, SET-domain containing protein 2.
    Figure Legend Snippet: Details of H3K36M peptide recognition by SETD2 L1609P mutant . A , the left panel shows a clipped surface representation of the SETD2 WT-H3K36M peptide complex (PDB: 5JJY ). Peptide residues (residues A29–R42) are represented by sticks . The right panel shows a clipped surface representation of the SETD2 L1609P-H3K36M peptide complex. Peptide residues (A29–H39) are represented by sticks . The structures of the SETD2-H3K36M peptide complexes are shown in the same orientation after superimposition of the main chains. B , upper panel : Structural alignment of H3K36M peptides (residues A29–H39) in SETD2 WT (PDB: 5JJY ) ( orange ) and SETD2 L1609P ( green ) structures. Lower panel : Differences between SETD2-H3K36M peptide interactions in SETD2 WT and SETD2 L1609P complexes. Residue interactions across the binding interface of SETD2 WT or SETD2 L1609P mutant with H3K36M peptide were determined using LIGPLOT . Residues are represented by sticks . Residues involved in SETD2-H3K36M peptide interactions (nonbonded and hydrogen bonds) are represented by sticks and spheres . Dashes represent hydrogen bond. The lower left panel shows the SETD2 WT ( cyan )-H3M36 ( orange ) interacting residues that are specific for the SETD2 WT complex and not present in the SETD2 L1609P complex. These interactions are listed in a table ( bottom left ). The lower right panel shows SETD2 L1609P ( salmon )-H3K36M ( green ) peptide interacting residues that are specific for the SETD2 L1609P complex and not present in the SETD2 WT complex. These interactions are listed in a table ( bottom right ). SETD2, SET-domain containing protein 2.

    Techniques Used: Mutagenesis, Residue, Binding Assay

    Related Articles

    Plasmid Preparation:

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation
    Article Snippet: .. A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433–1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HI-control (DE3) E . coli . .. SETD2 L1609P mutation was introduced using the QuickChange XL site-directed mutagenesis kit (Agilent) with the following primers: His_SETD2_L1609P_F: CACTATTACTTTATGGCTCCGAAAAATGATGAAATTATCGACGCG.

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: .. For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol.

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation.
    Article Snippet: .. SETD2 cDNA constructs and site-directed mutagenesis A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433-1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HIcontrolTM (DE3) E.Coli. .. SETD2 L1609P mutation was introduced using the QuickChange XL sitedirected mutagenesis kit (Agilent) with the following primers: His_SETD2_L1609P_F : CACTATTACTTTATGGCTCCGAAAAATGATGAAATTATCGACGCG His_SETD2_L1609P_R : CGCGTCGATAATTTCATCATTTTTCGGAGCCATAAAGTAATAGTG SETD2 catalytic domain (residues 1433-1711) was subcloned onto a pEGFP-SETD2 vector, (kindly given by Dr. Sergio de Almeida) between BglII and PstI sites using the following primers: GFP_catalytic_SETD2_F : CGAGATCTCAGGGAGAGACATCAGTGC GFP_catalytic_SETD2_R: GCCTGCAGTCACTTACGAGATCGTTCCTTCTTCATTTTC SETD2 L1609P mutation was introduced using the Agilent QuickChange XL site-directed mutagenesis kit with the following primers: GFP_SETD2_L1609P_F : CATCCATTACTATTTCATGGCCCCGAAGAATGATGAGATAATAG GFP_SETD2_L1609P_R : CTATTATCTCATCATTCTTCGGGGCCATGAAATAGTAATGGATG Successful cloning and mutagenesis were verified by sequencing.

    Over Expression:

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: .. For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol.

    Polymerase Chain Reaction:

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: .. For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol.

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol. ..

    Amplification:

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: .. For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol.

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol. ..

    FLAG-tag:

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: .. For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol.

    Clone Assay:

    Article Title: SETD2 Mutations Do Not Contribute to Clonal Fitness in Response to Chemotherapy in Childhood B Cell Acute Lymphoblastic Leukemia
    Article Snippet: For overexpression studies, the SETD2 ORF (not full length) was PCR amplified from the SETD2-GFP plasmid, which was a gift from Sérgio De Almeida (Addgene plasmid #80653; http://n2t.net/addgene:80653 ) to include a FLAG-tag at the N-terminus[ 20 ]. .. Following amplification, the SETD2 PCR product was cloned into pInducer20-Blast (Addgene, #109334) using Invitrogen’s Gateway ® technology protocol. ..

    Construct:

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation.
    Article Snippet: .. SETD2 cDNA constructs and site-directed mutagenesis A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433-1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HIcontrolTM (DE3) E.Coli. .. SETD2 L1609P mutation was introduced using the QuickChange XL sitedirected mutagenesis kit (Agilent) with the following primers: His_SETD2_L1609P_F : CACTATTACTTTATGGCTCCGAAAAATGATGAAATTATCGACGCG His_SETD2_L1609P_R : CGCGTCGATAATTTCATCATTTTTCGGAGCCATAAAGTAATAGTG SETD2 catalytic domain (residues 1433-1711) was subcloned onto a pEGFP-SETD2 vector, (kindly given by Dr. Sergio de Almeida) between BglII and PstI sites using the following primers: GFP_catalytic_SETD2_F : CGAGATCTCAGGGAGAGACATCAGTGC GFP_catalytic_SETD2_R: GCCTGCAGTCACTTACGAGATCGTTCCTTCTTCATTTTC SETD2 L1609P mutation was introduced using the Agilent QuickChange XL site-directed mutagenesis kit with the following primers: GFP_SETD2_L1609P_F : CATCCATTACTATTTCATGGCCCCGAAGAATGATGAGATAATAG GFP_SETD2_L1609P_R : CTATTATCTCATCATTCTTCGGGGCCATGAAATAGTAATGGATG Successful cloning and mutagenesis were verified by sequencing.

    Mutagenesis:

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation.
    Article Snippet: .. SETD2 cDNA constructs and site-directed mutagenesis A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433-1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HIcontrolTM (DE3) E.Coli. .. SETD2 L1609P mutation was introduced using the QuickChange XL sitedirected mutagenesis kit (Agilent) with the following primers: His_SETD2_L1609P_F : CACTATTACTTTATGGCTCCGAAAAATGATGAAATTATCGACGCG His_SETD2_L1609P_R : CGCGTCGATAATTTCATCATTTTTCGGAGCCATAAAGTAATAGTG SETD2 catalytic domain (residues 1433-1711) was subcloned onto a pEGFP-SETD2 vector, (kindly given by Dr. Sergio de Almeida) between BglII and PstI sites using the following primers: GFP_catalytic_SETD2_F : CGAGATCTCAGGGAGAGACATCAGTGC GFP_catalytic_SETD2_R: GCCTGCAGTCACTTACGAGATCGTTCCTTCTTCATTTTC SETD2 L1609P mutation was introduced using the Agilent QuickChange XL site-directed mutagenesis kit with the following primers: GFP_SETD2_L1609P_F : CATCCATTACTATTTCATGGCCCCGAAGAATGATGAGATAATAG GFP_SETD2_L1609P_R : CTATTATCTCATCATTCTTCGGGGCCATGAAATAGTAATGGATG Successful cloning and mutagenesis were verified by sequencing.



    Similar Products

    94
    EpiCypher recombinant setd2
    The <t>L1609P</t> mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Recombinant Setd2, supplied by EpiCypher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/SETD2%2C+Recombinant+Human/pmc12969715-275-3-32
    Average 94 stars, based on 1 article reviews
    recombinant setd2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Cell Signaling Technology Inc anti setd2
    The <t>L1609P</t> mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Anti Setd2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/pmc13062286-59-14-9
    Average 86 stars, based on 1 article reviews
    anti setd2 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    94
    Cell Signaling Technology Inc western blot setd2
    The <t>L1609P</t> mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Western Blot Setd2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/SETD2+Rabbit+mAb/pm41872549-223-3-7
    Average 94 stars, based on 1 article reviews
    western blot setd2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    91
    Addgene inc human setd2 catalytic domain
    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Human Setd2 Catalytic Domain, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/SETD2+(Plasmid+%2325348)/pmc12969715-226-9-13
    Average 91 stars, based on 1 article reviews
    human setd2 catalytic domain - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    91
    Addgene inc cdna coding
    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Cdna Coding, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/SETD2+(Plasmid+%2325348)/pmc12969715-226-5-13
    Average 91 stars, based on 1 article reviews
    cdna coding - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    86
    Absolute Biotech Inc anti setd2
    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Anti Setd2, supplied by Absolute Biotech Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/anti+setd2/pm41748592-214-10-11
    Average 86 stars, based on 1 article reviews
    anti setd2 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    91
    Addgene inc setd2 cdna constructs
    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of <t>SETD2</t> catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.
    Setd2 Cdna Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/setd2/SETD2+(Plasmid+%2325348)/pm41654133-133-0-19
    Average 91 stars, based on 1 article reviews
    setd2 cdna constructs - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of SETD2 catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of SETD2 catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.

    Article Snippet: Five micromolars of recombinant SETD2 (WT, L1609P, or T1663M) were incubated ON at room temperature with 1 μg of recombinant human histone H3.3 (NEB) or 1 μg of recombinant human nucleosomes (16–0009, EpiCypher) or 2 μg core histones purified from HEK293T SETD2 KO cells , 100 μM SAM, and 1 mM DTT.

    Techniques: Mutagenesis, Activity Assay, In Vitro, Binding Assay, Sequencing, Residue, Methylation, Recombinant, Purification, Staining, Autoradiography, Control, Thermal Shift Assay, Fluorescence, Liquid Chromatography

    The L1609P mutation results in low levels of the H3K36me3 mark and in low expression of SETD2 in CRISPR/Cas9-engineered HEK293T cells and in transfected HEK293T-SETD2 KO cells . A , endogenous H3K36me3 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : the H3K36me3 mark was detected by immunofluorescence using an anti-H3K36me3 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with 10 μm scale bars. Right panel : Histones from CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant were extracted and H3K36me3 levels were determined by Western blotting using a an anti-H3K36me3 antibody. Ponceau Red staining of extracted histones is shown. B , endogenous SETD2 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : Cells were fixed and SETD2 was detected using an anti-SETD2 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with scale bars of 10 μm. Right panel : SETD2 was detected in cell extracts by Western blot using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. C , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 L1609P were transfected with GFP-SETD2 WT or GFP-SETD2 L1609P plasmids. Nontransfected CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were used as controls. Ectopic GFP-SETD2 expression and H3K36me3 mark levels were detected by Western blot using anti-GFP or anti-H3K36me3 antibodies, respectively. Ponceau Red staining of cellular histones or extracts on membranes are shown. D , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were treated with MG132 or DMSO. Endogenous SETD2 WT and SETD2 L1609P expression levels were detected by Western blotting using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: The L1609P mutation results in low levels of the H3K36me3 mark and in low expression of SETD2 in CRISPR/Cas9-engineered HEK293T cells and in transfected HEK293T-SETD2 KO cells . A , endogenous H3K36me3 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : the H3K36me3 mark was detected by immunofluorescence using an anti-H3K36me3 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with 10 μm scale bars. Right panel : Histones from CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant were extracted and H3K36me3 levels were determined by Western blotting using a an anti-H3K36me3 antibody. Ponceau Red staining of extracted histones is shown. B , endogenous SETD2 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : Cells were fixed and SETD2 was detected using an anti-SETD2 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with scale bars of 10 μm. Right panel : SETD2 was detected in cell extracts by Western blot using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. C , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 L1609P were transfected with GFP-SETD2 WT or GFP-SETD2 L1609P plasmids. Nontransfected CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were used as controls. Ectopic GFP-SETD2 expression and H3K36me3 mark levels were detected by Western blot using anti-GFP or anti-H3K36me3 antibodies, respectively. Ponceau Red staining of cellular histones or extracts on membranes are shown. D , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were treated with MG132 or DMSO. Endogenous SETD2 WT and SETD2 L1609P expression levels were detected by Western blotting using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. SETD2, SET-domain containing protein 2.

    Article Snippet: Five micromolars of recombinant SETD2 (WT, L1609P, or T1663M) were incubated ON at room temperature with 1 μg of recombinant human histone H3.3 (NEB) or 1 μg of recombinant human nucleosomes (16–0009, EpiCypher) or 2 μg core histones purified from HEK293T SETD2 KO cells , 100 μM SAM, and 1 mM DTT.

    Techniques: Mutagenesis, Expressing, CRISPR, Transfection, Immunofluorescence, Staining, Western Blot

    Overall structure of the ternary complex of SETD2 L1609P mutant bound to H3K36M peptide and SAM cofactor . A , left panel : cartoon representation of SETD2 WT (PDB: 5JJY ) ( cyan ) bound to H3K36M peptide ( orange ) and the SAH cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 L1609 and H3M36 residues are represented by yellow and orange sticks , respectively. The close-up view shows the region around residue L1609 with the H3K36M peptide (residues 29–42, orange ) and the SAH cofactor ( black sticks ). Zinc atoms are shown in gray . Right panel : cartoon representation of the SETD2 L1609P mutant (PDB: 8RZU ) ( salmon ) bound to the H3K36M peptide ( green ) and the SAM cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 P1609 and H3M36 residues are shown as yellow and green sticks , respectively. The close-up view shows the region around the residue P1609 with the H3K36M peptide (residues 29–39, green ) and the SAM cofactor ( black sticks ). B , left panel : cartoon representation of the characteristic triangular shape of the SET domain formed by 3 β-sheets (β1-β2; β3-β8-β7; β4-β6-β5 strands) of SETD2 WT in complex with the H3K36M peptide (residues 29–42 in orange) (PDB: 5JJY ). The β-sheet composed of β4-β6-β5 strands is boxed and the SETD2 L1609 residue is shown in yellow . Right panel : cartoon representation of the triangular β-sheet structure of the SET domain of the SETD2 L1609P mutant ( salmon ) in complex with the H3K36M peptide (residues 29–39, green ) (PDB: 8RZU ). The β5-strand in SETD2 WT adopts a loop conformation in the structure of the SETD2 L1609P mutant ( boxed ). The P1609 residue in mutant SETD2 is shown in yellow . SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: Overall structure of the ternary complex of SETD2 L1609P mutant bound to H3K36M peptide and SAM cofactor . A , left panel : cartoon representation of SETD2 WT (PDB: 5JJY ) ( cyan ) bound to H3K36M peptide ( orange ) and the SAH cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 L1609 and H3M36 residues are represented by yellow and orange sticks , respectively. The close-up view shows the region around residue L1609 with the H3K36M peptide (residues 29–42, orange ) and the SAH cofactor ( black sticks ). Zinc atoms are shown in gray . Right panel : cartoon representation of the SETD2 L1609P mutant (PDB: 8RZU ) ( salmon ) bound to the H3K36M peptide ( green ) and the SAM cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 P1609 and H3M36 residues are shown as yellow and green sticks , respectively. The close-up view shows the region around the residue P1609 with the H3K36M peptide (residues 29–39, green ) and the SAM cofactor ( black sticks ). B , left panel : cartoon representation of the characteristic triangular shape of the SET domain formed by 3 β-sheets (β1-β2; β3-β8-β7; β4-β6-β5 strands) of SETD2 WT in complex with the H3K36M peptide (residues 29–42 in orange) (PDB: 5JJY ). The β-sheet composed of β4-β6-β5 strands is boxed and the SETD2 L1609 residue is shown in yellow . Right panel : cartoon representation of the triangular β-sheet structure of the SET domain of the SETD2 L1609P mutant ( salmon ) in complex with the H3K36M peptide (residues 29–39, green ) (PDB: 8RZU ). The β5-strand in SETD2 WT adopts a loop conformation in the structure of the SETD2 L1609P mutant ( boxed ). The P1609 residue in mutant SETD2 is shown in yellow . SETD2, SET-domain containing protein 2.

    Article Snippet: Five micromolars of recombinant SETD2 (WT, L1609P, or T1663M) were incubated ON at room temperature with 1 μg of recombinant human histone H3.3 (NEB) or 1 μg of recombinant human nucleosomes (16–0009, EpiCypher) or 2 μg core histones purified from HEK293T SETD2 KO cells , 100 μM SAM, and 1 mM DTT.

    Techniques: Mutagenesis, Residue

    Effects of the SETD2 L1609P mutation on the conformations of neighboring residues of SETD2 and the H3K36M peptide. A , the left panel shows a cartoon overlay of the β5-β6 hairpin of SETD2 WT (PDB: 5JJY ) ( cyan ) and SETD2 L1609P mutant ( salmon ) structures. The H3K36M peptide is shown in orange and green for SETD2 WT and SETD2 L1609P, respectively. The side chains of residues L1609 and P1609 residues are shown as sticks ( yellow CPK). The middle panel shows a close-up view of the hairpin residues (1609–1613) of SETD2 WT ( cyan ) and SETD2 L1609P ( salmon ). The side chains are shown in CPK sticks . The right panel shows the β5-β6 hairpin residues of SETD2 WT ( top ) and SETD2 L1609P ( bottom ) in sticks . Dashes represent the distance between Cα of residues K1610 and E1613 residues. B , conformational remodeling of residues K1610 and K1639 of SETD2 and residue K37 of H3 induced by the L1609P mutation. Left panel shows residues SETD2 L1609 ( yellow ), K1610 (cyan), K1639 ( cyan ), and H3K37 ( orange ) in spheres and sticks in the SETD2 WT structure (PDB: 5JJY ). Middle panel shows residues SETD2 P1609 ( yellow ), K1610 ( salmon ), K1639 ( salmon ), and H3K37 ( green ) in spheres and sticks in the SETD2 L1609P structure. The right panel shows residues P1609 ( yellow ) and K1610 ( salmon ) from the SETD2 L1609P structure and residues K1639 ( cyan ) and H3K37 ( orange ) from the SETD2 WT structure. Steric clashes between side chains are shown in boxes . The orientations are the same in all three panels and were obtained by superimposing the SETD2 WT and L1609P main chains. C , surface representation of the SETD2 substrate-binding region. H3K36M peptides are shown as sticks. The left panel shows the SETD2 WT structure (PDB: 5JJY ) in light cyan . The SETD2 L1609 residue is shown in yellow . The SETD2 K1610 and K1639 residues are shown in blue . H3K36M peptide residues diffracting in both WT and L1609P structures (residues A29–H39) are shown in green . H3K36M peptide residues observed only in the SETD2 WT structure (residues R40-R42) are shown in transparent orange . The right panel shows the SETD2 L1609P structure in light pink . The SETD2 P1609 residue is shown in yellow . The K1610 and K1639 residues are shown in purple . H3K36M peptide residues observed in the SETD2 L1609P structure (A29–H39) are shown in green . SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: Effects of the SETD2 L1609P mutation on the conformations of neighboring residues of SETD2 and the H3K36M peptide. A , the left panel shows a cartoon overlay of the β5-β6 hairpin of SETD2 WT (PDB: 5JJY ) ( cyan ) and SETD2 L1609P mutant ( salmon ) structures. The H3K36M peptide is shown in orange and green for SETD2 WT and SETD2 L1609P, respectively. The side chains of residues L1609 and P1609 residues are shown as sticks ( yellow CPK). The middle panel shows a close-up view of the hairpin residues (1609–1613) of SETD2 WT ( cyan ) and SETD2 L1609P ( salmon ). The side chains are shown in CPK sticks . The right panel shows the β5-β6 hairpin residues of SETD2 WT ( top ) and SETD2 L1609P ( bottom ) in sticks . Dashes represent the distance between Cα of residues K1610 and E1613 residues. B , conformational remodeling of residues K1610 and K1639 of SETD2 and residue K37 of H3 induced by the L1609P mutation. Left panel shows residues SETD2 L1609 ( yellow ), K1610 (cyan), K1639 ( cyan ), and H3K37 ( orange ) in spheres and sticks in the SETD2 WT structure (PDB: 5JJY ). Middle panel shows residues SETD2 P1609 ( yellow ), K1610 ( salmon ), K1639 ( salmon ), and H3K37 ( green ) in spheres and sticks in the SETD2 L1609P structure. The right panel shows residues P1609 ( yellow ) and K1610 ( salmon ) from the SETD2 L1609P structure and residues K1639 ( cyan ) and H3K37 ( orange ) from the SETD2 WT structure. Steric clashes between side chains are shown in boxes . The orientations are the same in all three panels and were obtained by superimposing the SETD2 WT and L1609P main chains. C , surface representation of the SETD2 substrate-binding region. H3K36M peptides are shown as sticks. The left panel shows the SETD2 WT structure (PDB: 5JJY ) in light cyan . The SETD2 L1609 residue is shown in yellow . The SETD2 K1610 and K1639 residues are shown in blue . H3K36M peptide residues diffracting in both WT and L1609P structures (residues A29–H39) are shown in green . H3K36M peptide residues observed only in the SETD2 WT structure (residues R40-R42) are shown in transparent orange . The right panel shows the SETD2 L1609P structure in light pink . The SETD2 P1609 residue is shown in yellow . The K1610 and K1639 residues are shown in purple . H3K36M peptide residues observed in the SETD2 L1609P structure (A29–H39) are shown in green . SETD2, SET-domain containing protein 2.

    Article Snippet: Five micromolars of recombinant SETD2 (WT, L1609P, or T1663M) were incubated ON at room temperature with 1 μg of recombinant human histone H3.3 (NEB) or 1 μg of recombinant human nucleosomes (16–0009, EpiCypher) or 2 μg core histones purified from HEK293T SETD2 KO cells , 100 μM SAM, and 1 mM DTT.

    Techniques: Mutagenesis, Residue, Binding Assay

    Details of H3K36M peptide recognition by SETD2 L1609P mutant . A , the left panel shows a clipped surface representation of the SETD2 WT-H3K36M peptide complex (PDB: 5JJY ). Peptide residues (residues A29–R42) are represented by sticks . The right panel shows a clipped surface representation of the SETD2 L1609P-H3K36M peptide complex. Peptide residues (A29–H39) are represented by sticks . The structures of the SETD2-H3K36M peptide complexes are shown in the same orientation after superimposition of the main chains. B , upper panel : Structural alignment of H3K36M peptides (residues A29–H39) in SETD2 WT (PDB: 5JJY ) ( orange ) and SETD2 L1609P ( green ) structures. Lower panel : Differences between SETD2-H3K36M peptide interactions in SETD2 WT and SETD2 L1609P complexes. Residue interactions across the binding interface of SETD2 WT or SETD2 L1609P mutant with H3K36M peptide were determined using LIGPLOT . Residues are represented by sticks . Residues involved in SETD2-H3K36M peptide interactions (nonbonded and hydrogen bonds) are represented by sticks and spheres . Dashes represent hydrogen bond. The lower left panel shows the SETD2 WT ( cyan )-H3M36 ( orange ) interacting residues that are specific for the SETD2 WT complex and not present in the SETD2 L1609P complex. These interactions are listed in a table ( bottom left ). The lower right panel shows SETD2 L1609P ( salmon )-H3K36M ( green ) peptide interacting residues that are specific for the SETD2 L1609P complex and not present in the SETD2 WT complex. These interactions are listed in a table ( bottom right ). SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: Details of H3K36M peptide recognition by SETD2 L1609P mutant . A , the left panel shows a clipped surface representation of the SETD2 WT-H3K36M peptide complex (PDB: 5JJY ). Peptide residues (residues A29–R42) are represented by sticks . The right panel shows a clipped surface representation of the SETD2 L1609P-H3K36M peptide complex. Peptide residues (A29–H39) are represented by sticks . The structures of the SETD2-H3K36M peptide complexes are shown in the same orientation after superimposition of the main chains. B , upper panel : Structural alignment of H3K36M peptides (residues A29–H39) in SETD2 WT (PDB: 5JJY ) ( orange ) and SETD2 L1609P ( green ) structures. Lower panel : Differences between SETD2-H3K36M peptide interactions in SETD2 WT and SETD2 L1609P complexes. Residue interactions across the binding interface of SETD2 WT or SETD2 L1609P mutant with H3K36M peptide were determined using LIGPLOT . Residues are represented by sticks . Residues involved in SETD2-H3K36M peptide interactions (nonbonded and hydrogen bonds) are represented by sticks and spheres . Dashes represent hydrogen bond. The lower left panel shows the SETD2 WT ( cyan )-H3M36 ( orange ) interacting residues that are specific for the SETD2 WT complex and not present in the SETD2 L1609P complex. These interactions are listed in a table ( bottom left ). The lower right panel shows SETD2 L1609P ( salmon )-H3K36M ( green ) peptide interacting residues that are specific for the SETD2 L1609P complex and not present in the SETD2 WT complex. These interactions are listed in a table ( bottom right ). SETD2, SET-domain containing protein 2.

    Article Snippet: Five micromolars of recombinant SETD2 (WT, L1609P, or T1663M) were incubated ON at room temperature with 1 μg of recombinant human histone H3.3 (NEB) or 1 μg of recombinant human nucleosomes (16–0009, EpiCypher) or 2 μg core histones purified from HEK293T SETD2 KO cells , 100 μM SAM, and 1 mM DTT.

    Techniques: Mutagenesis, Residue, Binding Assay

    The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of SETD2 catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: The L1609P mutation decreases methyltransferase activity and intrinsic protein stability of SETD2 catalytic core in vitro . A , upper panel : schematic representation of the SETD2 domains. The SETD2 L1609P mutation is located in the SET domain within the SETD2 catalytic core (composed of the AWS, SET, and post-SET domains). Lower left panel : Structural representation of the SETD2 active site (PDB entry: 5JJY ) with a zoomed-in view of the substrate (H3K36M peptide) and cofactor (SAH) binding sites. Lower right panel : Sequence alignment of residues 1603 to 1619 of the SET domain of human SETD2 with the equivalent sequences of human G9A, EZH2, NSD1, NSD2, SETD8, MLL1, MLL2, SETD8, ASH1 (sequence retrieved from the UniProt database). Conserved residues are highlighted in blue . The secondary structure of the SETD2 residues (deduced from PDB entry: 5JJY ) is shown above the alignment. The SETD2 residue L1609 and the equivalent residues in the other SET domain-containing enzymes are highlighted in orange . B , in vitro methylation of recombinant histone H3, core histones (purified from HEK293T SETD2-KO cells) or recombinant nucleosomes. SETD2-dependent H3K36me3 methylation was detected using an anti-H3K36me3 antibody. Ponceau Red staining of histones is shown. The purified catalytic core of SETD2 WT and SETD2 L1609P mutant used in the assays were detected using an anti-6xHis-tag antibody. C , SETD2 mono-methylation, dimethylation, or trimethylation activities were determined by UFLC assays using H3K36 fluorescent peptides as previously described ( , ). Bar graphs and error bars represent the mean and SD of three independent experiments. D , automethylation of SETD2 and methylation of α-tubulin detected by autoradiography using 3 H-SAM. Coomassie Blue staining was used as loading control. E , determination of the intrinsic protein stability of SETD2 WT or SETD2 L1609P by thermal shift assay (TSA). Left panel : T m values were determined by the minimum of the first derivative of the fluorescence emission as a function of temperature (dFluo/dT). Right panel : Bar graphs and error bars represent the mean and SD of nine experiments. SETD2, SET-domain containing protein 2; UFLC, ultrafast liquid chromatography.

    Article Snippet: A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433–1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HI-control (DE3) E . coli .

    Techniques: Mutagenesis, Activity Assay, In Vitro, Binding Assay, Sequencing, Residue, Methylation, Recombinant, Purification, Staining, Autoradiography, Control, Thermal Shift Assay, Fluorescence, Liquid Chromatography

    The L1609P mutation results in low levels of the H3K36me3 mark and in low expression of SETD2 in CRISPR/Cas9-engineered HEK293T cells and in transfected HEK293T-SETD2 KO cells . A , endogenous H3K36me3 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : the H3K36me3 mark was detected by immunofluorescence using an anti-H3K36me3 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with 10 μm scale bars. Right panel : Histones from CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant were extracted and H3K36me3 levels were determined by Western blotting using a an anti-H3K36me3 antibody. Ponceau Red staining of extracted histones is shown. B , endogenous SETD2 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : Cells were fixed and SETD2 was detected using an anti-SETD2 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with scale bars of 10 μm. Right panel : SETD2 was detected in cell extracts by Western blot using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. C , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 L1609P were transfected with GFP-SETD2 WT or GFP-SETD2 L1609P plasmids. Nontransfected CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were used as controls. Ectopic GFP-SETD2 expression and H3K36me3 mark levels were detected by Western blot using anti-GFP or anti-H3K36me3 antibodies, respectively. Ponceau Red staining of cellular histones or extracts on membranes are shown. D , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were treated with MG132 or DMSO. Endogenous SETD2 WT and SETD2 L1609P expression levels were detected by Western blotting using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: The L1609P mutation results in low levels of the H3K36me3 mark and in low expression of SETD2 in CRISPR/Cas9-engineered HEK293T cells and in transfected HEK293T-SETD2 KO cells . A , endogenous H3K36me3 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : the H3K36me3 mark was detected by immunofluorescence using an anti-H3K36me3 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with 10 μm scale bars. Right panel : Histones from CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant were extracted and H3K36me3 levels were determined by Western blotting using a an anti-H3K36me3 antibody. Ponceau Red staining of extracted histones is shown. B , endogenous SETD2 levels in CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or L1609P mutant. Left panel : Cells were fixed and SETD2 was detected using an anti-SETD2 antibody. DAPI staining was used for nuclei localization. Optical sections are shown with scale bars of 10 μm. Right panel : SETD2 was detected in cell extracts by Western blot using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. C , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 L1609P were transfected with GFP-SETD2 WT or GFP-SETD2 L1609P plasmids. Nontransfected CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were used as controls. Ectopic GFP-SETD2 expression and H3K36me3 mark levels were detected by Western blot using anti-GFP or anti-H3K36me3 antibodies, respectively. Ponceau Red staining of cellular histones or extracts on membranes are shown. D , CRISPR/Cas9-engineered HEK293T cells expressing SETD2 WT or SETD2 L1609P were treated with MG132 or DMSO. Endogenous SETD2 WT and SETD2 L1609P expression levels were detected by Western blotting using an anti-SETD2 antibody. Ponceau Red staining of the cell extracts is shown. SETD2, SET-domain containing protein 2.

    Article Snippet: A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433–1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HI-control (DE3) E . coli .

    Techniques: Mutagenesis, Expressing, CRISPR, Transfection, Immunofluorescence, Staining, Western Blot

    Overall structure of the ternary complex of SETD2 L1609P mutant bound to H3K36M peptide and SAM cofactor . A , left panel : cartoon representation of SETD2 WT (PDB: 5JJY ) ( cyan ) bound to H3K36M peptide ( orange ) and the SAH cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 L1609 and H3M36 residues are represented by yellow and orange sticks , respectively. The close-up view shows the region around residue L1609 with the H3K36M peptide (residues 29–42, orange ) and the SAH cofactor ( black sticks ). Zinc atoms are shown in gray . Right panel : cartoon representation of the SETD2 L1609P mutant (PDB: 8RZU ) ( salmon ) bound to the H3K36M peptide ( green ) and the SAM cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 P1609 and H3M36 residues are shown as yellow and green sticks , respectively. The close-up view shows the region around the residue P1609 with the H3K36M peptide (residues 29–39, green ) and the SAM cofactor ( black sticks ). B , left panel : cartoon representation of the characteristic triangular shape of the SET domain formed by 3 β-sheets (β1-β2; β3-β8-β7; β4-β6-β5 strands) of SETD2 WT in complex with the H3K36M peptide (residues 29–42 in orange) (PDB: 5JJY ). The β-sheet composed of β4-β6-β5 strands is boxed and the SETD2 L1609 residue is shown in yellow . Right panel : cartoon representation of the triangular β-sheet structure of the SET domain of the SETD2 L1609P mutant ( salmon ) in complex with the H3K36M peptide (residues 29–39, green ) (PDB: 8RZU ). The β5-strand in SETD2 WT adopts a loop conformation in the structure of the SETD2 L1609P mutant ( boxed ). The P1609 residue in mutant SETD2 is shown in yellow . SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: Overall structure of the ternary complex of SETD2 L1609P mutant bound to H3K36M peptide and SAM cofactor . A , left panel : cartoon representation of SETD2 WT (PDB: 5JJY ) ( cyan ) bound to H3K36M peptide ( orange ) and the SAH cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 L1609 and H3M36 residues are represented by yellow and orange sticks , respectively. The close-up view shows the region around residue L1609 with the H3K36M peptide (residues 29–42, orange ) and the SAH cofactor ( black sticks ). Zinc atoms are shown in gray . Right panel : cartoon representation of the SETD2 L1609P mutant (PDB: 8RZU ) ( salmon ) bound to the H3K36M peptide ( green ) and the SAM cofactor ( gray sticks ). The protein surface is shown as transparent. The side chains of the SETD2 P1609 and H3M36 residues are shown as yellow and green sticks , respectively. The close-up view shows the region around the residue P1609 with the H3K36M peptide (residues 29–39, green ) and the SAM cofactor ( black sticks ). B , left panel : cartoon representation of the characteristic triangular shape of the SET domain formed by 3 β-sheets (β1-β2; β3-β8-β7; β4-β6-β5 strands) of SETD2 WT in complex with the H3K36M peptide (residues 29–42 in orange) (PDB: 5JJY ). The β-sheet composed of β4-β6-β5 strands is boxed and the SETD2 L1609 residue is shown in yellow . Right panel : cartoon representation of the triangular β-sheet structure of the SET domain of the SETD2 L1609P mutant ( salmon ) in complex with the H3K36M peptide (residues 29–39, green ) (PDB: 8RZU ). The β5-strand in SETD2 WT adopts a loop conformation in the structure of the SETD2 L1609P mutant ( boxed ). The P1609 residue in mutant SETD2 is shown in yellow . SETD2, SET-domain containing protein 2.

    Article Snippet: A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433–1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HI-control (DE3) E . coli .

    Techniques: Mutagenesis, Residue

    Effects of the SETD2 L1609P mutation on the conformations of neighboring residues of SETD2 and the H3K36M peptide. A , the left panel shows a cartoon overlay of the β5-β6 hairpin of SETD2 WT (PDB: 5JJY ) ( cyan ) and SETD2 L1609P mutant ( salmon ) structures. The H3K36M peptide is shown in orange and green for SETD2 WT and SETD2 L1609P, respectively. The side chains of residues L1609 and P1609 residues are shown as sticks ( yellow CPK). The middle panel shows a close-up view of the hairpin residues (1609–1613) of SETD2 WT ( cyan ) and SETD2 L1609P ( salmon ). The side chains are shown in CPK sticks . The right panel shows the β5-β6 hairpin residues of SETD2 WT ( top ) and SETD2 L1609P ( bottom ) in sticks . Dashes represent the distance between Cα of residues K1610 and E1613 residues. B , conformational remodeling of residues K1610 and K1639 of SETD2 and residue K37 of H3 induced by the L1609P mutation. Left panel shows residues SETD2 L1609 ( yellow ), K1610 (cyan), K1639 ( cyan ), and H3K37 ( orange ) in spheres and sticks in the SETD2 WT structure (PDB: 5JJY ). Middle panel shows residues SETD2 P1609 ( yellow ), K1610 ( salmon ), K1639 ( salmon ), and H3K37 ( green ) in spheres and sticks in the SETD2 L1609P structure. The right panel shows residues P1609 ( yellow ) and K1610 ( salmon ) from the SETD2 L1609P structure and residues K1639 ( cyan ) and H3K37 ( orange ) from the SETD2 WT structure. Steric clashes between side chains are shown in boxes . The orientations are the same in all three panels and were obtained by superimposing the SETD2 WT and L1609P main chains. C , surface representation of the SETD2 substrate-binding region. H3K36M peptides are shown as sticks. The left panel shows the SETD2 WT structure (PDB: 5JJY ) in light cyan . The SETD2 L1609 residue is shown in yellow . The SETD2 K1610 and K1639 residues are shown in blue . H3K36M peptide residues diffracting in both WT and L1609P structures (residues A29–H39) are shown in green . H3K36M peptide residues observed only in the SETD2 WT structure (residues R40-R42) are shown in transparent orange . The right panel shows the SETD2 L1609P structure in light pink . The SETD2 P1609 residue is shown in yellow . The K1610 and K1639 residues are shown in purple . H3K36M peptide residues observed in the SETD2 L1609P structure (A29–H39) are shown in green . SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: Effects of the SETD2 L1609P mutation on the conformations of neighboring residues of SETD2 and the H3K36M peptide. A , the left panel shows a cartoon overlay of the β5-β6 hairpin of SETD2 WT (PDB: 5JJY ) ( cyan ) and SETD2 L1609P mutant ( salmon ) structures. The H3K36M peptide is shown in orange and green for SETD2 WT and SETD2 L1609P, respectively. The side chains of residues L1609 and P1609 residues are shown as sticks ( yellow CPK). The middle panel shows a close-up view of the hairpin residues (1609–1613) of SETD2 WT ( cyan ) and SETD2 L1609P ( salmon ). The side chains are shown in CPK sticks . The right panel shows the β5-β6 hairpin residues of SETD2 WT ( top ) and SETD2 L1609P ( bottom ) in sticks . Dashes represent the distance between Cα of residues K1610 and E1613 residues. B , conformational remodeling of residues K1610 and K1639 of SETD2 and residue K37 of H3 induced by the L1609P mutation. Left panel shows residues SETD2 L1609 ( yellow ), K1610 (cyan), K1639 ( cyan ), and H3K37 ( orange ) in spheres and sticks in the SETD2 WT structure (PDB: 5JJY ). Middle panel shows residues SETD2 P1609 ( yellow ), K1610 ( salmon ), K1639 ( salmon ), and H3K37 ( green ) in spheres and sticks in the SETD2 L1609P structure. The right panel shows residues P1609 ( yellow ) and K1610 ( salmon ) from the SETD2 L1609P structure and residues K1639 ( cyan ) and H3K37 ( orange ) from the SETD2 WT structure. Steric clashes between side chains are shown in boxes . The orientations are the same in all three panels and were obtained by superimposing the SETD2 WT and L1609P main chains. C , surface representation of the SETD2 substrate-binding region. H3K36M peptides are shown as sticks. The left panel shows the SETD2 WT structure (PDB: 5JJY ) in light cyan . The SETD2 L1609 residue is shown in yellow . The SETD2 K1610 and K1639 residues are shown in blue . H3K36M peptide residues diffracting in both WT and L1609P structures (residues A29–H39) are shown in green . H3K36M peptide residues observed only in the SETD2 WT structure (residues R40-R42) are shown in transparent orange . The right panel shows the SETD2 L1609P structure in light pink . The SETD2 P1609 residue is shown in yellow . The K1610 and K1639 residues are shown in purple . H3K36M peptide residues observed in the SETD2 L1609P structure (A29–H39) are shown in green . SETD2, SET-domain containing protein 2.

    Article Snippet: A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433–1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HI-control (DE3) E . coli .

    Techniques: Mutagenesis, Residue, Binding Assay

    Details of H3K36M peptide recognition by SETD2 L1609P mutant . A , the left panel shows a clipped surface representation of the SETD2 WT-H3K36M peptide complex (PDB: 5JJY ). Peptide residues (residues A29–R42) are represented by sticks . The right panel shows a clipped surface representation of the SETD2 L1609P-H3K36M peptide complex. Peptide residues (A29–H39) are represented by sticks . The structures of the SETD2-H3K36M peptide complexes are shown in the same orientation after superimposition of the main chains. B , upper panel : Structural alignment of H3K36M peptides (residues A29–H39) in SETD2 WT (PDB: 5JJY ) ( orange ) and SETD2 L1609P ( green ) structures. Lower panel : Differences between SETD2-H3K36M peptide interactions in SETD2 WT and SETD2 L1609P complexes. Residue interactions across the binding interface of SETD2 WT or SETD2 L1609P mutant with H3K36M peptide were determined using LIGPLOT . Residues are represented by sticks . Residues involved in SETD2-H3K36M peptide interactions (nonbonded and hydrogen bonds) are represented by sticks and spheres . Dashes represent hydrogen bond. The lower left panel shows the SETD2 WT ( cyan )-H3M36 ( orange ) interacting residues that are specific for the SETD2 WT complex and not present in the SETD2 L1609P complex. These interactions are listed in a table ( bottom left ). The lower right panel shows SETD2 L1609P ( salmon )-H3K36M ( green ) peptide interacting residues that are specific for the SETD2 L1609P complex and not present in the SETD2 WT complex. These interactions are listed in a table ( bottom right ). SETD2, SET-domain containing protein 2.

    Journal: The Journal of Biological Chemistry

    Article Title: The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylation

    doi: 10.1016/j.jbc.2026.111259

    Figure Lengend Snippet: Details of H3K36M peptide recognition by SETD2 L1609P mutant . A , the left panel shows a clipped surface representation of the SETD2 WT-H3K36M peptide complex (PDB: 5JJY ). Peptide residues (residues A29–R42) are represented by sticks . The right panel shows a clipped surface representation of the SETD2 L1609P-H3K36M peptide complex. Peptide residues (A29–H39) are represented by sticks . The structures of the SETD2-H3K36M peptide complexes are shown in the same orientation after superimposition of the main chains. B , upper panel : Structural alignment of H3K36M peptides (residues A29–H39) in SETD2 WT (PDB: 5JJY ) ( orange ) and SETD2 L1609P ( green ) structures. Lower panel : Differences between SETD2-H3K36M peptide interactions in SETD2 WT and SETD2 L1609P complexes. Residue interactions across the binding interface of SETD2 WT or SETD2 L1609P mutant with H3K36M peptide were determined using LIGPLOT . Residues are represented by sticks . Residues involved in SETD2-H3K36M peptide interactions (nonbonded and hydrogen bonds) are represented by sticks and spheres . Dashes represent hydrogen bond. The lower left panel shows the SETD2 WT ( cyan )-H3M36 ( orange ) interacting residues that are specific for the SETD2 WT complex and not present in the SETD2 L1609P complex. These interactions are listed in a table ( bottom left ). The lower right panel shows SETD2 L1609P ( salmon )-H3K36M ( green ) peptide interacting residues that are specific for the SETD2 L1609P complex and not present in the SETD2 WT complex. These interactions are listed in a table ( bottom right ). SETD2, SET-domain containing protein 2.

    Article Snippet: A pet28a-MHL plasmid containing the cDNA coding for the human SETD2 catalytic domain (Addgene #25348, residues 1433–1711) was used in order to produce 6xHis-tagged WT SETD2 in BL21 HI-control (DE3) E . coli .

    Techniques: Mutagenesis, Residue, Binding Assay