shRNA:Article Title: Sequence-dependent splicing dysregulation drives therapy resistance in pediatric AML.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains C57BL/6N Charles River N/A Oligonucleotides See Table for a list of human and mouse primer This paper N/A shRNA of scramble: CCTAAGGTTAAGTCGCCCTCG This paper N/A shRNA1 of U2AF2: GAAGAAGAAGGTCCGTAAATA This paper N/A shRNA3 of U2AF2: GGTAGGAACATAGCGTGTTTA This paper N/A Recombinant DNA U2AF2 cDNA CUSABIO Cat#CSB-CL025408HU METTL3 cDNA Y G. Yang labratory N/A Software and algorithms GraphPad Prism 10 GraphPad Software Foundation https://www.graphpad.com ImageJ NIH https://ImageJ.nih.gov/ij/ Samtools (1.9) Li et al., 2009 35 https://samtools.sourceforge.net/ BWA (0.7.1) Li et al., 2009 36 N/A STAR (2.7.7a) Dobin et al., 2013 37 https://github.com/alexdobin/STAR featureCounts (2.0.1) Liao et al., 2014 38 N/A Excel Microsoft N/A R software (4.2.3) R Core Team, 2013 https://www.R-project.org/ Illustrator Adobe N/A rMATS (4.0.2) Shen et al., 2014 39 N/A Cell Reports Medicine 7, 102542, January 20, 2026 e2 ..
Recombinant:Article Title: Sequence-dependent splicing dysregulation drives therapy resistance in pediatric AML.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains C57BL/6N Charles River N/A Oligonucleotides See Table for a list of human and mouse primer This paper N/A shRNA of scramble: CCTAAGGTTAAGTCGCCCTCG This paper N/A shRNA1 of U2AF2: GAAGAAGAAGGTCCGTAAATA This paper N/A shRNA3 of U2AF2: GGTAGGAACATAGCGTGTTTA This paper N/A Recombinant DNA U2AF2 cDNA CUSABIO Cat#CSB-CL025408HU METTL3 cDNA Y G. Yang labratory N/A Software and algorithms GraphPad Prism 10 GraphPad Software Foundation https://www.graphpad.com ImageJ NIH https://ImageJ.nih.gov/ij/ Samtools (1.9) Li et al., 2009 35 https://samtools.sourceforge.net/ BWA (0.7.1) Li et al., 2009 36 N/A STAR (2.7.7a) Dobin et al., 2013 37 https://github.com/alexdobin/STAR featureCounts (2.0.1) Liao et al., 2014 38 N/A Excel Microsoft N/A R software (4.2.3) R Core Team, 2013 https://www.R-project.org/ Illustrator Adobe N/A rMATS (4.0.2) Shen et al., 2014 39 N/A Cell Reports Medicine 7, 102542, January 20, 2026 e2 ..
Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer.
Article Snippet: N/A Biological samples Human Colon Rectal Cancer tissue samples and corresponding adjacent tumor-free tissues This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona, Switzerland;University Basel Hospital, and Klinikum Rechts Der Isar, Mü nich, Germany Peripheral Blood Mononuclear Cells from CRC patient and healthy donors This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Amresco N/A Collagenase D Merck Cat#11088882001 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 DNase I Merck Cat#10104159001 Fetal bovine serum (FBS) Gibco (Thermo Fisher) Cat#10270-106 Fluoromount-GTM Mounting Medium Thermo Fisher Scientific (Invitrogen) Cat#00-4958-02 GlutaMAX Gibco (Thermo Fisher) Cat#35050-061 Growth Factor Reduced Matrigel Corning Costar N/A Hoechst 33342 Thermo Fisher Scientific Cat#62249 Human serum Sigma-Aldrich Cat#H4522 Human Siglec-5-Fc chimera R&D Cat#1072-SL Human Siglec-14-Fc chimera R&D Cat#4905-SL Hyaluronidase type I Sigma-Aldrich Cat#H3506 Kanamycin sulfate Gibco (Thermo Fisher) Cat#15160-047 Ketamine Streuli Pharma AG N/A Lysozyme Sigma-Aldrich Cat#L6876 Paraformaldehyde (PFA) Sigma-Aldrich Cat#158127 PEI PrimeTM linear polyethylenimine Sigma-Aldrich Cat#919012 Phenol (aqueous) Sigma-Aldrich N/A Phosphate-buffered saline (PBS) Gibco (Thermo Fisher) Cat#14190-144 PMA (phorbol 12-myristate 13-acetate) Sigma-Aldrich Cat#P8139 p-Nitrophenyl phosphate (pNPP) Sigma-Aldrich Cat#36199-67-4 Polybrene Sigma-Aldrich Cat#H9268 Poly-L-lysine Sigma-Aldrich Cat#P8920 Proteinase K (molecular biology grade) Thermo Scientific Cat#EO0491 Protein Bloking Buffer Dako Cat#X0909 (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Origene Cat#RC206610L4 Human SIGLEC14 ORF clone (mGFP-tagged) Origene Cat#RC224202L4 pCMV-dR8.2 Addgene Cat #8455 pVSV-G Addgene Cat#138479 Software and algorithms Adobe Illustrator 27.4 Adobe RRID: SCR_010279 cBioPortal https://www.cbioportal.org N/A CellSense Microscope Imaging Software Olympus N/A clusterProfiler (v4.6.2) Bioconductor RRID:SCR_016884 DoubletFinder (v2.0.6) GitHub RRID:SCR_018301 FACS Diva Software BD Biosciences RRID: SCR_001456 FACS Symphony A5 Cell Analyzer BD Biosciences RRID: SCR_022674 FlowJo v10 + Downsample v3.0.0 + UMAP v2.2 + XShift/Cluster Explorer FlowJo LLC RRID: SCR_008520 GraphPad Prism v8.3.1 GraphPad RRID:SCR_002798 Human Protein Atlas (v23) https://www.proteinatlas.org N/A ImageJ NIH RRID:SCR_003070 ImageJ (FiJi) https://imagej.net/Fiji RRID:SCR_002285 Leiden algorithm Seurat / R N/A MAPS software FEI / Thermo Fisher Scientific N/A PCA Seurat / R RRID:SCR_016341; https://satijalab.org/seurat R (v4.4.3) The R Project RRID:SCR_001905 Seurat (v5.3) Satija Lab / CRAN RRID:SCR_016341 Seurat R package v5.1.0 CRAN/Bioconductor RRID:SCR_016341; https://satijalab.org/seurat (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e4 ..
Software:Article Title: Sequence-dependent splicing dysregulation drives therapy resistance in pediatric AML.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains C57BL/6N Charles River N/A Oligonucleotides See Table for a list of human and mouse primer This paper N/A shRNA of scramble: CCTAAGGTTAAGTCGCCCTCG This paper N/A shRNA1 of U2AF2: GAAGAAGAAGGTCCGTAAATA This paper N/A shRNA3 of U2AF2: GGTAGGAACATAGCGTGTTTA This paper N/A Recombinant DNA U2AF2 cDNA CUSABIO Cat#CSB-CL025408HU METTL3 cDNA Y G. Yang labratory N/A Software and algorithms GraphPad Prism 10 GraphPad Software Foundation https://www.graphpad.com ImageJ NIH https://ImageJ.nih.gov/ij/ Samtools (1.9) Li et al., 2009 35 https://samtools.sourceforge.net/ BWA (0.7.1) Li et al., 2009 36 N/A STAR (2.7.7a) Dobin et al., 2013 37 https://github.com/alexdobin/STAR featureCounts (2.0.1) Liao et al., 2014 38 N/A Excel Microsoft N/A R software (4.2.3) R Core Team, 2013 https://www.R-project.org/ Illustrator Adobe N/A rMATS (4.0.2) Shen et al., 2014 39 N/A Cell Reports Medicine 7, 102542, January 20, 2026 e2 ..
Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer.
Article Snippet: N/A Biological samples Human Colon Rectal Cancer tissue samples and corresponding adjacent tumor-free tissues This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona, Switzerland;University Basel Hospital, and Klinikum Rechts Der Isar, Mü nich, Germany Peripheral Blood Mononuclear Cells from CRC patient and healthy donors This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Amresco N/A Collagenase D Merck Cat#11088882001 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 DNase I Merck Cat#10104159001 Fetal bovine serum (FBS) Gibco (Thermo Fisher) Cat#10270-106 Fluoromount-GTM Mounting Medium Thermo Fisher Scientific (Invitrogen) Cat#00-4958-02 GlutaMAX Gibco (Thermo Fisher) Cat#35050-061 Growth Factor Reduced Matrigel Corning Costar N/A Hoechst 33342 Thermo Fisher Scientific Cat#62249 Human serum Sigma-Aldrich Cat#H4522 Human Siglec-5-Fc chimera R&D Cat#1072-SL Human Siglec-14-Fc chimera R&D Cat#4905-SL Hyaluronidase type I Sigma-Aldrich Cat#H3506 Kanamycin sulfate Gibco (Thermo Fisher) Cat#15160-047 Ketamine Streuli Pharma AG N/A Lysozyme Sigma-Aldrich Cat#L6876 Paraformaldehyde (PFA) Sigma-Aldrich Cat#158127 PEI PrimeTM linear polyethylenimine Sigma-Aldrich Cat#919012 Phenol (aqueous) Sigma-Aldrich N/A Phosphate-buffered saline (PBS) Gibco (Thermo Fisher) Cat#14190-144 PMA (phorbol 12-myristate 13-acetate) Sigma-Aldrich Cat#P8139 p-Nitrophenyl phosphate (pNPP) Sigma-Aldrich Cat#36199-67-4 Polybrene Sigma-Aldrich Cat#H9268 Poly-L-lysine Sigma-Aldrich Cat#P8920 Proteinase K (molecular biology grade) Thermo Scientific Cat#EO0491 Protein Bloking Buffer Dako Cat#X0909 (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Origene Cat#RC206610L4 Human SIGLEC14 ORF clone (mGFP-tagged) Origene Cat#RC224202L4 pCMV-dR8.2 Addgene Cat #8455 pVSV-G Addgene Cat#138479 Software and algorithms Adobe Illustrator 27.4 Adobe RRID: SCR_010279 cBioPortal https://www.cbioportal.org N/A CellSense Microscope Imaging Software Olympus N/A clusterProfiler (v4.6.2) Bioconductor RRID:SCR_016884 DoubletFinder (v2.0.6) GitHub RRID:SCR_018301 FACS Diva Software BD Biosciences RRID: SCR_001456 FACS Symphony A5 Cell Analyzer BD Biosciences RRID: SCR_022674 FlowJo v10 + Downsample v3.0.0 + UMAP v2.2 + XShift/Cluster Explorer FlowJo LLC RRID: SCR_008520 GraphPad Prism v8.3.1 GraphPad RRID:SCR_002798 Human Protein Atlas (v23) https://www.proteinatlas.org N/A ImageJ NIH RRID:SCR_003070 ImageJ (FiJi) https://imagej.net/Fiji RRID:SCR_002285 Leiden algorithm Seurat / R N/A MAPS software FEI / Thermo Fisher Scientific N/A PCA Seurat / R RRID:SCR_016341; https://satijalab.org/seurat R (v4.4.3) The R Project RRID:SCR_001905 Seurat (v5.3) Satija Lab / CRAN RRID:SCR_016341 Seurat R package v5.1.0 CRAN/Bioconductor RRID:SCR_016341; https://satijalab.org/seurat (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e4 ..
Negative Control:Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Real-time Polymerase Chain Reaction:Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Over Expression:Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Plasmid Preparation:Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Control:Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER KrasLA2 mice Charles River N/A Oligonucleotides Human IRG1 siRNA (Hs_IRG1_4) Qiagen SI05379920 Human IRG1 siRNA (Hs_IRG1_3) Qiagen SI05172685 Human G6PD siRNA (Hs_G6PD_6) Qiagen SI03082450 Human G6PD siRNA (Hs_G6PD_2) Qiagen SI00008862 AllStars Negative Control siRNA Qiagen Cat# 1027292 qPCR primers This study Table S2 Recombinant DNA IRG1 overexpression plasmid GeneCopoeia Cat# Ex-l1206-Lv105 Empty control plasmid GeneCopoeia Cat# Ex-NEG-Lv105 TKT overexpression plasmid Addgene Cat# Plasmid #175331 Software and algorithms GraphPad Prism GraphPad v9 ImageJ NIH 1.54P SCiLS Lab Bruker 2025b MetaboScape Bruker 2025 ll OPEN ACCESS Article e2 Cell Metabolism 38, 1–18.e1–e8, July 7, 2026 treated according to European Commission guidelines for laboratory animals. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
Mouse Assay:Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer.
Article Snippet: N/A Biological samples Human Colon Rectal Cancer tissue samples and corresponding adjacent tumor-free tissues This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona, Switzerland;University Basel Hospital, and Klinikum Rechts Der Isar, Mü nich, Germany Peripheral Blood Mononuclear Cells from CRC patient and healthy donors This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Amresco N/A Collagenase D Merck Cat#11088882001 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 DNase I Merck Cat#10104159001 Fetal bovine serum (FBS) Gibco (Thermo Fisher) Cat#10270-106 Fluoromount-GTM Mounting Medium Thermo Fisher Scientific (Invitrogen) Cat#00-4958-02 GlutaMAX Gibco (Thermo Fisher) Cat#35050-061 Growth Factor Reduced Matrigel Corning Costar N/A Hoechst 33342 Thermo Fisher Scientific Cat#62249 Human serum Sigma-Aldrich Cat#H4522 Human Siglec-5-Fc chimera R&D Cat#1072-SL Human Siglec-14-Fc chimera R&D Cat#4905-SL Hyaluronidase type I Sigma-Aldrich Cat#H3506 Kanamycin sulfate Gibco (Thermo Fisher) Cat#15160-047 Ketamine Streuli Pharma AG N/A Lysozyme Sigma-Aldrich Cat#L6876 Paraformaldehyde (PFA) Sigma-Aldrich Cat#158127 PEI PrimeTM linear polyethylenimine Sigma-Aldrich Cat#919012 Phenol (aqueous) Sigma-Aldrich N/A Phosphate-buffered saline (PBS) Gibco (Thermo Fisher) Cat#14190-144 PMA (phorbol 12-myristate 13-acetate) Sigma-Aldrich Cat#P8139 p-Nitrophenyl phosphate (pNPP) Sigma-Aldrich Cat#36199-67-4 Polybrene Sigma-Aldrich Cat#H9268 Poly-L-lysine Sigma-Aldrich Cat#P8920 Proteinase K (molecular biology grade) Thermo Scientific Cat#EO0491 Protein Bloking Buffer Dako Cat#X0909 (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Origene Cat#RC206610L4 Human SIGLEC14 ORF clone (mGFP-tagged) Origene Cat#RC224202L4 pCMV-dR8.2 Addgene Cat #8455 pVSV-G Addgene Cat#138479 Software and algorithms Adobe Illustrator 27.4 Adobe RRID: SCR_010279 cBioPortal https://www.cbioportal.org N/A CellSense Microscope Imaging Software Olympus N/A clusterProfiler (v4.6.2) Bioconductor RRID:SCR_016884 DoubletFinder (v2.0.6) GitHub RRID:SCR_018301 FACS Diva Software BD Biosciences RRID: SCR_001456 FACS Symphony A5 Cell Analyzer BD Biosciences RRID: SCR_022674 FlowJo v10 + Downsample v3.0.0 + UMAP v2.2 + XShift/Cluster Explorer FlowJo LLC RRID: SCR_008520 GraphPad Prism v8.3.1 GraphPad RRID:SCR_002798 Human Protein Atlas (v23) https://www.proteinatlas.org N/A ImageJ NIH RRID:SCR_003070 ImageJ (FiJi) https://imagej.net/Fiji RRID:SCR_002285 Leiden algorithm Seurat / R N/A MAPS software FEI / Thermo Fisher Scientific N/A PCA Seurat / R RRID:SCR_016341; https://satijalab.org/seurat R (v4.4.3) The R Project RRID:SCR_001905 Seurat (v5.3) Satija Lab / CRAN RRID:SCR_016341 Seurat R package v5.1.0 CRAN/Bioconductor RRID:SCR_016341; https://satijalab.org/seurat (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e4 ..
Sequencing:Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Reverse Transcription Polymerase Chain Reaction:Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Modification:Article Title: Development of functional resident macrophages in human pluripotent stem cell-derived colonic organoids and human fetal colon.
Article Snippet: This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO d22 and d37 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vitro HCO hematopoietic suspended cells only d28 This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data – in vivo HCO transplant 15 wks post-transplant This Paper GEO: GSE240363 Raw and analyzed scRNA-seq data - in vitro iPSC-derived Monocyte/Macrophages d14 This Paper GEO: GSE240363 Reference scRNA-seq data – human fetal hemogenic and hematopoietic atlas Calvanese et al.16 GEO: GSE162950 Reference scRNA-seq data – human fetal hematopoietic atlas Popescu et al.51 ArrayExpress: E-MTAB-7407 Reference scRNA-seq data – human fetal hematopoietic and macrophage atlas Bian et al.15 GEO: GSE133345 Reference scRNA-seq data – human fetal endodermal organ atlas Yu et al.57 ArrayExpress: E-MTAB-10187, E-MTAB-10268, E-MTAB-8221, E-MTAB-9228, E-MTAB-9489 Experimental models: Cell lines Human: H1 ES cells CCHMC Pluripotent Stem cell core / WiCell Research Institute NIH hESC-10-0043 Human: iPSC72.3 iPS cells CCHMC Pluripotent Stem cell core/McCracken et al.35 N/A Human: iPSC115.3 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC209.2 iPS cells CCHMC Pluripotent Stem cell core / This Paper N/A Human: iPSC263.10 iPS cells CCHMC Pluripotent Stem cell core / Holokai et al.90 N/A Human: HEK-293T CCHMC Pluripotent Stem cell core / ATCC CRL-3216 Mouse: Irradiated CF1-MEF Feeders CCHMC Pluripotent Stem cell core N/A Experimental models: Organisms/strains Mouse: NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) CCHMC Comprehensive Mouse and Cancer Core Facility N/A (Continued on next page) e3 Cell Stem Cell 30, 1434–1451.e1–e9, November 2, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Wildtype CD1 Mice Charles River 022 Oligonucleotides CDX2 gRNA Target Sequence: GTCGCTACATCACCATCCGG http://CRISPOR.org/ Integrated DNA Technologies (IDT) / This Paper N/A RT-PCR Primer Sequences See Table S2 N/A Recombinant DNA Plasmid: High Fidelity modified pX458-eSPCas9(1.1)-2A-GFP CCHMC Genome Editing Core Addgene Plasmid #48138 Software and algorithms Bowtie Langmead et al.91 v2.2.5 Cufflinks Trapnell et al.92 v2.2.1 Debian Linux 64-bit ‘‘Wheezy’’ N/A v7.10 FastQC N/A v0.10.1 Partek Flow N/A N/A IMARIS Bitplane N/A NIS Elements Nikon N/A R N/A v3.6.3, v4.1.1, and v4.2.1 R Studio N/A v1.2.5033 and v1.4.1717 Seurat Butler et al.93 v3.2.1 TopHat N/A v2.0.13 CellRanger 10x Genomics v3.0.2 FACSDiva BD Biosciences N/A Monocle 3 Cao et al.94 v1.2.7 CellChat Jin et al.95 v1.1.3 ELeFHAnt Thorner et al.96 v1.1.4 Prism 9 Graphpad v9.5.1 Other Ultra-Low Attachment Plates Corning 3471 AggreWell 400 24 well Plates StemCell Technologies 34415 Ibidi 2 well chambers Ibidi 80286 ..
Knock-In:Article Title: The Arp2/3 complex controls the development of homeostatic microglia.
Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T. .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T.
Membrane:Article Title: The Arp2/3 complex controls the development of homeostatic microglia.
Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T. .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T.
RNAscope:Article Title: The Arp2/3 complex controls the development of homeostatic microglia.
Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T. .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T.
Multiplex Assay:Article Title: The Arp2/3 complex controls the development of homeostatic microglia.
Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T. .. Reagents and tools table Reagent/resource Reference or source Identifier or catalog number Experimental models C57BL/6J wild-type mice Charles River Arpc4flox mice Prof. Metello Innocenti (Università degli Studi di Milano-Bicocca) van der Kammen et al, 2017 Tg(Cx3cr1-Cre) MW126Gsat/Mmucd mice MMRRC Stock #036395- UCD Cx3cr1GFP knock-in mice Jackson Laboratory Strain No. 005582 Antibodies Rabbit anti-IBA1 Wako Cat#019-19741 Guinea pig anti-IBA1 Synaptic Systems Cat#234 308 Reagent/resource Reference or source Identifier or catalog number Rat anti-MAC2 (Galectin3) BioLegend Cat#125402 Chicken anti-MBP Thermo Fisher Scientific Cat#PA1-10008 Rat anti-CD68 Bio-Rad Cat#MCA1957 Goat anti-AXL R&D Systems Cat#AF854 Rat anti-P2RY12 BioLegend Cat#848002 Rabbit anti-PhosphoSMAD2 (Ser465/467) Merck Cat#AB3849-I Rabbit anti-PhosphoSMAD3 (Ser423/425) Thermo Fisher Scientific Cat#44-246 G Rat anti-TMEM119 (PE, V3RT1Gosz) Invitrogen Cat#12-6119-82 Mouse anti-CD45 (APC, 104) Thermo Fisher Scientific Cat#17-045482; RRID: AB_469400 Rat anti-CD11b (PE, M1/ 70) Thermo Fisher Scientific Cat#25-0112-82 Rat anti-CD3 (APC/Cy7, 17/A2) BioLegend Cat#100222 Rat anti-Ly6G (APC/Cy7, 1A8) BioLegend Cat#127624 Rat anti-CD19 (APC/Cy7, 6D5) BioLegend Cat#115530 Rat anti-Ly6C (APC/Cy7, HK1.4) BioLegend Cat#128025 Chemicals, enzymes and other reagents Neural Tissue Dissociation Kit (Papain) Miltenyi Biotec Cat# 130-092- 628 Zombie Violet Fixable Viability Kit BioLegend Cat# 423113 Matrigel Basement Membrane Matrix Corning Cat# 356234 RNAscope Multiplex Fluorescent Detection Reagents v2 Advanced Cell Diagnostics (ACD) Cat# 323100 VECTASTAIN ABC Kit (Standard) Vector Laboratories Cat# PK-6100 Tissue-Tek O.C.T.
Microscopy:Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer.
Article Snippet: N/A Biological samples Human Colon Rectal Cancer tissue samples and corresponding adjacent tumor-free tissues This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona, Switzerland;University Basel Hospital, and Klinikum Rechts Der Isar, Mü nich, Germany Peripheral Blood Mononuclear Cells from CRC patient and healthy donors This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Amresco N/A Collagenase D Merck Cat#11088882001 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 DNase I Merck Cat#10104159001 Fetal bovine serum (FBS) Gibco (Thermo Fisher) Cat#10270-106 Fluoromount-GTM Mounting Medium Thermo Fisher Scientific (Invitrogen) Cat#00-4958-02 GlutaMAX Gibco (Thermo Fisher) Cat#35050-061 Growth Factor Reduced Matrigel Corning Costar N/A Hoechst 33342 Thermo Fisher Scientific Cat#62249 Human serum Sigma-Aldrich Cat#H4522 Human Siglec-5-Fc chimera R&D Cat#1072-SL Human Siglec-14-Fc chimera R&D Cat#4905-SL Hyaluronidase type I Sigma-Aldrich Cat#H3506 Kanamycin sulfate Gibco (Thermo Fisher) Cat#15160-047 Ketamine Streuli Pharma AG N/A Lysozyme Sigma-Aldrich Cat#L6876 Paraformaldehyde (PFA) Sigma-Aldrich Cat#158127 PEI PrimeTM linear polyethylenimine Sigma-Aldrich Cat#919012 Phenol (aqueous) Sigma-Aldrich N/A Phosphate-buffered saline (PBS) Gibco (Thermo Fisher) Cat#14190-144 PMA (phorbol 12-myristate 13-acetate) Sigma-Aldrich Cat#P8139 p-Nitrophenyl phosphate (pNPP) Sigma-Aldrich Cat#36199-67-4 Polybrene Sigma-Aldrich Cat#H9268 Poly-L-lysine Sigma-Aldrich Cat#P8920 Proteinase K (molecular biology grade) Thermo Scientific Cat#EO0491 Protein Bloking Buffer Dako Cat#X0909 (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Origene Cat#RC206610L4 Human SIGLEC14 ORF clone (mGFP-tagged) Origene Cat#RC224202L4 pCMV-dR8.2 Addgene Cat #8455 pVSV-G Addgene Cat#138479 Software and algorithms Adobe Illustrator 27.4 Adobe RRID: SCR_010279 cBioPortal https://www.cbioportal.org N/A CellSense Microscope Imaging Software Olympus N/A clusterProfiler (v4.6.2) Bioconductor RRID:SCR_016884 DoubletFinder (v2.0.6) GitHub RRID:SCR_018301 FACS Diva Software BD Biosciences RRID: SCR_001456 FACS Symphony A5 Cell Analyzer BD Biosciences RRID: SCR_022674 FlowJo v10 + Downsample v3.0.0 + UMAP v2.2 + XShift/Cluster Explorer FlowJo LLC RRID: SCR_008520 GraphPad Prism v8.3.1 GraphPad RRID:SCR_002798 Human Protein Atlas (v23) https://www.proteinatlas.org N/A ImageJ NIH RRID:SCR_003070 ImageJ (FiJi) https://imagej.net/Fiji RRID:SCR_002285 Leiden algorithm Seurat / R N/A MAPS software FEI / Thermo Fisher Scientific N/A PCA Seurat / R RRID:SCR_016341; https://satijalab.org/seurat R (v4.4.3) The R Project RRID:SCR_001905 Seurat (v5.3) Satija Lab / CRAN RRID:SCR_016341 Seurat R package v5.1.0 CRAN/Bioconductor RRID:SCR_016341; https://satijalab.org/seurat (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e4 ..
Imaging:Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer.
Article Snippet: N/A Biological samples Human Colon Rectal Cancer tissue samples and corresponding adjacent tumor-free tissues This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona, Switzerland;University Basel Hospital, and Klinikum Rechts Der Isar, Mü nich, Germany Peripheral Blood Mononuclear Cells from CRC patient and healthy donors This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Amresco N/A Collagenase D Merck Cat#11088882001 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 DNase I Merck Cat#10104159001 Fetal bovine serum (FBS) Gibco (Thermo Fisher) Cat#10270-106 Fluoromount-GTM Mounting Medium Thermo Fisher Scientific (Invitrogen) Cat#00-4958-02 GlutaMAX Gibco (Thermo Fisher) Cat#35050-061 Growth Factor Reduced Matrigel Corning Costar N/A Hoechst 33342 Thermo Fisher Scientific Cat#62249 Human serum Sigma-Aldrich Cat#H4522 Human Siglec-5-Fc chimera R&D Cat#1072-SL Human Siglec-14-Fc chimera R&D Cat#4905-SL Hyaluronidase type I Sigma-Aldrich Cat#H3506 Kanamycin sulfate Gibco (Thermo Fisher) Cat#15160-047 Ketamine Streuli Pharma AG N/A Lysozyme Sigma-Aldrich Cat#L6876 Paraformaldehyde (PFA) Sigma-Aldrich Cat#158127 PEI PrimeTM linear polyethylenimine Sigma-Aldrich Cat#919012 Phenol (aqueous) Sigma-Aldrich N/A Phosphate-buffered saline (PBS) Gibco (Thermo Fisher) Cat#14190-144 PMA (phorbol 12-myristate 13-acetate) Sigma-Aldrich Cat#P8139 p-Nitrophenyl phosphate (pNPP) Sigma-Aldrich Cat#36199-67-4 Polybrene Sigma-Aldrich Cat#H9268 Poly-L-lysine Sigma-Aldrich Cat#P8920 Proteinase K (molecular biology grade) Thermo Scientific Cat#EO0491 Protein Bloking Buffer Dako Cat#X0909 (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Origene Cat#RC206610L4 Human SIGLEC14 ORF clone (mGFP-tagged) Origene Cat#RC224202L4 pCMV-dR8.2 Addgene Cat #8455 pVSV-G Addgene Cat#138479 Software and algorithms Adobe Illustrator 27.4 Adobe RRID: SCR_010279 cBioPortal https://www.cbioportal.org N/A CellSense Microscope Imaging Software Olympus N/A clusterProfiler (v4.6.2) Bioconductor RRID:SCR_016884 DoubletFinder (v2.0.6) GitHub RRID:SCR_018301 FACS Diva Software BD Biosciences RRID: SCR_001456 FACS Symphony A5 Cell Analyzer BD Biosciences RRID: SCR_022674 FlowJo v10 + Downsample v3.0.0 + UMAP v2.2 + XShift/Cluster Explorer FlowJo LLC RRID: SCR_008520 GraphPad Prism v8.3.1 GraphPad RRID:SCR_002798 Human Protein Atlas (v23) https://www.proteinatlas.org N/A ImageJ NIH RRID:SCR_003070 ImageJ (FiJi) https://imagej.net/Fiji RRID:SCR_002285 Leiden algorithm Seurat / R N/A MAPS software FEI / Thermo Fisher Scientific N/A PCA Seurat / R RRID:SCR_016341; https://satijalab.org/seurat R (v4.4.3) The R Project RRID:SCR_001905 Seurat (v5.3) Satija Lab / CRAN RRID:SCR_016341 Seurat R package v5.1.0 CRAN/Bioconductor RRID:SCR_016341; https://satijalab.org/seurat (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e4 ..
FACS:Article Title: Intratumoral microbiota and host genotype cooperatively shape neutrophil cytotoxic functions in colorectal cancer.
Article Snippet: N/A Biological samples Human Colon Rectal Cancer tissue samples and corresponding adjacent tumor-free tissues This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona, Switzerland;University Basel Hospital, and Klinikum Rechts Der Isar, Mü nich, Germany Peripheral Blood Mononuclear Cells from CRC patient and healthy donors This manuscript University Basel Hospital, Basel; Ente Ospedaliero Cantonale (EOC), Lugano and Bellinzona Chemicals, peptides, and recombinant proteins Ampicillin sodium salt Amresco N/A Collagenase D Merck Cat#11088882001 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D8418 DNase I Merck Cat#10104159001 Fetal bovine serum (FBS) Gibco (Thermo Fisher) Cat#10270-106 Fluoromount-GTM Mounting Medium Thermo Fisher Scientific (Invitrogen) Cat#00-4958-02 GlutaMAX Gibco (Thermo Fisher) Cat#35050-061 Growth Factor Reduced Matrigel Corning Costar N/A Hoechst 33342 Thermo Fisher Scientific Cat#62249 Human serum Sigma-Aldrich Cat#H4522 Human Siglec-5-Fc chimera R&D Cat#1072-SL Human Siglec-14-Fc chimera R&D Cat#4905-SL Hyaluronidase type I Sigma-Aldrich Cat#H3506 Kanamycin sulfate Gibco (Thermo Fisher) Cat#15160-047 Ketamine Streuli Pharma AG N/A Lysozyme Sigma-Aldrich Cat#L6876 Paraformaldehyde (PFA) Sigma-Aldrich Cat#158127 PEI PrimeTM linear polyethylenimine Sigma-Aldrich Cat#919012 Phenol (aqueous) Sigma-Aldrich N/A Phosphate-buffered saline (PBS) Gibco (Thermo Fisher) Cat#14190-144 PMA (phorbol 12-myristate 13-acetate) Sigma-Aldrich Cat#P8139 p-Nitrophenyl phosphate (pNPP) Sigma-Aldrich Cat#36199-67-4 Polybrene Sigma-Aldrich Cat#H9268 Poly-L-lysine Sigma-Aldrich Cat#P8920 Proteinase K (molecular biology grade) Thermo Scientific Cat#EO0491 Protein Bloking Buffer Dako Cat#X0909 (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mice strain: NOD-rag-gamma-deficient (NRG) mice NOD.Cg-Rag1tm1Mom Il2rgtm1Wjl/ SzJ, Charles River, Italy) N/A Oligonucleotides Universal bacterial 16S rRNA gene primers; FW- TCCTACGGGAGGCAGCAGT; RWGGACTACCAGGGTATCTAATCCTGTT Microsynth N/A Fusobacterium nucleatum 16s rRNA gene primers; FW- GCCTCACAGCTAGGGACAAC; RWGAGTAAGGGCCGTGTCTCAG Microsynth N/A CXCL1 (human primers): Hs00236937_m1 Applied Biosystems Cat#4331182 CXCL2 (human primers): Hs00236966_m1 Applied Biosystems Cat# 4331182 CXCL5 (human primers): Hs00171085_m1 Applied Biosystems Cat# 4331182 CXL8 (human primers): Hs00174103_m1 Applied Biosystems Cat# 4331182 CD66b (human primers); FW- 5 ′ -TCAAAGCATTTGCAATCAGC-3 ′ ; RW- 5 ′ -GTGGGCAACTTCACAAAGGT-3 ′ Microsynth N/A GAPDH (human primers): Hs02786624_g1 Applied Biosystems Cat#4331182 SIGLEC-14 (human primers); FW: 5 ′ -AGGATTTATTCTCCCATCTCGCT-3 ′ ; RW: 5 ′ -GATGCTGATGGCGAGGTTCTG-3 ′ Sigma-Aldrich N/A SIGLEC-5 (human primers); FW: 5 ′ -GTGGTTCTGACATCTCACCTCATC-3 ′ ; RW: 5 ′ -CCTGAAGATGGTGATGGTCTG-3 ′ Sigma-Aldrich N/A Recombinant DNA pLenti-C-mGFP-P2A-Puro Origene Cat#PS100093 Human SIGLEC5 ORF clone (mGFP-tagged) Origene Cat#RC206610L4 Human SIGLEC14 ORF clone (mGFP-tagged) Origene Cat#RC224202L4 pCMV-dR8.2 Addgene Cat #8455 pVSV-G Addgene Cat#138479 Software and algorithms Adobe Illustrator 27.4 Adobe RRID: SCR_010279 cBioPortal https://www.cbioportal.org N/A CellSense Microscope Imaging Software Olympus N/A clusterProfiler (v4.6.2) Bioconductor RRID:SCR_016884 DoubletFinder (v2.0.6) GitHub RRID:SCR_018301 FACS Diva Software BD Biosciences RRID: SCR_001456 FACS Symphony A5 Cell Analyzer BD Biosciences RRID: SCR_022674 FlowJo v10 + Downsample v3.0.0 + UMAP v2.2 + XShift/Cluster Explorer FlowJo LLC RRID: SCR_008520 GraphPad Prism v8.3.1 GraphPad RRID:SCR_002798 Human Protein Atlas (v23) https://www.proteinatlas.org N/A ImageJ NIH RRID:SCR_003070 ImageJ (FiJi) https://imagej.net/Fiji RRID:SCR_002285 Leiden algorithm Seurat / R N/A MAPS software FEI / Thermo Fisher Scientific N/A PCA Seurat / R RRID:SCR_016341; https://satijalab.org/seurat R (v4.4.3) The R Project RRID:SCR_001905 Seurat (v5.3) Satija Lab / CRAN RRID:SCR_016341 Seurat R package v5.1.0 CRAN/Bioconductor RRID:SCR_016341; https://satijalab.org/seurat (Continued on next page) Cell Host & Microbe 34, 425–443.e1–e11, March 11, 2026 e4 ..
other:Article Title: IRG1/itaconate rewires macrophage and lung tumor metabolism through G6PD inhibition.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies information listed in Table S3 This study N/A Chemicals, peptides, and recombinant proteins Octyl itaconate (Octyl Ita) Cayman Cat# 25374 Itaconate (itaconic acid) Sigma Cat# 129204 LPS Sigma Cat# L5418 IFNγ R and D Systems Cat# 285-IF IL-4 R and D Systems Cat# 204-IL M-CSF R and D Systems Cat# 416-ML N-acetyl cysteine (NAC) Sigma Cat# A9165 6-phosphogluconate (6GP) Sigma Cat# P7877 D-ribose (DR) Sigma Cat# R9629 Ribose-5-phosphate (R5P) Sigma Cat# R7750 2-hydroxypropyl-β-cyclodextrin Sigma Cat# H107 Recombinant human G6PD Abcam Cat# ab167987 ITalk probe Chomix Biotech Cat# CMX210035 Cycloheximide Sigma-Aldrich Cat# C4859 [1,2-13C2]-glucose Sigma Cat# 453188 1,5-diaminonaphthalene (DAN) Merc Cat# 56451 HiPerFect Qiagen Cat# 371707 Critical commercial assays LookOut Mycoplasma PCR Detection Kit Merck MP0040A RNeasy Mini Kit Qiagen Cat# 74104 miRNeasy Micro Kit Qiagen Cat# 217084 High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814 SYBR Green PCR Master Mix Applied Biosystems Cat# A25742 BrdU proliferation assay kit Roche Cat# 11647229001 Cell Death Detection ELISA kit Roche Cat# 11920685001 Tumor Dissociation Kit Miltenyi Biotec Cat# 130-095-929 CD68-PE antibody (MACS) Miltenyi Biotec Cat# 130-096-807 Anti-PE MicroBeads Miltenyi Biotec Cat# 130-048-801 GSH/GSSG-Glo assay Promega Cat# V6611 Deposited data RNA-seq NCBI GEO GSE256045 Experimental models: Cell lines
|
