massarray assay design software (Sequenom)
86
Structured Review
Sequenom
massarray assay design software
Massarray Assay Design Software, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequenom+multiplex+massarray/assay+design+massarray+software/pm17595314-71-15-14
Average 86 stars, based on 1 article reviews
Massarray Assay Design Software, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sequenom+multiplex+massarray/assay+design+massarray+software/pm17595314-71-15-14
Average 86 stars, based on 1 article reviews
massarray assay design software - by Bioz Stars,
2026-09
86/100 stars
Images
1) Product Images from "Genetic variation in tumour necrosis factor and lymphotoxin is not associated with endometriosis in an Australian sample."
Article Title: Genetic variation in tumour necrosis factor and lymphotoxin is not associated with endometriosis in an Australian sample.
Journal: Human reproduction (Oxford, England)
doi: 10.1093/humrep/dem182
Figure Legend Snippet: Figure 1: Single-nucleotide polymorphisms (SNPs) rs1800630 (-863A/C) genotyped in 958 endometriosis cases and 959 controls using Seque- nom MassARRAY platform (a) Genotypes for rs1800630 (known as -863C/A) were not consistent with Hardy–Weinberg equilibrium, (b) the assay showed good clusters and mass spectra and (c) the sequence of rs1800630 where arrows indicate positions of two neighbouring variants located adjacent to rs1800630 and in the site of the extension primer
Techniques Used: Sequencing
Related Articles
Software:Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population Article Snippet: .. The Sequenom Article Title: GP6 polymorphisms and venous thromboembolism: a Chinese case-control study with cross-population assessment. Article Snippet: .. All primers, including the extension primers for the SNP AR TIC LE IN PR ES S assay, were designed using Article Title: GP6 polymorphisms and venous thromboembolism: a Chinese case-control study with cross-population assessment Article Snippet: .. All primers, including the extension primers for the SNP assay, were designed using Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China. Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis. Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Polymerase Chain Reaction:Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population Article Snippet: .. The Sequenom Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis. Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Amplification:Article Title: TLR4 rs11536889 and rs1927914 SNPs are Associated with Ischemic Stroke Risk in a Southern Chinese Han Population Article Snippet: .. The Sequenom Article Title: Analysis of MIR155HG gene polymorphisms and ulcerative colitis susceptibility in the Chinese Han Population Article Snippet: .. Forward, reverse, and extension primers for PCR amplification were designed using the Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis. Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Article Title: Analysis of TNFAIP3, IRAK1, and TLR4 Gene Polymorphisms in Patients With Rheumatoid Arthritis Article Snippet: .. Primer sequences for PCR amplification and single base extension were designed using Sequenom's Synthesized:Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China. Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Mass Assay:Article Title: IL-17A rs2275913 polymorphism is associated with spinal tuberculosis but not with pulmonary tuberculosis: A study of the Han population in southern China. Article Snippet: .. Designed for IL-17 a SNP genotyping of primers (Forward: 5'ATGGTGTTAATCTCATCTGGTGGG3′, Reverse: 5′ATGCCCACGGTCCAGAAATAC3′), primers for this locus were designed and synthesized using Sequencing:Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep Article Snippet: .. Based on gene sequence information from the NCBI database (Ovis aries), PCR primers and single-base extension primers were designed using |