rnp complexes (Synthego Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Synthego Inc rnp complexes
Rnp Complexes, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rnp+complex/complexes+rnp/pm41237357-60-0-10
Average 86 stars, based on 1 article reviews

rnp complexes - by Bioz Stars, 2026-10

86/100 stars

Images

other:

Article Title: Highly discriminative globin gene activation by the non-canonical BAF chromatin remodeling complex.
Article Snippet: RNP complexes of 50 pmol SpCas9 and 300 pmol sgRNA (Synthego, supplemental table S2) were nucleofected into 100,000 Phase I CD34+ HSPCs using an Amaxa 4D nucleofector from Lonza with program DZ-100 in P3 solution.

Control:

Article Title: Mutations outside the MR1 antigen binding groove differentially inhibit presentation of exogenous antigens
Article Snippet: .. 6e5 cells were electroporated with ribonucleoprotein complexes prepared from SpCas9 2NLS nuclease and either nontargeting control scrambled sgRNA No 1 or three sgRNAs targeting B2M (all EditCo, formerly : Synthego, sequences: CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) using a Neon N x T Electroporation system (Invitrogen) according to the manufacturer’s instructions. .. In short, SpCas9 and sgRNA were mixed in resuspension buffer (Synthego) at a 1:9 M ratio and incubated at RT for 10 min before transfecting the cells using two 20 ms pulses at 1400 V. Editing was confirmed by PCR amplification of the target region in the polyclonal cell line before proceeding.

Article Title: Human genetic variation reveals FCRL3 is a lymphocyte receptor for Yersinia pestis
Article Snippet: .. To assemble RNP complexes, Synthego sgRNAs stocks for CD46 (a control transmembrane protein found on all nucleated cells) and FCRL3 at 30 μM and Cas9 at 20 μM were prepared ( ). ..

Electroporation:

Gene Knockout:

Article Title: Recombinant cathepsins B and L promote α-synuclein clearance and restore lysosomal function in human and murine models with α-synuclein pathology.
Article Snippet: .. Briefly, ribonucleoprotein (RNP), complexes of CTSB or CTSL multi RNA guides and Cas9 protein were assembled as per the manufacturer’s instructions (Gene Knockout Kit v2; Synthego) to transfect H4 cells via the Neon Transfection System. .. Briefly, ribonucleoprotein (RNP), complexes of CTSB or CTSL multi RNA guides and Cas9 protein were assembled as per the manufacturer’s instructions (Gene Knockout Kit v2; Synthego) to transfect H4 cells via the Neon Transfection System.

Transfection:

Double Knockout:

Article Title: Multimodal HLA-I genotype regulation by human cytomegalovirus US10 and resulting surface patterning
Article Snippet: .. HeLa HLA- I and β2m double knockout cells were generated by nucleofection of SpCas9 and guide RNA ribonucleoprotein complexes (Synthego) into HLA- I HeLa ..

Generated:

Introduce:

Article Title: Generation and validation of a human iPSC-derived TDP-43 knockout model for ALS disease modeling
Article Snippet: .. To introduce double-stranded DNA breaks in either exon 1 or exon 2 of TARDBP , iPSCs were electroporated with the ribonucleoprotein (RNP) complexes consisting of Alt-R SpCas9 Nuclease V3 (IDT, 1081059) and each of the different sgRNA guides (Synthego, sgRNA EZ kit) at a 1 to 3 molar ratio, respectively. ..

Knockdown:

Article Title: Convergence of coronary artery disease genes onto endothelial cell programs
Article Snippet: .. For some experiments, we used Synthego’s ribonucleoprotein (RNP) technology as an orthologous method to knock down target genes, as previously described 80 . .. Briefly, TeloHAEC were nucleofected with Synthego’s Gene Knockout Kit v2 for non-targeting negative control, CCM2, TLNRD1 or MAP3K3 using the Lonza 4D-Nucleofector system.

Review