Review




Structured Review

Proteintech anti rfc3
Anti Rfc3, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/RFC3+Antibody/pmc11322876-149-38-40
Average 92 stars, based on 5 article reviews
anti rfc3 - by Bioz Stars, 2026-10
92/100 stars

Images

Related Articles

Control:

Article Title: MiR-133a-3p overexpression-induced elevation of cisplatin-mediated chemosensitivity to non-small cell lung cancer by targeting replication factor C3
Article Snippet: Investigated the role of miR-133a-3p expression in NSCLC resistance to cisplatin (DDP) treatment and elucidate the possible mechanisms.. MiR-133a-3p expression levels in DDP-resistant cells (SPC-1/DPP and A549/DDP) were measured using quantitative reverse-transcription polymerase chain reaction.. Cell proliferation, cell apoptosis, cell cycle distribution, and DDP sensitivity were detected through flow cytometry, Cell Counting Kit-8 (CCK-8) and western blot analysis.

Recombinant:

Article Title: Cyclin N-Terminal Domain-Containing-1 Coordinates Meiotic Crossover Formation with Cell-Cycle Progression in a Cyclin-Independent Manner
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CDC34 Proteintech Cat# 10964-2-AP; RRID: AB_2077925 CDK1 Millipore Cat# MAB8878; RRID: AB_2074771 CDK1-pY15 Abcam Cat# ab47594; RRID: AB_869073 CDK2 Santa Cruz Cat# sc-163; RRID: AB_631215 CDK2-pY15 Abcam Cat# ab76146; RRID: AB_1310069 CDK4 Cell Signaling Cat# 12790S; RRID: AB_2631166 Cyclin B1 Cell Signaling Cat# 4138S; RRID: AB_2072132 GAPDH Invitrogen Cat# MA5-15738-HRP; RRID: AB_2537659 HA (Rabbit) Cell Signaling Cat# 3724S; RRID: AB_1549585 HA (Rat) Roche Cat# 11867423001; RRID: AB_390918 HEI10 Abcam Cat# ab71977; RRID: AB_1310045 MLH1 BD Biosciences Cat# 550838; RRID: AB_2297859 MLH3 Custom made (Holloway et al., 2008) N/A MAD2L2 Proteintech Cat# 12683-1-AP; RRID: AB_2139530 Pan CDK p-Y15 Abcam Cat# ab133463; RRID: AB_2811262 PCNA Proteintech Cat# 10205-2-AP; RRID: AB_2160330 RAD51 Millipore Cat# PC130-100UL; RRID: AB_569857 RFC3 Proteintech Cat# 11814-1-AP; RRID: AB_2178470 RFC4 Proteintech Cat# 10806-1-AP; RRID: AB_2178477 RNF212 Novus Cat# NBP1-83471; RRID: AB_11030667 SYCP1 Abcam aCat# b15090; RRID: AB_301636 SYCP3 Custom made (Kolas et al., 2005) N/A WEE1 Novus Cat# NBP1-33506; RRID: AB_2215876 gH2AFX Millipore Cat# 05-636; RRID: AB_309864 Chemicals, Peptides, and Recombinant Proteins Adavosertib MedChemExpress Cat# HY-10993 Nocodazole Sigma Aldrich Cat# SML1665-1ML Experimental Models: Organisms/Strains M. musculus C57BL/6J The Jackson Laboratory 000664 S. cerevisiae Y2H Gold Takarabio 630498 Oligonucleotides CNTD1-FH crRNA: ccgcuuccucuaacacguga This Paper N/A CNTD1-FH HDR Donor: cctgggccacag cagcctgttccccacaaggcagccagagctctga ggactgctgccgctgccgcttcctctaacacg GACTACAAAGACGATGACGACAAGcttT ACCCATACGATGTTCCAGATTACGCTt gagggtggctgacccgcactgccttgtcactgg acctctttccttgtttacttttatactcaggg This Paper N/A CNTD1-FH Sequencing Primer, Forward: gcgcacgagtgtttgtgcact This Paper N/A CNTD1-FH Sequencing Primer, Reverse: ccagtgacaaggcagtgcgggtcagcc This Paper N/A (Continued on next page) Cell Reports 32, 107858, July 7, 2020 e1 Article ll OPEN ACCESS ..

Sequencing:

Article Title: Cyclin N-Terminal Domain-Containing-1 Coordinates Meiotic Crossover Formation with Cell-Cycle Progression in a Cyclin-Independent Manner
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies CDC34 Proteintech Cat# 10964-2-AP; RRID: AB_2077925 CDK1 Millipore Cat# MAB8878; RRID: AB_2074771 CDK1-pY15 Abcam Cat# ab47594; RRID: AB_869073 CDK2 Santa Cruz Cat# sc-163; RRID: AB_631215 CDK2-pY15 Abcam Cat# ab76146; RRID: AB_1310069 CDK4 Cell Signaling Cat# 12790S; RRID: AB_2631166 Cyclin B1 Cell Signaling Cat# 4138S; RRID: AB_2072132 GAPDH Invitrogen Cat# MA5-15738-HRP; RRID: AB_2537659 HA (Rabbit) Cell Signaling Cat# 3724S; RRID: AB_1549585 HA (Rat) Roche Cat# 11867423001; RRID: AB_390918 HEI10 Abcam Cat# ab71977; RRID: AB_1310045 MLH1 BD Biosciences Cat# 550838; RRID: AB_2297859 MLH3 Custom made (Holloway et al., 2008) N/A MAD2L2 Proteintech Cat# 12683-1-AP; RRID: AB_2139530 Pan CDK p-Y15 Abcam Cat# ab133463; RRID: AB_2811262 PCNA Proteintech Cat# 10205-2-AP; RRID: AB_2160330 RAD51 Millipore Cat# PC130-100UL; RRID: AB_569857 RFC3 Proteintech Cat# 11814-1-AP; RRID: AB_2178470 RFC4 Proteintech Cat# 10806-1-AP; RRID: AB_2178477 RNF212 Novus Cat# NBP1-83471; RRID: AB_11030667 SYCP1 Abcam aCat# b15090; RRID: AB_301636 SYCP3 Custom made (Kolas et al., 2005) N/A WEE1 Novus Cat# NBP1-33506; RRID: AB_2215876 gH2AFX Millipore Cat# 05-636; RRID: AB_309864 Chemicals, Peptides, and Recombinant Proteins Adavosertib MedChemExpress Cat# HY-10993 Nocodazole Sigma Aldrich Cat# SML1665-1ML Experimental Models: Organisms/Strains M. musculus C57BL/6J The Jackson Laboratory 000664 S. cerevisiae Y2H Gold Takarabio 630498 Oligonucleotides CNTD1-FH crRNA: ccgcuuccucuaacacguga This Paper N/A CNTD1-FH HDR Donor: cctgggccacag cagcctgttccccacaaggcagccagagctctga ggactgctgccgctgccgcttcctctaacacg GACTACAAAGACGATGACGACAAGcttT ACCCATACGATGTTCCAGATTACGCTt gagggtggctgacccgcactgccttgtcactgg acctctttccttgtttacttttatactcaggg This Paper N/A CNTD1-FH Sequencing Primer, Forward: gcgcacgagtgtttgtgcact This Paper N/A CNTD1-FH Sequencing Primer, Reverse: ccagtgacaaggcagtgcgggtcagcc This Paper N/A (Continued on next page) Cell Reports 32, 107858, July 7, 2020 e1 Article ll OPEN ACCESS ..

Negative Control:

Article Title: RFC3 drives the proliferation, migration, invasion and angiogenesis of colorectal cancer cells by binding KIF14.
Article Snippet: Briefly, SW620 cells were lysed on ice for 30 min in radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology). .. Next, 2 μg RFC3 (cat. no. 11814‐1‐AP; Proteintech Group, Inc.), KIF14 (cat. no. ab71155; Abcam) or goat anti‐rabbit IgG (the negative control; cat. no. ab172730; Abcam) antibodies were added to 500 μg SW620 cell lysates and incubated over‐ night at 4 ̊C. .. Subsequently, 50 μg protein A magnetic beads (cat. no. #sc‐2003; Santa Cruz Biotechnology, Inc.) were added for capturing the complexes of RFC3 and KIF14.

Article Title: RFC3 drives the proliferation, migration, invasion and angiogenesis of colorectal cancer cells by binding KIF14
Article Snippet: Briefly, SW620 cells were lysed on ice for 30 min in radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology). .. Next, 2 μg RFC3 (cat. no. 11814-1-AP; Proteintech Group, Inc.), KIF14 (cat. no. ab71155; Abcam) or goat anti-rabbit IgG (the negative control; cat. no. ab172730; Abcam) antibodies were added to 500 μg SW620 cell lysates and incubated overnight at 4 ̊C. .. Subsequently, 50 μg protein A magnetic beads (cat. no. #sc-2003; Santa Cruz Biotechnology, Inc.) were added for capturing the complexes of RFC3 and KIF14.

Incubation:

Article Title: RFC3 drives the proliferation, migration, invasion and angiogenesis of colorectal cancer cells by binding KIF14.
Article Snippet: Briefly, SW620 cells were lysed on ice for 30 min in radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology). .. Next, 2 μg RFC3 (cat. no. 11814‐1‐AP; Proteintech Group, Inc.), KIF14 (cat. no. ab71155; Abcam) or goat anti‐rabbit IgG (the negative control; cat. no. ab172730; Abcam) antibodies were added to 500 μg SW620 cell lysates and incubated over‐ night at 4 ̊C. .. Subsequently, 50 μg protein A magnetic beads (cat. no. #sc‐2003; Santa Cruz Biotechnology, Inc.) were added for capturing the complexes of RFC3 and KIF14.

Article Title: RFC3 drives the proliferation, migration, invasion and angiogenesis of colorectal cancer cells by binding KIF14
Article Snippet: Briefly, SW620 cells were lysed on ice for 30 min in radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology). .. Next, 2 μg RFC3 (cat. no. 11814-1-AP; Proteintech Group, Inc.), KIF14 (cat. no. ab71155; Abcam) or goat anti-rabbit IgG (the negative control; cat. no. ab172730; Abcam) antibodies were added to 500 μg SW620 cell lysates and incubated overnight at 4 ̊C. .. Subsequently, 50 μg protein A magnetic beads (cat. no. #sc-2003; Santa Cruz Biotechnology, Inc.) were added for capturing the complexes of RFC3 and KIF14.

other:




Similar Products

99
ATCC replication
Replication, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/hTERT+RPE-1/pmc13209694-183-22-37
Average 99 stars, based on 1 article reviews
replication - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

94
MedChemExpress replication
Replication, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/Sulindac/pm42210694-57-20-25
Average 94 stars, based on 1 article reviews
replication - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

86
Sawai Pharmaceutical oitv replicates
Oitv Replicates, supplied by Sawai Pharmaceutical, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/oitv+replicates/pm42309469-198-0-20
Average 86 stars, based on 1 article reviews
oitv replicates - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Moderna conventional non replicating mrna based therapeutics
Conventional Non Replicating Mrna Based Therapeutics, supplied by Moderna, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/messenger+mrna+rna+vaccines/pmc13264025-10-0-14
Average 86 stars, based on 1 article reviews
conventional non replicating mrna based therapeutics - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Hasegawa Co Ltd replication evidence
Replication Evidence, supplied by Hasegawa Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/evidence+replication+structural/pmc13260784-159-24-15
Average 86 stars, based on 1 article reviews
replication evidence - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Mendeley Ltd replication codes
Replication Codes, supplied by Mendeley Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/codes+replication/pm42269350-519-0-4
Average 86 stars, based on 1 article reviews
replication codes - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Boekel Scientific 96 pin replicator
96 Pin Replicator, supplied by Boekel Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/96+pin+replicator/10__3390_slash_ddc5020036-156-14-16
Average 86 stars, based on 1 article reviews
96 pin replicator - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Bavarian Nordic replication
Replication, supplied by Bavarian Nordic, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/incompetent+replication/10__1016_slash_s1473___3099_ascii40_26_ascii41_00177___5-33-5-8
Average 86 stars, based on 1 article reviews
replication - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Taxon Biosciences pcr replicates
Pcr Replicates, supplied by Taxon Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/pcr+replicates/10__21425_slash_fob__19__175973-163-9-0
Average 86 stars, based on 1 article reviews
pcr replicates - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Epoch Life Signs Inc transient denv replication assay mutant subgenomic denv reporter replicons sgdvs rluc
Transient Denv Replication Assay Mutant Subgenomic Denv Reporter Replicons Sgdvs Rluc, supplied by Epoch Life Signs Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/replication/assay+denv+denv+mutant+replication+replicons+reporter+rluc+sgdvs+subgenomic+transient/pm42085491-395-0-20
Average 86 stars, based on 1 article reviews
transient denv replication assay mutant subgenomic denv reporter replicons sgdvs rluc - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

Image Search Results