hg19 refseq q coding regions for the 523 genes (Illumina Inc)
Structured Review
Hg19 Refseq Q Coding Regions For The 523 Genes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/refseq+genes/hg19+reference+genome/pm39894076-65-8-25
Average 90 stars, based on 1 article reviews
Images
Related Articles
other:Article Title: Dysregulation of heterochromatin caused by genomic structural variants may be central to autism spectrum disorder Article Snippet: Both studies used the Article Title: Nonrecurrent Triplication of 5q21.3q23.3: A Case Report and Review of the Literature. Article Snippet: Triplications involving 5q21.3q23.3 are rare, and a phenotype has not been established.. Here, we present a 4monthold male with dysmorphic facial features and congenital cardiac malformation.. Chromosomal microarray identified a pathogenic triplication of 5q21.3q23.3 with chromosome analysis showing the extra 5q material inserted into 16q. Article Title: Method for the diagnosis and/or prognosis of cancer of the biliary tract Article Snippet: [38] Methylation:Article Title: KZFP-mediated variable DNA methylation of a primate-specific transposon is linked to type I diabetes in humans Article Snippet: .. Genomic coordinates in supplementary tables pertaining to GoDMC and ENID mQTL use the Sequencing:Article Title: ZNF512B binds RBBP4 via a variant NuRD interaction motif and aggregates chromatin in a NuRD complex-independent manner Article Snippet: .. Alignment of the trimmed sequencing reads to the Article Title: Mechanistic basis of atypical TERT promoter mutations Article Snippet: .. Supplementary Table 6 Gene Position hg19 Forward 5 ́- 3 ́ Reverse 5 ́- 3 ́ Amplicon TERT chr5:1295152-1295311 AGCGCTGCCTGAAACTCG CCTGCCCCTTCACCTTCCAG 160 bp Primer Sequence 5 ́- 3 ́ TERT Fwd with Blocking Assay:Article Title: Clinical Validation of the TruSight Oncology 500 Assay for the Detection and Reporting of Pan-Cancer Biomarkers. Article Snippet: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 jmdjournal.org 63 64 65 66 67 68 69 70 71 72 73 74 Clinical Validation of the TruSight Oncology 75 76 500 Assay for the Detection and Reporting of 77 78 79 80 81 82 83 84 Pan-Cancer Biomarkers Hussam Al-Kateb,* Shannon M. Knight,* Gopinath Sivasankaran,y Jesse S. Voss,* Beth A. Pitel,* Joseph H. Blommel,* Calvin R. Jerde,* Kandeleria M. Rumilla,* Jodi L. Lee,* Nate R. Mattson,* Kim P. Lauer,y Eric A. Zimmerman Zuckerman,* Chris D. Hofich,* Dragana Milosevic,* Joe Thompson,* Lori S. Tillmans,* Tony T. Stai,* Surendra Dasari,y Amber L. Pryzbylski,* Lisa G. Mullineaux,* Cris M. Ida,* Robert B. Jenkins,* Sounak Gupta,* Benjamin R. Kipp,* and Kevin C. Halling* 85 86 87 From the Departments of Laboratory Medicine and Pathology* and Quantitative Health Sciences, y Mayo Clinic, Rochester, Minnesota Amplification:Article Title: Mechanistic basis of atypical TERT promoter mutations Article Snippet: .. Supplementary Table 6 Gene Position hg19 Forward 5 ́- 3 ́ Reverse 5 ́- 3 ́ Amplicon TERT chr5:1295152-1295311 AGCGCTGCCTGAAACTCG CCTGCCCCTTCACCTTCCAG 160 bp Primer Sequence 5 ́- 3 ́ TERT Fwd with |

