Review



prime scripttm rt qpcr reverse transcription kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    TaKaRa prime scripttm rt qpcr reverse transcription kit
    Prime Scripttm Rt Qpcr Reverse Transcription Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 13579 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/PCR+Amplification+Kit/pm41006735-288-1-7
    Average 96 stars, based on 13579 article reviews
    prime scripttm rt qpcr reverse transcription kit - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Quantitative RT-PCR:

    Article Title: Viral Contaminants in a Philippine Wastewater Treatment Plant: Quantification and Treatment Reduction
    Article Snippet: .. The thermal conditions for Inf-A, SARS-CoV-2, PMMoV, and Pseudomonas bacteriophage Φ6 were at 25 °C for 10 min, 52 °C for 5 min, and 95 °C for 10 s, followed by 45 cycles at 95 °C for 5 s and 60 °C for 30 s. The Norovirus Detection RT-qPCR Kit for Wastewater (Takara Bio) was used to quantify NoV-GI and NoV-GII by preparing a 25-μL mixture consisting of 10.0 μL of RT-qPCR buffer, 2.0 μL of Enzyme Mix, 1.0 μL of NV (GI/GII) Primer/Probe (Cy5 for GI and FAM for GII), 7.0 μL of RNase-free water, and 5 μL of the extracted nucleic acid. .. The thermal cyclic parameters were set as follows: 25 °C for 10 min, 42 °C for 5 min, and 95 °C for 30 s, followed by 45 cycles of 95 °C for 5 s and 56 °C for 30 s. Standard curves were generated for each viral target by preparing six 10-fold serial dilutions of the synthesized plasmid DNA for crAssphage (10 6 copies/5μL; containing the 125-bp amplification region sequences of 5’-CAGAAGTACAAACTCCTAAAAAACGTAGAGGTAGAGGTATTAATAACGATTTACGTGATGTAACTCGTAAAAAGTTTGATGAACGTACTGATTGTAATAAAGCTAATGGCTTGTTTATTGGTCAT-3’) and Inf-A (10 6 copies/5μL; containing the 146-bp amplification region sequences of 5’-CCGAGGTCGAAACGTACGTTCTTTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTGGAAAGTGTCTTTGCAGGAAAGAACACAGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCTTGTCA-3’) (Eurofins, Tokyo, Japan), positive control DNA of SARS-CoV-2 and PMMoV/Φ6 (10 6 copies/μL) in the SARS-CoV-2 Detection RT-qPCR Kit for Wastewater for SARS-CoV-2, PMMoV, and Φ6, and positive control DNA of NoV (10 6 copies/μL) in the Norovirus Detection RT-qPCR Kit for Wastewater for NoV-GI and NoV-GII.

    Article Title: Viral Contaminants in a Philippine Wastewater Treatment Plant: Quantification and Treatment Reduction.
    Article Snippet: .. The thermal conditions for Inf-A, SARS-CoV-2, PMMoV, and Pseudomonas bacteriophage Φ6 were at 25 °C for 10 min, 52 °C for 5 min, and 95 °C for 10 s, followed by 45 cycles at 95 °C for 5 s and 60 °C for 30 s. The Norovirus Detection RT-qPCR Kit for Wastewater (Takara Bio) was used to quantify NoV-GI and NoV-GII by preparing a 25-μL mixture consisting of 10.0 μL of RT-qPCR buffer, 2.0 μL of Enzyme Mix, 1.0 μL of NV (GI/GII) Primer/Probe (Cy5 for GI and FAM for GII), 7.0 μL of RNase-free water, and 5 μL of the extracted nucleic acid. .. The thermal cyclic parameters were set as follows: 25 °C for 10 min, 42 °C for 5 min, and 95 °C for 30 s, followed by 45 cycles of 95 °C for 5 s and 56 °C for 30 s. Standard curves were generated for each viral target by preparing six 10-fold serial dilutions of the synthesized plasmid DNA for crAssphage (106 copies/5μL; containing the 125-bp amplification region sequences of 5’- C A G A A G T A C A A A C T C C T A A A A A A C G T A G A G G T A G A G G T A T T A A T A A C G A T T T A C G T G A T G T A A C T C G T A A A A A G T T T G A T G A A C G T A C T G A T T G T A A T A A A G C T A A T G G C T T G T T T A T T G G T C A T-3’) and Inf-A (106 copies/5μL; containing the 146-bp amplification region sequences of 5’- C C G A G G T C G A A A C G T A C G T T C T T T C T A T C A T C C C G T C A G G C C C C C T C A A A G C C G A G A T C G C G C A G A G A C T G G A A A G T G T C T T T G C A G G A A A G A A C A C A G A T C T T G A G G C T C T C A T G G A A T G G C T A A A G A C A A G A C C A A T C T T G T C A-3’) (Eurofins, Tokyo, Japan), positive control DNA of SARS-CoV-2 and PMMoV/Φ6 (106 copies/μL) in the SARS-CoV-2 Detection RT-qPCR Kit for Wastewater for SARS-CoV-2, PMMoV, and Φ6, and positive control DNA of NoV (106 copies/μL) in the Norovirus Detection RT-qPCR Kit for Wastewater for NoV-GI and NoV-GII.

    Amplification:

    Article Title: Re-Emergence and Characterization of a Highly Pathogenic Getah Virus on a Pig Farm in Guangdong Province, China
    Article Snippet: .. The fragments were amplified by PCR using an amplification kit (TaKaRa, Dalian, China). .. Amplification products were cloned into the pMD19-T simple vector (Takara, Dalian, China) and then sequenced (Sangon Biotech, Guangzhou, China).

    Article Title: Exploration Novel Therapeutic Targets for Periodontitis via Stress Granules Biomarkers
    Article Snippet: After sufficient grinding with liquid nitrogen, total RNA was extracted from the gingiva by using RNAiso Plus (Takara). .. Subsequently, 5 x PrimeScript RT Master Mix (Takara) was utilised for reverse transcription, and a TB Green PCR Core Kit (TaKaRa) was employed for PCR amplification. .. The reaction and detection were implemented on a CFX96TM system (Bio-Rad).

    Article Title: Cloning, structural and functional characterization of the ABCB1 transporter of the Eurasian bullfinch ( Pyrrhula pyrrhula )
    Article Snippet: .. RACE-PCR was performed with the SMARTer RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) as previously reported ( ) using the manufacturer's standard protocol. .. PCR amplification was performed with the FastStart High Fidelity DNA polymerase (Roche) under the following touch-down thermocycling conditions on a Peqlab Primus 96 advanced gradient PCR cycler: initial denaturation at 95 °C for 2 min; 10 cycles of 95 °C for 30 s, 72 °C minus 0.5 °C each cycle for 30 s, and 72 °C for 1 min; 35 cycles of 95 °C for 30 s, 67 °C for 30 s, and 72 °C for 1 min; and a final elongation at 72 °C for 10 min.

    Article Title: T cell receptors and methods of use thereof
    Article Snippet: Genomic DNA of gp100 was isolated from SK-MEL-28 using PureLink Genomic DNA Mini Kit (Invitrogen). .. TCR genes were cloned by 5′-rapid amplification of cDNA ends (RACE) PCR using a SMARTer RACE cDNA amplification kit (Takara Bio). ..

    Article Title: Pachymic Acid Alleviates Non‐Alcoholic Fatty Liver Disease via FGF21 ‐Mediated Inhibition of the p38 MAPK Pathway
    Article Snippet: .. RNA was then reverse‐transcribed into cDNA with a Takara reverse transcription kit, followed by amplification and quantification by qRT‐PCR. ..

    Polymerase Chain Reaction:

    Article Title: Re-Emergence and Characterization of a Highly Pathogenic Getah Virus on a Pig Farm in Guangdong Province, China
    Article Snippet: .. The fragments were amplified by PCR using an amplification kit (TaKaRa, Dalian, China). .. Amplification products were cloned into the pMD19-T simple vector (Takara, Dalian, China) and then sequenced (Sangon Biotech, Guangzhou, China).

    Article Title: Exploration Novel Therapeutic Targets for Periodontitis via Stress Granules Biomarkers
    Article Snippet: After sufficient grinding with liquid nitrogen, total RNA was extracted from the gingiva by using RNAiso Plus (Takara). .. Subsequently, 5 x PrimeScript RT Master Mix (Takara) was utilised for reverse transcription, and a TB Green PCR Core Kit (TaKaRa) was employed for PCR amplification. .. The reaction and detection were implemented on a CFX96TM system (Bio-Rad).

    Article Title: T cell receptors and methods of use thereof
    Article Snippet: Genomic DNA of gp100 was isolated from SK-MEL-28 using PureLink Genomic DNA Mini Kit (Invitrogen). .. TCR genes were cloned by 5′-rapid amplification of cDNA ends (RACE) PCR using a SMARTer RACE cDNA amplification kit (Takara Bio). ..

    Article Title: Isolation and Identification of G8P[1] Bovine Rotavirus A Among Neonatal Diarrheic Calves in Yunnan, China
    Article Snippet: .. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScriptTM One-Step RT-PCR Kit (TaKaRa, Dalian, China). ..

    Reverse Transcription:

    Article Title: Exploration Novel Therapeutic Targets for Periodontitis via Stress Granules Biomarkers
    Article Snippet: After sufficient grinding with liquid nitrogen, total RNA was extracted from the gingiva by using RNAiso Plus (Takara). .. Subsequently, 5 x PrimeScript RT Master Mix (Takara) was utilised for reverse transcription, and a TB Green PCR Core Kit (TaKaRa) was employed for PCR amplification. .. The reaction and detection were implemented on a CFX96TM system (Bio-Rad).

    Article Title: Isolation and Identification of G8P[1] Bovine Rotavirus A Among Neonatal Diarrheic Calves in Yunnan, China
    Article Snippet: .. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScriptTM One-Step RT-PCR Kit (TaKaRa, Dalian, China). ..

    Article Title: Pachymic Acid Alleviates Non‐Alcoholic Fatty Liver Disease via FGF21 ‐Mediated Inhibition of the p38 MAPK Pathway
    Article Snippet: .. RNA was then reverse‐transcribed into cDNA with a Takara reverse transcription kit, followed by amplification and quantification by qRT‐PCR. ..

    Clone Assay:

    Article Title: T cell receptors and methods of use thereof
    Article Snippet: Genomic DNA of gp100 was isolated from SK-MEL-28 using PureLink Genomic DNA Mini Kit (Invitrogen). .. TCR genes were cloned by 5′-rapid amplification of cDNA ends (RACE) PCR using a SMARTer RACE cDNA amplification kit (Takara Bio). ..

    One Step RT-PCR:

    Article Title: Isolation and Identification of G8P[1] Bovine Rotavirus A Among Neonatal Diarrheic Calves in Yunnan, China
    Article Snippet: .. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScriptTM One-Step RT-PCR Kit (TaKaRa, Dalian, China). ..



    Similar Products

    99
    TaKaRa reverse transcription reagent prime scripttm rt reagent kit
    Reverse Transcription Reagent Prime Scripttm Rt Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/PrimeScript+RT+Reagent+Kit/pm41837479-39-83-94
    Average 99 stars, based on 1 article reviews
    reverse transcription reagent prime scripttm rt reagent kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher super scripttm iii reverse transcription kit
    Super Scripttm Iii Reverse Transcription Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/super+scripttm+iii+reverse+transcription+kit/10__1039_slash_d4ma01094a-140-14-20
    Average 90 stars, based on 1 article reviews
    super scripttm iii reverse transcription kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    TaKaRa prime scripttm rt qpcr reverse transcription kit
    Prime Scripttm Rt Qpcr Reverse Transcription Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/PCR+Amplification+Kit/pm41006735-288-1-7
    Average 96 stars, based on 1 article reviews
    prime scripttm rt qpcr reverse transcription kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Ribobio co scripttm reverse transcription kit
    Scripttm Reverse Transcription Kit, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/scripttm+reverse+transcription+kit/pm40037422-67-15-19
    Average 90 stars, based on 1 article reviews
    scripttm reverse transcription kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Enzynomics co Ltd top scripttm rt reverse transcription kit
    Top Scripttm Rt Reverse Transcription Kit, supplied by Enzynomics co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/topscript+reverse+transcription+kit/pm39979315-101-10-16
    Average 90 stars, based on 1 article reviews
    top scripttm rt reverse transcription kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega go scripttm reverse transcription kit
    Go Scripttm Reverse Transcription Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/goscripttm+reverse+transcription+system/pm39496386-70-6-11
    Average 90 stars, based on 1 article reviews
    go scripttm reverse transcription kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega go scripttm reverse transcription system kit
    Go Scripttm Reverse Transcription System Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/scripttm+reverse+transcription+kit/goscripttm+reverse+transcription+system/pmc11319933-108-17-23
    Average 90 stars, based on 1 article reviews
    go scripttm reverse transcription system kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results