Review



hg19 refseq q coding regions for the 523 genes  (Illumina Inc)


Bioz Verified Symbol Illumina Inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Illumina Inc hg19 refseq q coding regions for the 523 genes
    Hg19 Refseq Q Coding Regions For The 523 Genes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/hg19+reference+genome/pm39894076-65-8-25
    Average 90 stars, based on 1 article reviews
    hg19 refseq q coding regions for the 523 genes - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Dysregulation of heterochromatin caused by genomic structural variants may be central to autism spectrum disorder
    Article Snippet: Both studies used the Illumina 1Mv1 SNP array, resulting in 1,048,847 nuclear SNP calls for MIAMI and 1,072,657 for AGPC.

    Article Title: Nonrecurrent Triplication of 5q21.3q23.3: A Case Report and Review of the Literature.
    Article Snippet: Triplications involving 5q21.3q23.3 are rare, and a phenotype has not been established.. Here, we present a 4monthold male with dysmorphic facial features and congenital cardiac malformation.. Chromosomal microarray identified a pathogenic triplication of 5q21.3q23.3 with chromosome analysis showing the extra 5q material inserted into 16q.

    Article Title: Method for the diagnosis and/or prognosis of cancer of the biliary tract
    Article Snippet: [38] Triche J T. FDb.InfiniumMethylation.hg19: Annotation package for Illumina Infinium DNA methylation probes.

    Methylation:

    Article Title: KZFP-mediated variable DNA methylation of a primate-specific transposon is linked to type I diabetes in humans
    Article Snippet: .. Genomic coordinates in supplementary tables pertaining to GoDMC and ENID mQTL use the hg19 reference as this is used for annotations in the Illumina 450k methylation and H3Africa genotyping array manifests and by the GoDMC mQTL database ( http://mqtldb.godmc.org.uk/ ). ..

    Sequencing:

    Article Title: ZNF512B binds RBBP4 via a variant NuRD interaction motif and aggregates chromatin in a NuRD complex-independent manner
    Article Snippet: .. Alignment of the trimmed sequencing reads to the hg19 reference genome (downloaded from Illumina’s iGenomes) was performed using Hisat2 v.2.2.1 with ‘–min-intronlen 30 –max-intronlen 3000′′ parameters ( ) and stored as binary alignment maps (BAM). ..

    Article Title: Mechanistic basis of atypical TERT promoter mutations
    Article Snippet: .. Supplementary Table 6 Gene Position hg19 Forward 5 ́- 3 ́ Reverse 5 ́- 3 ́ Amplicon TERT chr5:1295152-1295311 AGCGCTGCCTGAAACTCG CCTGCCCCTTCACCTTCCAG 160 bp Primer Sequence 5 ́- 3 ́ TERT Fwd with barcode GGACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNATGGGAAAGA GTGTCCAGCGCTGCCTGAAACTCG TERT Rev GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTGCCCCTTCACCTTCCAG Illumina Fwd AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Rev with index CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCT TCCGATCT Supplementary Table 6. ..

    Blocking Assay:

    Article Title: Clinical Validation of the TruSight Oncology 500 Assay for the Detection and Reporting of Pan-Cancer Biomarkers.
    Article Snippet: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 jmdjournal.org 63 64 65 66 67 68 69 70 71 72 73 74 Clinical Validation of the TruSight Oncology 75 76 500 Assay for the Detection and Reporting of 77 78 79 80 81 82 83 84 Pan-Cancer Biomarkers Hussam Al-Kateb,* Shannon M. Knight,* Gopinath Sivasankaran,y Jesse S. Voss,* Beth A. Pitel,* Joseph H. Blommel,* Calvin R. Jerde,* Kandeleria M. Rumilla,* Jodi L. Lee,* Nate R. Mattson,* Kim P. Lauer,y Eric A. Zimmerman Zuckerman,* Chris D. Hofich,* Dragana Milosevic,* Joe Thompson,* Lori S. Tillmans,* Tony T. Stai,* Surendra Dasari,y Amber L. Pryzbylski,* Lisa G. Mullineaux,* Cris M. Ida,* Robert B. Jenkins,* Sounak Gupta,* Benjamin R. Kipp,* and Kevin C. Halling* 85 86 87 From the Departments of Laboratory Medicine and Pathology* and Quantitative Health Sciences, y Mayo Clinic, Rochester, Minnesota

    Amplification:

    Article Title: Mechanistic basis of atypical TERT promoter mutations
    Article Snippet: .. Supplementary Table 6 Gene Position hg19 Forward 5 ́- 3 ́ Reverse 5 ́- 3 ́ Amplicon TERT chr5:1295152-1295311 AGCGCTGCCTGAAACTCG CCTGCCCCTTCACCTTCCAG 160 bp Primer Sequence 5 ́- 3 ́ TERT Fwd with barcode GGACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNATGGGAAAGA GTGTCCAGCGCTGCCTGAAACTCG TERT Rev GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTGCCCCTTCACCTTCCAG Illumina Fwd AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT Illumina Rev with index CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCT TCCGATCT Supplementary Table 6. ..



    Similar Products

    93
    Sino Biological refseq nm 002139 3
    Refseq Nm 002139 3, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/Human+RBMX+Gene+ORF+cDNA+clone+expression+plasmid/med_rxiv__2025__10__17__25337589-220-9-14
    Average 93 stars, based on 1 article reviews
    refseq nm 002139 3 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Biotechnology Information national center for biotechnology information refseq gene annotation
    National Center For Biotechnology Information Refseq Gene Annotation, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/refseq+genes/pmc11386081__12931_2024_2955_MOESM1_ESM-27-34-32
    Average 90 stars, based on 1 article reviews
    national center for biotechnology information refseq gene annotation - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation bugz gene (human, ncbi refseq: nm_001032293.3) encoding wild-type bugz
    ( A ) Volcano plot showing quantitative mass-spectrometry results. Dashed horizontal line shows the p -value cut-off ( p < 0.05) and vertical dashed lines indicate the upregulated/downregulated (competed/non-competed by free PTL) proteins. The green transparent region groups all the proteins that satisfy the p -value cut-off and are upregulated (competed) with a SILAC ratio higher than 2. N (number of experiments): 3. Statistical analysis was performed using unpaired t-test. ( B ) Representative spinning disk confocal time-series of mitosis in HeLa parental cells and HeLa stably expressing <t>GFP-BUGZ</t> undergoing indicated treatments. Scale bar: 10 µm. ( C ) Quantification of chromosome congression status and mitotic duration in HeLa parental cells and HeLa stably expressing GFP-BUGZ undergoing indicated treatments. Median is plotted for mitotic duration. N , n ( N = number of cells, n = number of experiments) for congression phenotype: HeLa + DMSO (44, 3), HeLa + 15 µM PTL (41, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3); N , n ( N = number of cells, n = number of experiments) for mitotic duration: HeLa + DMSO (40, 3), HeLa + 15 µM PTL (36, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3). .
    Bugz Gene (Human, Ncbi Refseq: Nm 001032293.3) Encoding Wild Type Bugz, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/bugz+gene++human++ncbi+refseq++nm+001032293+3++encoding+wild+type+bugz/pmc12219771-369-9-17
    Average 90 stars, based on 1 article reviews
    bugz gene (human, ncbi refseq: nm_001032293.3) encoding wild-type bugz - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology refseq gene annotation files
    ( A ) Volcano plot showing quantitative mass-spectrometry results. Dashed horizontal line shows the p -value cut-off ( p < 0.05) and vertical dashed lines indicate the upregulated/downregulated (competed/non-competed by free PTL) proteins. The green transparent region groups all the proteins that satisfy the p -value cut-off and are upregulated (competed) with a SILAC ratio higher than 2. N (number of experiments): 3. Statistical analysis was performed using unpaired t-test. ( B ) Representative spinning disk confocal time-series of mitosis in HeLa parental cells and HeLa stably expressing <t>GFP-BUGZ</t> undergoing indicated treatments. Scale bar: 10 µm. ( C ) Quantification of chromosome congression status and mitotic duration in HeLa parental cells and HeLa stably expressing GFP-BUGZ undergoing indicated treatments. Median is plotted for mitotic duration. N , n ( N = number of cells, n = number of experiments) for congression phenotype: HeLa + DMSO (44, 3), HeLa + 15 µM PTL (41, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3); N , n ( N = number of cells, n = number of experiments) for mitotic duration: HeLa + DMSO (40, 3), HeLa + 15 µM PTL (36, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3). .
    Refseq Gene Annotation Files, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/refseq+genes/pm40278833-423-2-15
    Average 90 stars, based on 1 article reviews
    refseq gene annotation files - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology refseq gene annotation files g6pc
    METTL14 cell‐autonomously increases <t>G6pc</t> levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).
    Refseq Gene Annotation Files G6pc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/anti+g6pase/pmc12165098-323-8-16
    Average 90 stars, based on 1 article reviews
    refseq gene annotation files g6pc - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc hg19 refseq q coding regions for the 523 genes
    METTL14 cell‐autonomously increases <t>G6pc</t> levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).
    Hg19 Refseq Q Coding Regions For The 523 Genes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/hg19+reference+genome/pm39894076-65-8-25
    Average 90 stars, based on 1 article reviews
    hg19 refseq q coding regions for the 523 genes - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    97
    ATCC gene reference species antigen protein refseq
    METTL14 cell‐autonomously increases <t>G6pc</t> levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).
    Gene Reference Species Antigen Protein Refseq, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/Antigen/us12168046-402-2-19
    Average 97 stars, based on 1 article reviews
    gene reference species antigen protein refseq - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    90
    Biotechnology Information reference sequence (refseq) genes
    METTL14 cell‐autonomously increases <t>G6pc</t> levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).
    Reference Sequence (Refseq) Genes, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/refseq+genes/pmc11470249__mmc1-101-65-60
    Average 90 stars, based on 1 article reviews
    reference sequence (refseq) genes - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Biotechnology Information ncbi refseq gene map for grch37
    METTL14 cell‐autonomously increases <t>G6pc</t> levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).
    Ncbi Refseq Gene Map For Grch37, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/refseq+genes/sequence+read+archive/pmc11250262-257-32-30
    Average 90 stars, based on 1 article reviews
    ncbi refseq gene map for grch37 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Volcano plot showing quantitative mass-spectrometry results. Dashed horizontal line shows the p -value cut-off ( p < 0.05) and vertical dashed lines indicate the upregulated/downregulated (competed/non-competed by free PTL) proteins. The green transparent region groups all the proteins that satisfy the p -value cut-off and are upregulated (competed) with a SILAC ratio higher than 2. N (number of experiments): 3. Statistical analysis was performed using unpaired t-test. ( B ) Representative spinning disk confocal time-series of mitosis in HeLa parental cells and HeLa stably expressing GFP-BUGZ undergoing indicated treatments. Scale bar: 10 µm. ( C ) Quantification of chromosome congression status and mitotic duration in HeLa parental cells and HeLa stably expressing GFP-BUGZ undergoing indicated treatments. Median is plotted for mitotic duration. N , n ( N = number of cells, n = number of experiments) for congression phenotype: HeLa + DMSO (44, 3), HeLa + 15 µM PTL (41, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3); N , n ( N = number of cells, n = number of experiments) for mitotic duration: HeLa + DMSO (40, 3), HeLa + 15 µM PTL (36, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3). .

    Journal: The EMBO Journal

    Article Title: Parthenolide disrupts mitosis by inhibiting ZNF207/BUGZ-promoted kinetochore-microtubule attachment

    doi: 10.1038/s44318-025-00469-2

    Figure Lengend Snippet: ( A ) Volcano plot showing quantitative mass-spectrometry results. Dashed horizontal line shows the p -value cut-off ( p < 0.05) and vertical dashed lines indicate the upregulated/downregulated (competed/non-competed by free PTL) proteins. The green transparent region groups all the proteins that satisfy the p -value cut-off and are upregulated (competed) with a SILAC ratio higher than 2. N (number of experiments): 3. Statistical analysis was performed using unpaired t-test. ( B ) Representative spinning disk confocal time-series of mitosis in HeLa parental cells and HeLa stably expressing GFP-BUGZ undergoing indicated treatments. Scale bar: 10 µm. ( C ) Quantification of chromosome congression status and mitotic duration in HeLa parental cells and HeLa stably expressing GFP-BUGZ undergoing indicated treatments. Median is plotted for mitotic duration. N , n ( N = number of cells, n = number of experiments) for congression phenotype: HeLa + DMSO (44, 3), HeLa + 15 µM PTL (41, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3); N , n ( N = number of cells, n = number of experiments) for mitotic duration: HeLa + DMSO (40, 3), HeLa + 15 µM PTL (36, 3), HeLa GFP-BUGZ + DMSO (85, 3), HeLa GFP-BUGZ + 15 µM PTL (30, 3), HeLa GFP-BUGZ + 30 µM PTL (56, 3), HeLa GFP-BUGZ + 45 µM PTL (58, 3). .

    Article Snippet: The BUGZ gene (human, NCBI RefSeq: NM_001032293.3 ) encoding wild-type BUGZ and C54A mutant were commercially synthesized (GenScript) as siRNA-resistant sequences into a pGenDONR vector (pGenDONR-BUGZ and pGenDONR-BUGZ C54A).

    Techniques: Mass Spectrometry, Multiplex sample analysis, Stable Transfection, Expressing

    ( A ) Representative spinning-disk confocal time-series of mitosis in HeLa cells stably expressing GFP-BUGZ and infected with adenovirus to express H2B-RFP. Scale bar: 10 µm. ( B ) Representative spinning-disk confocal time-series of mitosis in control, 15 µM PTL- and siBUGZ-treated U2OS cells stably expressing H2B-GFP/mScarlet-α-tubulin. Scale bar: 10 µm.

    Journal: The EMBO Journal

    Article Title: Parthenolide disrupts mitosis by inhibiting ZNF207/BUGZ-promoted kinetochore-microtubule attachment

    doi: 10.1038/s44318-025-00469-2

    Figure Lengend Snippet: ( A ) Representative spinning-disk confocal time-series of mitosis in HeLa cells stably expressing GFP-BUGZ and infected with adenovirus to express H2B-RFP. Scale bar: 10 µm. ( B ) Representative spinning-disk confocal time-series of mitosis in control, 15 µM PTL- and siBUGZ-treated U2OS cells stably expressing H2B-GFP/mScarlet-α-tubulin. Scale bar: 10 µm.

    Article Snippet: The BUGZ gene (human, NCBI RefSeq: NM_001032293.3 ) encoding wild-type BUGZ and C54A mutant were commercially synthesized (GenScript) as siRNA-resistant sequences into a pGenDONR vector (pGenDONR-BUGZ and pGenDONR-BUGZ C54A).

    Techniques: Stable Transfection, Expressing, Infection, Control

    ( A ) Fluorencence and Coomassie staining of immunoprecipitated FLAG-BUGZ from HEK 293T cells treated either with DMSO or 15 µM alkyne-PTL. ( B ) Representative spinning-disk confocal maximum projections of click-based imaging of 15 µM fluor-488-alkyne-PTL in nocodazole arrested U2OS cells co-stained with α-tubulin and CENP-C, as markers for microtubules and kinetochores, respectively. Scale bar: 10 µm. ( C ) Quantification of the relative levels of 15 µM fluor-488-alkyne-PTL at kinetochores. N , n (number of cells, number of experiments): siNT (38, 4) siBUGZ (40, 4). *** p ≤0.001. ( D ) Representative confocal maximum projections of BUB1 immunostainings in nocodazole arrested U2OS cells treated with DMSO or 15 µM PTL. Scale bar: 10 µm. ( E ) Quantification of the relative levels of BUB1 at kinetochores. N , n ( N = number of cells, n = number of experiments): DMSO (40, 4), 15 µM PTL (40, 4). ( F ) Extracted ion chromatograms for peptides with and without PTL modification at Cys54 (red, and green, respectively). ( G ) Extent of PTL-modification at Cys54 from 3 independent experiments. ( H ) AlphaFold 3 model of BUGZ Zinc Finger domains and Cys54 positioning showing the catalytic mechanism leading to PTL selectivity. Replicates are color-coded for all quantifications. Data in ( C ) and ( E ) are presented as mean ± SD values, while data in ( G ) are presented in mean ± SEM values. Statistical analysis was performed by unpaired t-test with Welch’s correction in ( C ) and Mann-Whitney test in ( E ). .

    Journal: The EMBO Journal

    Article Title: Parthenolide disrupts mitosis by inhibiting ZNF207/BUGZ-promoted kinetochore-microtubule attachment

    doi: 10.1038/s44318-025-00469-2

    Figure Lengend Snippet: ( A ) Fluorencence and Coomassie staining of immunoprecipitated FLAG-BUGZ from HEK 293T cells treated either with DMSO or 15 µM alkyne-PTL. ( B ) Representative spinning-disk confocal maximum projections of click-based imaging of 15 µM fluor-488-alkyne-PTL in nocodazole arrested U2OS cells co-stained with α-tubulin and CENP-C, as markers for microtubules and kinetochores, respectively. Scale bar: 10 µm. ( C ) Quantification of the relative levels of 15 µM fluor-488-alkyne-PTL at kinetochores. N , n (number of cells, number of experiments): siNT (38, 4) siBUGZ (40, 4). *** p ≤0.001. ( D ) Representative confocal maximum projections of BUB1 immunostainings in nocodazole arrested U2OS cells treated with DMSO or 15 µM PTL. Scale bar: 10 µm. ( E ) Quantification of the relative levels of BUB1 at kinetochores. N , n ( N = number of cells, n = number of experiments): DMSO (40, 4), 15 µM PTL (40, 4). ( F ) Extracted ion chromatograms for peptides with and without PTL modification at Cys54 (red, and green, respectively). ( G ) Extent of PTL-modification at Cys54 from 3 independent experiments. ( H ) AlphaFold 3 model of BUGZ Zinc Finger domains and Cys54 positioning showing the catalytic mechanism leading to PTL selectivity. Replicates are color-coded for all quantifications. Data in ( C ) and ( E ) are presented as mean ± SD values, while data in ( G ) are presented in mean ± SEM values. Statistical analysis was performed by unpaired t-test with Welch’s correction in ( C ) and Mann-Whitney test in ( E ). .

    Article Snippet: The BUGZ gene (human, NCBI RefSeq: NM_001032293.3 ) encoding wild-type BUGZ and C54A mutant were commercially synthesized (GenScript) as siRNA-resistant sequences into a pGenDONR vector (pGenDONR-BUGZ and pGenDONR-BUGZ C54A).

    Techniques: Staining, Immunoprecipitation, Imaging, Modification, MANN-WHITNEY

    ( A ) Fluorencence and Comassie staining of immunoprecipitated FLAG empty and FLAG-BUGZ from HEK 293T cells treated alkyne-PTL. ( B ) Representative confocal images of click-based imaging of 5 µM fluor-Cy5-alkyne-PTL in HeLa GFP-BUGZ cells under the indicated conditions. Scale bar: 10 µm. ( C ) Scatter plot showing the intensity of BUGZ (x-axis) and 5 µM fluor-Cy5-alkyne-PTL (y-axis) at individual kinetochores from the indicated conditions in ( B ). Each dot represents a single kinetochore. A Pearson correlation line is shown for the correlation between BUGZ and fluor-Cy5-alkyne-PTL levels. ( D ) Quantification of 5 µM fluor-Cy5-alkyne-PTL intensity at kinetochores normalized to CENP-C intensity for the conditions indicated in ( B ). N , n (number of cells, number of experiments): siNT (19, 3) siBUGZ (21, 3). **** p ≤ 0.0001. Replicates are color coded. Data are presented as mean ± SD values from three independent replicates. Statistical analysis was performed using unpaired t-test. ( E ) Immunoblot for BUGZ depletion efficiency in HeLa GFP-BUGZ cells. ( F ) Illustration of domain architecture of BUGZ. ( G ) Western-blot with anti-BUGZ antibody of in cellulo GFP-Trap pulldown sample from HeLa cells stably expressing GFP-BUGZ treated with 50 µM PTL. ( H ) Extracted ion chromatograms and MS-MS spectra for peptides with and without PTL modification at Cys54 (red and green, respectively) from the GFP-Trap sample shown in ( G ).

    Journal: The EMBO Journal

    Article Title: Parthenolide disrupts mitosis by inhibiting ZNF207/BUGZ-promoted kinetochore-microtubule attachment

    doi: 10.1038/s44318-025-00469-2

    Figure Lengend Snippet: ( A ) Fluorencence and Comassie staining of immunoprecipitated FLAG empty and FLAG-BUGZ from HEK 293T cells treated alkyne-PTL. ( B ) Representative confocal images of click-based imaging of 5 µM fluor-Cy5-alkyne-PTL in HeLa GFP-BUGZ cells under the indicated conditions. Scale bar: 10 µm. ( C ) Scatter plot showing the intensity of BUGZ (x-axis) and 5 µM fluor-Cy5-alkyne-PTL (y-axis) at individual kinetochores from the indicated conditions in ( B ). Each dot represents a single kinetochore. A Pearson correlation line is shown for the correlation between BUGZ and fluor-Cy5-alkyne-PTL levels. ( D ) Quantification of 5 µM fluor-Cy5-alkyne-PTL intensity at kinetochores normalized to CENP-C intensity for the conditions indicated in ( B ). N , n (number of cells, number of experiments): siNT (19, 3) siBUGZ (21, 3). **** p ≤ 0.0001. Replicates are color coded. Data are presented as mean ± SD values from three independent replicates. Statistical analysis was performed using unpaired t-test. ( E ) Immunoblot for BUGZ depletion efficiency in HeLa GFP-BUGZ cells. ( F ) Illustration of domain architecture of BUGZ. ( G ) Western-blot with anti-BUGZ antibody of in cellulo GFP-Trap pulldown sample from HeLa cells stably expressing GFP-BUGZ treated with 50 µM PTL. ( H ) Extracted ion chromatograms and MS-MS spectra for peptides with and without PTL modification at Cys54 (red and green, respectively) from the GFP-Trap sample shown in ( G ).

    Article Snippet: The BUGZ gene (human, NCBI RefSeq: NM_001032293.3 ) encoding wild-type BUGZ and C54A mutant were commercially synthesized (GenScript) as siRNA-resistant sequences into a pGenDONR vector (pGenDONR-BUGZ and pGenDONR-BUGZ C54A).

    Techniques: Staining, Immunoprecipitation, Imaging, Western Blot, Stable Transfection, Expressing, Tandem Mass Spectroscopy, Modification

    METTL14 cell‐autonomously increases G6pc levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).

    Journal: Advanced Science

    Article Title: METTL14‐Induced M 6 A Methylation Increases G6pc Biosynthesis, Hepatic Glucose Production and Metabolic Disorders in Obesity

    doi: 10.1002/advs.202417355

    Figure Lengend Snippet: METTL14 cell‐autonomously increases G6pc levels and glucose production in hepatocytes. A) Primary hepatocytes were stimulated with glucagon (10 n m for 5 h) to measure gluconeogenesis using pyruvate and lactate as substrates (normalized to protein levels, n = 3 mice per group). B) Mettl14 f/f males (8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector for 6 weeks (on chow diet). Liver slices were treated with glucagon ex vivo (10 n m for 5 h) to measure gluconeogenesis (normalized to protein levels, n = 3 mice per group). C) Primary hepatocytes (C57BL/6J mice) were transduced with adeno‐METTL14 or adeno‐GFP vector for 48 h, and then stimulated with glucagon (10 n m ) for 5 h. Gluconeogenesis was measured and normalized to protein levels ( n = 3 per group). D–F) Mettl14 f/f males (on HFD for 10 weeks) were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector. Livers were harvested 6 weeks later. Livers were also harvested from Mettl14 f/f and Mettl14 Δ hep males on HFD for 10 weeks. D) Liver mRNA levels (normalized to 36B4 levels, n = 6 mice per group). E) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 4 mice per group). F) Liver glycogen levels ( n = 5 mice per group). G,H) C57BL/6J males (10 weeks on chow diet) were transduced with adeno‐METTL14 or adeno‐GFP vector. Liver glycogen was measured 2 weeks later. G) Liver extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 mice per group). H) Liver glycogen levels ( n = 6 mice per group). I) Males (8 weeks on chow diet) were transduced with the indicated AAV8 vectors. PTT and GLTT were performed 3 weeks later. AUC: area under curve. Mettl14 f/f , AAV8‐TBG‐GFP: n = 7. Mettl14 Δ hep , AAV8‐TBG‐GFP: n = 5. Mettl14 Δ hep , AAV8‐TBG‐G6pc: n = 6. Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐way ANOVA with Šidák's multiple‐comparison test (A–C) and two‐sided unpaired t ‐test (D–H) and one‐way ANOVA with Tukey's multiple‐comparison test (I).

    Article Snippet: [ ] The RefSeq gene annotation files including G6pc were downloaded from the University of California, Santa Cruz (UCSC) browser.

    Techniques: Transduction, Plasmid Preparation, Ex Vivo, Comparison

    METTL14 m 6 A‐dependently increases G6pc mRNA stability and translation in hepatocytes. A) Huh7 cells were cotransfected with METTL14 and G6pc plasmids for 2 days. METTL14‐bound G6pc mRNA was measured using METTL14‐linked RIP ( n = 3 per group). B) Mettl14 f/f males were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector for 6 weeks (on HFD). METTL14‐bound G6pc mRNA was measured in the liver using RIP assays ( n = 3 mice per group). C) Levels of m 6 A‐marked G6pc mRNA were measured in primary hepatocytes using MeRIP (normalized to G6pc input; n = 3 per group). D) Liver m 6 A distribution across the G6pc gene between Mettl14 f/f and Mettl14 Δ hep males. E) C57BL/6J mice were transduced with adeno‐METTL14 or adeno‐GFP vector ( n = 3 per group). 2 weeks later, liver m 6 A‐marked G6pc mRNA was measured using MeRIP (normalized to G6pc mRNA input). F) Huh7 cells were cotransfected with METTL14 and G6pc plasmids. 12 hours later, cells were treated with STM2457 (5 µg mL −1 ) for 36 h to measure m 6 A‐marked G6pc mRNA (normalized to G6pc mRNA input, DMSO as control, n = 3 per group). G) Primary hepatocytes were treated with actinomycin D to measure G6pc mRNA stability ( n = 3 mice per group). H) Primary hepatocyte culture (C57BL/6J males) was transduced with adeno‐METTL14 or adeno‐GFP vector for 24 h. G6pc mRNA decays were assessed using actinomycin D ( n = 3 mice per group). I) Poly‐bound and mono‐bound G6pc mRNA were measured in primary hepatocytes from males (8 weeks). J) OPP assays on primary hepatocytes to assess G6pc translation (normalized to G6pc input; n = 3 mice per group). K,L) Primary hepatocyte culture (C57BL/6J males) was transduced with adeno‐METTL14 or adeno‐GFP vector. Poly/mono‐bound G6pc mRNA and G6pc translation (OPP assays) were measured 48 and 24 h later, respectively ( n = 3 mice per group). M–O) Huh7 cells were cotransfected with METTL14 and G6pc or G6pc Δ 5A plasmids for 2 days. G6pc mRNA m 6 A methylations (normalized to G6pc input) and G6pc mRNA levels (normalized to GAPDH levels) were measured. Cell extracts were immunoblotted with anti‐G6pc antibody to measure G6pc levels (normalized to p85 levels, N = 3 per group). P) Huh7 cells were cotransfected with METTL14 and G6pc or G6pc Δ 5A plasmids for 36 h and then treated with actinomycin D. G6pc mRNA levels were measured and normalized to the initial values ( n = 3 per group). Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐sided unpaired t ‐test (A–C, E, I–L), two‐way ANOVA with Šidák's multiple‐comparison test (G,H,P) and one‐way ANOVA with Tukey's multiple‐comparison test (M–O).

    Journal: Advanced Science

    Article Title: METTL14‐Induced M 6 A Methylation Increases G6pc Biosynthesis, Hepatic Glucose Production and Metabolic Disorders in Obesity

    doi: 10.1002/advs.202417355

    Figure Lengend Snippet: METTL14 m 6 A‐dependently increases G6pc mRNA stability and translation in hepatocytes. A) Huh7 cells were cotransfected with METTL14 and G6pc plasmids for 2 days. METTL14‐bound G6pc mRNA was measured using METTL14‐linked RIP ( n = 3 per group). B) Mettl14 f/f males were transduced with AAV8‐TBG‐GFP or AAV8‐TBG‐Cre vector for 6 weeks (on HFD). METTL14‐bound G6pc mRNA was measured in the liver using RIP assays ( n = 3 mice per group). C) Levels of m 6 A‐marked G6pc mRNA were measured in primary hepatocytes using MeRIP (normalized to G6pc input; n = 3 per group). D) Liver m 6 A distribution across the G6pc gene between Mettl14 f/f and Mettl14 Δ hep males. E) C57BL/6J mice were transduced with adeno‐METTL14 or adeno‐GFP vector ( n = 3 per group). 2 weeks later, liver m 6 A‐marked G6pc mRNA was measured using MeRIP (normalized to G6pc mRNA input). F) Huh7 cells were cotransfected with METTL14 and G6pc plasmids. 12 hours later, cells were treated with STM2457 (5 µg mL −1 ) for 36 h to measure m 6 A‐marked G6pc mRNA (normalized to G6pc mRNA input, DMSO as control, n = 3 per group). G) Primary hepatocytes were treated with actinomycin D to measure G6pc mRNA stability ( n = 3 mice per group). H) Primary hepatocyte culture (C57BL/6J males) was transduced with adeno‐METTL14 or adeno‐GFP vector for 24 h. G6pc mRNA decays were assessed using actinomycin D ( n = 3 mice per group). I) Poly‐bound and mono‐bound G6pc mRNA were measured in primary hepatocytes from males (8 weeks). J) OPP assays on primary hepatocytes to assess G6pc translation (normalized to G6pc input; n = 3 mice per group). K,L) Primary hepatocyte culture (C57BL/6J males) was transduced with adeno‐METTL14 or adeno‐GFP vector. Poly/mono‐bound G6pc mRNA and G6pc translation (OPP assays) were measured 48 and 24 h later, respectively ( n = 3 mice per group). M–O) Huh7 cells were cotransfected with METTL14 and G6pc or G6pc Δ 5A plasmids for 2 days. G6pc mRNA m 6 A methylations (normalized to G6pc input) and G6pc mRNA levels (normalized to GAPDH levels) were measured. Cell extracts were immunoblotted with anti‐G6pc antibody to measure G6pc levels (normalized to p85 levels, N = 3 per group). P) Huh7 cells were cotransfected with METTL14 and G6pc or G6pc Δ 5A plasmids for 36 h and then treated with actinomycin D. G6pc mRNA levels were measured and normalized to the initial values ( n = 3 per group). Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐sided unpaired t ‐test (A–C, E, I–L), two‐way ANOVA with Šidák's multiple‐comparison test (G,H,P) and one‐way ANOVA with Tukey's multiple‐comparison test (M–O).

    Article Snippet: [ ] The RefSeq gene annotation files including G6pc were downloaded from the University of California, Santa Cruz (UCSC) browser.

    Techniques: Transduction, Plasmid Preparation, Control, Comparison

    YTHDF1 and YTHDF3 mediate METTL14 upregulation of G6pc biosynthesis. A) Ythdf2 f/f males (HFD for 8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector. PTT, GTT, and ITT were performed 4 weeks later ( n = 7 mice per group). B) Huh7 cells were cotransfected with HA‐G6pc , YTHDF2 , and METTL14 plasmids for 2 days. Cell extracts were immunoblotted with the indicated antibodies. HA‐G6pc levels were normalized to p85 levels ( n = 3 per group). C) Huh7 cells were cotransfected with the indicated plasmids for 2 days. Cell extracts were immunoblotted with the indicated antibodies. HA‐G6pc levels were normalized to p85 levels ( n = 3 per group). D–G) Huh7 cells were cotransfected with G6pc , G6pc Δ m6A , Flag‐YTHDF1 , and Flag‐YTHDF3 plasmids for 2 days (empty plasmid as control). YTHDF1‐bound and YTHDF3‐bound G6pc and G6pc Δ 5A mRNAs were measured using RIP assays (normalized to G6pc or G6pc Δ 5A mRNA input). Cell extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 per group). Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, one‐way ANOVA with Tukey's multiple‐comparison test (A–D) and two‐sided unpaired t ‐test (E–G).

    Journal: Advanced Science

    Article Title: METTL14‐Induced M 6 A Methylation Increases G6pc Biosynthesis, Hepatic Glucose Production and Metabolic Disorders in Obesity

    doi: 10.1002/advs.202417355

    Figure Lengend Snippet: YTHDF1 and YTHDF3 mediate METTL14 upregulation of G6pc biosynthesis. A) Ythdf2 f/f males (HFD for 8 weeks) were transduced with AAV8‐TBG‐Cre or AAV8‐TBG‐GFP vector. PTT, GTT, and ITT were performed 4 weeks later ( n = 7 mice per group). B) Huh7 cells were cotransfected with HA‐G6pc , YTHDF2 , and METTL14 plasmids for 2 days. Cell extracts were immunoblotted with the indicated antibodies. HA‐G6pc levels were normalized to p85 levels ( n = 3 per group). C) Huh7 cells were cotransfected with the indicated plasmids for 2 days. Cell extracts were immunoblotted with the indicated antibodies. HA‐G6pc levels were normalized to p85 levels ( n = 3 per group). D–G) Huh7 cells were cotransfected with G6pc , G6pc Δ m6A , Flag‐YTHDF1 , and Flag‐YTHDF3 plasmids for 2 days (empty plasmid as control). YTHDF1‐bound and YTHDF3‐bound G6pc and G6pc Δ 5A mRNAs were measured using RIP assays (normalized to G6pc or G6pc Δ 5A mRNA input). Cell extracts were immunoblotted with anti‐G6pc antibody. G6pc levels were normalized to p85 levels ( n = 3 per group). Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, one‐way ANOVA with Tukey's multiple‐comparison test (A–D) and two‐sided unpaired t ‐test (E–G).

    Article Snippet: [ ] The RefSeq gene annotation files including G6pc were downloaded from the University of California, Santa Cruz (UCSC) browser.

    Techniques: Transduction, Plasmid Preparation, Control, Comparison

    Obesity is associated with activation of the METTL3/METTL14/ G6pc mRNA m 6 A/G6pc synthesis/HGP axis. A) C57BL/6J males (8 weeks) were fasted for 24 h or randomly fed. Total liver G6pc mRNA (normalized to 36B4 levels) and m 6 A‐marked G6pc mRNA (normalized to G6pc input) were measured ( n = 5 per group). B–G) C57BL/6J males were fed HFD for 12 weeks (chow diet as control) and fasted overnight to harvest livers. B) Liver RNA abundance (normalized to 36B4 levels, n = 8 per group). C,D) Liver extracts were immunoblotted with the indicated antibodies. Protein levels were normalized to p85 levels ( n = 6 per group). E,F) Total liver m 6 A levels (dot blot assays, n = 6 mice per group). G) Liver m 6 A‐marked G6pc mRNA was measured by MeRIP (normalized to G6pc input, n = 6 mice per group). H) Obesogenic factors stimulate upregulation of hepatic METTL14 and METTL3, which in turn install m 6 A on G6pc mRNA. YTHDF1 and TRYDF3 bind to m 6 A‐marked G6pc mRNA and increase G6pc mRNA stability and translation, thereby increasing G6pc synthesis. G6pc increases HGP, thereby promoting hyperglycemia, glucose intolerance, and type 2 diabetes progression. Illustration was obtained from BioRender.com ( https://BioRender.com/k70o576 ). Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐sided unpaired t ‐test.

    Journal: Advanced Science

    Article Title: METTL14‐Induced M 6 A Methylation Increases G6pc Biosynthesis, Hepatic Glucose Production and Metabolic Disorders in Obesity

    doi: 10.1002/advs.202417355

    Figure Lengend Snippet: Obesity is associated with activation of the METTL3/METTL14/ G6pc mRNA m 6 A/G6pc synthesis/HGP axis. A) C57BL/6J males (8 weeks) were fasted for 24 h or randomly fed. Total liver G6pc mRNA (normalized to 36B4 levels) and m 6 A‐marked G6pc mRNA (normalized to G6pc input) were measured ( n = 5 per group). B–G) C57BL/6J males were fed HFD for 12 weeks (chow diet as control) and fasted overnight to harvest livers. B) Liver RNA abundance (normalized to 36B4 levels, n = 8 per group). C,D) Liver extracts were immunoblotted with the indicated antibodies. Protein levels were normalized to p85 levels ( n = 6 per group). E,F) Total liver m 6 A levels (dot blot assays, n = 6 mice per group). G) Liver m 6 A‐marked G6pc mRNA was measured by MeRIP (normalized to G6pc input, n = 6 mice per group). H) Obesogenic factors stimulate upregulation of hepatic METTL14 and METTL3, which in turn install m 6 A on G6pc mRNA. YTHDF1 and TRYDF3 bind to m 6 A‐marked G6pc mRNA and increase G6pc mRNA stability and translation, thereby increasing G6pc synthesis. G6pc increases HGP, thereby promoting hyperglycemia, glucose intolerance, and type 2 diabetes progression. Illustration was obtained from BioRender.com ( https://BioRender.com/k70o576 ). Data are presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, two‐sided unpaired t ‐test.

    Article Snippet: [ ] The RefSeq gene annotation files including G6pc were downloaded from the University of California, Santa Cruz (UCSC) browser.

    Techniques: Activation Assay, Control, Dot Blot