macsquant running buffer (Miltenyi Biotec)
Miltenyi Biotec is a verified supplier 
Miltenyi Biotec manufactures this product 
95
Structured Review
Miltenyi Biotec
macsquant running buffer
Macsquant Running Buffer, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/running+buffer/MACSQuant+Running+Buffer/pm42127909-906-14-17
Average 95 stars, based on 90 article reviews
Macsquant Running Buffer, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/running+buffer/MACSQuant+Running+Buffer/pm42127909-906-14-17
Average 95 stars, based on 90 article reviews
macsquant running buffer - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Flow Cytometry:Article Title: High-throughput screening approach identifies substrate-selective Hsp104 variants that counter amyloid seeding with diminished off-target effects. Article Snippet: .. Cells for flow cytometry were fixed in 4% paraformaldehyde (Thermo Fisher) and resuspended in Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with Cytometry:Article Title: Development of Replicon Cell Pools Bearing a Flavivirus RNA Replicon as a Source of HIV-1 Gag-Pol for Lentiviral Vector Production Article Snippet: .. Cells were detached with trypsin-EDTA, washed with PBS, and resuspended in 1 mL of Incubation:Article Title: Multi-antigen-targeting T cells in pediatric central nervous system tumors: a phase 1 trial. Article Snippet: Each tube received 100 μl of Fixable Live/Dead Aqua (Thermo Fisher Scientific, cat. no. L34966) or Fixable Live/Dead Near IR (Thermo Fisher Scientific, cat. no. L34976) dye and was incubated in the dark for 20 min. .. Following incubation, other:Article Title: CD177 Deficiency Defines a Stable Subtype of Human Neutrophil Granulocytes with Tumor Promoting Activity. Article Snippet: C re Thermo Fisher Scientific; Cat. # 11875085 ) supplemented with 0% fetal bovine serum (PAN-Biotech; Cat. # P30-3031) and 00 U/mL penicillin–streptomycin (Thermo Fisher Scientific; at Passaging:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with Suspension:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with Concentration Assay:Article Title: Nanopore Electroporation: A New Delivery Method Within the Field of Epigenetic Editing. Article Snippet: The following primer air was used to clone the sgRNA into the MLM3636 vector Plasmid #43860, Addgene, Watertown, MA, USA) as previously escribed (Primer sense (Sequence 5′-3′): ACACCGCTTTGCGTTTGGCCCATTAG and Primer antisense (Sequence 5′-3′): AAACTAATGGGCCAAACGGCAAAGCG) [52]. of 11 .. After resuspending INS1 β-cells according to the passaging protocol, the cell suspension was diluted 10 times in DPBS containing DAPI (0.01 μg/ml final concentration) before determination of cell concentration and viability using flow cytometry on a MACSQuant Analyzer 16 Flow cytometer with |