gene exp gapdh hs99999905 m1 (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
gene exp gapdh hs99999905 m1
Gene Exp Gapdh Hs99999905 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s3+noncontact+microarray+printer/Gene+Exp%2E+GAPDH%2C+Hs99999905_m1/pmc04890760-303-35-36
Average 99 stars, based on 1 article reviews
Gene Exp Gapdh Hs99999905 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s3+noncontact+microarray+printer/Gene+Exp%2E+GAPDH%2C+Hs99999905_m1/pmc04890760-303-35-36
Average 99 stars, based on 1 article reviews
gene exp gapdh hs99999905 m1 - by Bioz Stars,
2026-11
99/100 stars
Images
1) Product Images from "EGFR Signal-Network Reconstruction Demonstrates Metabolic Crosstalk in EMT"
Article Title: EGFR Signal-Network Reconstruction Demonstrates Metabolic Crosstalk in EMT
Journal: PLoS Computational Biology
doi: 10.1371/journal.pcbi.1004924
Figure Legend Snippet: (A) Real-Time Quantitative Reverse Transcription PCR of EGFR in D492, D492M EGFR and D492M Empty , normalized to GAPDH. EGFR transcription level is significantly higher in D492M EGFR compared to D492M Empty but does not reach the D492 EGFR transcription level. (B) Protein expression of EGFR, Phospho-p44/42 MAPK (ERK1/2) and Phospho-AKT determined by Western blotting. Overexpression of EGFR in D492M leads to increased protein expression of EGFR in D492M EGFR compared to D492M Empty , but EGFR protein expression does not reach the D492 level. Overexpression of EGFR in D492M leads to increased MAPK (Erk1/2) and Akt phosphorylation which is higher than in both D492M Empty and D492.
Techniques Used: Reverse Transcription, Expressing, Western Blot, Over Expression, Phospho-proteomics
Figure Legend Snippet: Predicted expression of metabolic genes regulated by AKT in D492 and D492M cells.
Techniques Used: Expressing, Microarray, Starch
Related Articles
Gene Expression:Article Title: A Novel CIP2A and BCL-XL Clinical Diagnostic Toolkit to Predict Disease Progression and Treatment-Free Remission in Chronic Myeloid Leukaemia. Article Snippet: .. The relative gene expression (RQ) levels were normalised to the endogenous control, GAPDH (Thermo Scientific, Article Title: Compositions and methods for splicing modulation of UNC13A Article Snippet: The following PCR probe assay for UNC13A CE synthesized at Integrated DNA technologies (IDT) were used: UNC13A_CE FWD 5′-3′ CCCCGTACCATGTCCAGTACA (SEQ ID NO: 320), UNC13A_CE REV 5′-3′ CATTCACCAGCATTTATTCAACAAA (SEQ ID NO: 321), UNC13A_CE Probe 5′-3′/56-FAM/CTGCATGAG/ZEN/CTGCCT/3IABKFQ/. .. For housekeeping gene GAPDH expression analysis was performed by using Thermofisher® TaqMan Gene Expression Assay Article Title: Generation of biologically responsive colon-like intestinal tissue patches from human induced pluripotent stem cells using a rapid co-differentiation platform. Article Snippet: Quantitative real-time-PCR (qRT-PCR) was performed on LightCycler96 (Roche) with human Gapdh used as an endogenous control. .. The IDs of Taqman Gene expression assays (Applied Biosystems) used in this study are EpCAM (Hs00901885_m1), Cdx-2 (Hs01078080_m1), Sox17 (Hs00751752_s1), Nanog (Hs02387400_g1), Klf5 (Hs00156145_m1), Wnt2b (Hs00921614_m1), BMP4 (Hs00370078_m1), GAPDH ( Article Title: Higher expression of SOX1, miR-155, and miR-21 in the colostrum of SARS-CoV-2-infected mothers. Article Snippet: Commercially available TagMan probes (Applied Biosystems, Pleasanton, USA; ThermofisherScientific) were used for determinations: has-miR-21- .. AR TIC LE IN PR ES S ARTICLE IN PRESS 3p (ID 002438), Mature miRNA Sequence: CAACACCAGUCGAUGGGCUGU; hsa-miR-155-5p (ID 002623) Mature miRNA Sequence: UUAAUGCUAAUCGUGAUAGGGGU; for SOX1: Hs01057642_s1 (NM_005986.2); As an endogenous control, the miRNA: RNU48 (ID 001006) (GATGACCCCAGGTAACTCTGAGTGTGTCGCTGATGCCATCACCGCAGCG CTCTGACC) was used, and the gene: GAPDH: Control:Article Title: A Novel CIP2A and BCL-XL Clinical Diagnostic Toolkit to Predict Disease Progression and Treatment-Free Remission in Chronic Myeloid Leukaemia. Article Snippet: .. The relative gene expression (RQ) levels were normalised to the endogenous control, GAPDH (Thermo Scientific, Article Title: Higher expression of SOX1, miR-155, and miR-21 in the colostrum of SARS-CoV-2-infected mothers. Article Snippet: Commercially available TagMan probes (Applied Biosystems, Pleasanton, USA; ThermofisherScientific) were used for determinations: has-miR-21- .. AR TIC LE IN PR ES S ARTICLE IN PRESS 3p (ID 002438), Mature miRNA Sequence: CAACACCAGUCGAUGGGCUGU; hsa-miR-155-5p (ID 002623) Mature miRNA Sequence: UUAAUGCUAAUCGUGAUAGGGGU; for SOX1: Hs01057642_s1 (NM_005986.2); As an endogenous control, the miRNA: RNU48 (ID 001006) (GATGACCCCAGGTAACTCTGAGTGTGTCGCTGATGCCATCACCGCAGCG CTCTGACC) was used, and the gene: GAPDH: other:Article Title: Plasmacytoid dendritic cells modulate the production of mucosal IgA in IgA nephropathy Article Snippet: The levels of IgA, Gd-IgA1 and APRIL in culture supernatant were measured using IgA (Bethyl Laboratories), Gd-IgA1 (Immuno-Biological Laboratories) and APRIL (AdipoGen Life Sciences) ELISA kits according to the manufacturer’s instructions. Expressing:Article Title: Compositions and methods for splicing modulation of UNC13A Article Snippet: The following PCR probe assay for UNC13A CE synthesized at Integrated DNA technologies (IDT) were used: UNC13A_CE FWD 5′-3′ CCCCGTACCATGTCCAGTACA (SEQ ID NO: 320), UNC13A_CE REV 5′-3′ CATTCACCAGCATTTATTCAACAAA (SEQ ID NO: 321), UNC13A_CE Probe 5′-3′/56-FAM/CTGCATGAG/ZEN/CTGCCT/3IABKFQ/. .. For housekeeping gene GAPDH expression analysis was performed by using Thermofisher® TaqMan Gene Expression Assay Article Title: Cerebrospinal fluid and frontal cortex TMPRSS2 and ACE2 protein levels differ in Down syndrome and Alzheimer's disease. Article Snippet: .. We used the specific Thermo Fisher Scientific TaqMan probes for ACE2 (assay ID: Hs01085333_m1), TMPRSS2 (assay ID: Hs01122322_m1) and human GAPDH as a housekeeping gene (assay ID: Quantitative RT-PCR:Article Title: Good Manufacturing Practice-Derived Human Liver Stem Cell Extracellular Vesicles Attenuate Liver Fibrosis In Vivo Article Snippet: .. For each well of a 96-well reaction plate, the following reagents were mixed: 5 μL of TaqMan 1-Step qRT-PCR Mix, 1 μL of Primer 1 (GAPDH—FAM), 1 μL of primers, and 11 μL of molecular grade H 2 O. Primers used were pre-built and provided by Thermo Fisher as per the following specifications: GAPDH ( Gene Assay:Article Title: Cerebrospinal fluid and frontal cortex TMPRSS2 and ACE2 protein levels differ in Down syndrome and Alzheimer's disease. Article Snippet: .. We used the specific Thermo Fisher Scientific TaqMan probes for ACE2 (assay ID: Hs01085333_m1), TMPRSS2 (assay ID: Hs01122322_m1) and human GAPDH as a housekeeping gene (assay ID: Sequencing:Article Title: Higher expression of SOX1, miR-155, and miR-21 in the colostrum of SARS-CoV-2-infected mothers. Article Snippet: Commercially available TagMan probes (Applied Biosystems, Pleasanton, USA; ThermofisherScientific) were used for determinations: has-miR-21- .. AR TIC LE IN PR ES S ARTICLE IN PRESS 3p (ID 002438), Mature miRNA Sequence: CAACACCAGUCGAUGGGCUGU; hsa-miR-155-5p (ID 002623) Mature miRNA Sequence: UUAAUGCUAAUCGUGAUAGGGGU; for SOX1: Hs01057642_s1 (NM_005986.2); As an endogenous control, the miRNA: RNU48 (ID 001006) (GATGACCCCAGGTAACTCTGAGTGTGTCGCTGATGCCATCACCGCAGCG CTCTGACC) was used, and the gene: GAPDH: Real-time Polymerase Chain Reaction:Article Title: Higher expression of SOX1, miR-155, and miR-21 in the colostrum of SARS-CoV-2-infected mothers. Article Snippet: Commercially available TagMan probes (Applied Biosystems, Pleasanton, USA; ThermofisherScientific) were used for determinations: has-miR-21- .. AR TIC LE IN PR ES S ARTICLE IN PRESS 3p (ID 002438), Mature miRNA Sequence: CAACACCAGUCGAUGGGCUGU; hsa-miR-155-5p (ID 002623) Mature miRNA Sequence: UUAAUGCUAAUCGUGAUAGGGGU; for SOX1: Hs01057642_s1 (NM_005986.2); As an endogenous control, the miRNA: RNU48 (ID 001006) (GATGACCCCAGGTAACTCTGAGTGTGTCGCTGATGCCATCACCGCAGCG CTCTGACC) was used, and the gene: GAPDH: Reverse Transcription:Article Title: Higher expression of SOX1, miR-155, and miR-21 in the colostrum of SARS-CoV-2-infected mothers. Article Snippet: Commercially available TagMan probes (Applied Biosystems, Pleasanton, USA; ThermofisherScientific) were used for determinations: has-miR-21- .. AR TIC LE IN PR ES S ARTICLE IN PRESS 3p (ID 002438), Mature miRNA Sequence: CAACACCAGUCGAUGGGCUGU; hsa-miR-155-5p (ID 002623) Mature miRNA Sequence: UUAAUGCUAAUCGUGAUAGGGGU; for SOX1: Hs01057642_s1 (NM_005986.2); As an endogenous control, the miRNA: RNU48 (ID 001006) (GATGACCCCAGGTAACTCTGAGTGTGTCGCTGATGCCATCACCGCAGCG CTCTGACC) was used, and the gene: GAPDH: |
