t4 dna ligase buffer (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs t4 dna ligase buffer
T4 Dna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2521 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reaction+buffer/T4+DNA+Ligase+Reaction+Buffer/pm42127148-320-0-4
Average 99 stars, based on 2521 article reviews

t4 dna ligase buffer - by Bioz Stars, 2026-11

99/100 stars

Images

Chromatin Immunoprecipitation:

Article Title: Structural remodeling and activation of the hdeAB and proVWX operons in response to pH and salt stress.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ChIP-grade anti-FLAG antibody Digenodes Cat# C15200209; RRID: AB_3756920 Bacterial and virus strains Escherichia coli K-12 N/A N/A MG1655 ΔendA Rashid et al.28 N/A MG1655 ΔendA stpA::kanRccdB Rashid et al.28 N/A MG1655 ΔendA hns::kanRccdB this paper N/A ΔendA; rpoS::camR this paper N/A ΔendA; ΔstpAFRT ; ΔhnsKan-KEIO this paper N/A ΔendA; ΔrpoSFRT ; ΔstpAFRT; ΔhnsKan-KEIO this paper N/A ΔendA; hns::hns-3XFLAG this paper N/A ΔendA; stpA::stpA-3XFLAG this paper N/A ΔendA;hns::hns-3XFLAG; stpA::kanRccdB this paper N/A ΔendA; stpA::stpA-3XFLAG; hns::kanRccdB this paper N/A Chemicals, peptides, and recombinant proteins T4 DNA ligase New England Biolabs Cat# M0202M T4 DNA ligase buffer New England Biolabs Cat# B0202S MluCI enzyme New England Biolabs Cat# R0538L NlaIII enzyme New England Biolabs Cat# R0125L proteinase K Thermo Fisher scientific Cat# EO0492 Glycogen Thermo Fisher scientific Cat# AM9510 Critical commercial assays PureLink RNA Mini Kit Thermo Fisher scientific Cat# 12183020 PrimeTimeTM Gene Expression Master Mix Kit Integrated DNA Technologies Cat# 10557710 iDeal ChIP-qPCR kit Diagenode Cat# C01010180 Luna Universal qPCR Master Mix New England Biolabs Cat# M3003E Qubit dsDNA HS Assay Kit ThermoFisher Scientific Cat# Q32854 Oligonucleotides TaqMan probe_hdeAB (6-FAM/TGAGGTTATAACC TGGTTTTCT/ZEN/GTATATGTCATGTTGATGG/IBFQ) Integrated DNA Technologies N/A TaqMan probe_proVWX (6-FAM/CATGCAATA/ZEN/ GAAAGATTCCTTTATTTGTCTATGTCGAT/IBFQ ) Integrated DNA Technologies N/A Deposited data Raw data of Micro-C Gavrilov et al.9 GEO: GSE272161 Generated data in this study this paper 4TU. .. ResearchData: https://doi.org/10.4121/ f75943dc-4404-4784-8445-ceee37f141ad Software and algorithms NanoDrop 2000/2000c (version 1.6) Thermo Fisher scientific N/A MO.

Virus:

Recombinant:

Gene Expression:

ChIP-qPCR:

Real-time Polymerase Chain Reaction:

Qubit:

Generated:

Incubation:

Article Title: Reconstituting human and SV40 replisomes with Okazaki fragment maturation reveals synchronized leading- and lagging-strand synthesis.
Article Snippet: The digested plasmid was purified from an agarose gel using the QIAquick Gel Extraction Kit (QIAGEN). .. The BsaIlinearized DNA was ligated to a 5-fold molar excess pre-annealed fork and incubated in a reaction containing T4 DNA ligase (60,000 units, New England Biolabs), 10x T4 ligase buffer at 16 °C for 17 h. The excess unligated fork was removed by gel purification. ..

Article Title: Guanine content in the CTCF motif encodes a vulnerability to persistent, alcohol-induced redistribution
Article Snippet: Next, digested chromatin was incubated at 65°C for 20 minutes to inactivate DpnII, after which time restriction fragment overhangs were marked with biotin and repaired by incubation at 37°C for one hour in the presence of fill-in master mix (15 ul of 1 mM biotin-14-dATP, 1.5 ul of 10 mM dCTP, 1.5 ul of 10 mM dGTP, 1.5 ul of 10 mM dTTP, 22.5 ul water, and 8 ul of 5 U/ul DNA polymerase I, Large (Klenow) Fragment (NEB M0210)). .. 900 ul ligation master mix was then added and cells incubated with slow rotation overnight (669 ul water, 120 ul of 10X NEB T4 DNA ligase buffer (NEB B0202), 100 ul of 10% Triton X-100, 6 ul of 20 mg/ml bovine serum albumin, 5 ul of 400 U/ul T4 DNA Ligase (NEB M0202)). .. The next day, protein was degraded by proteinase K (NEB P8107) and SDS with 55°C incubation for 30 minutes.

Gel Purification:

Amplification:

Article Title: AMP Deaminase-2 Activators and Regulators Underpinning Cellular Function in Human Fructose and Nucleotide Metabolism
Article Snippet: Removal of the first 128 residues of the hAMPD2-2 sequence from the pET28a vector encoding His6-tagged hAMPD2-2 was performed via PCR amplification using Taq polymerase (Invitrogen), a forward primer (Eurofins) containing an NdeI restriction site (5′- GACTCATATGCGGGAGCGTGATGTGCTG-3′) and a reverse primer (Eurofins) with a HindIII restriction site (5′- CCGCAAGCTTGTCGACTTATTG-3′). .. The amplified and purified PCR product and pET28a-hAMPD2-2 were digested in NEB buffer 2 using NdeI and HindIII restriction enzymes (New England Biolabs) and ligated using T4 ligase buffer and T4 ligase enzyme (New England Biolabs) at 16 °C overnight. .. Ligated pET28a-hAMPD2-2Δ128 was transformed into NEB5α competent cells (New England Biolabs), extracted, and the sequence was confirmed via Sanger sequencing (Genewiz).

Purification:

Polymerase Chain Reaction:

Ligation:

other:

Article Title: Negative regulation of T H 17-mediated inflammation by the nuclear receptor REV-ERBβ
Article Snippet: T4 Ligase Buffer , NEB , Cat# B0202S.

Adapter Ligation:

Article Title: Phylogenomics and species delimitation in the Scincella silvicola complex (Squamata: Scincidae) reveal deep structure and cryptic diversity across the Atlantic slopes of Mexico.
Article Snippet: .. Adapter ligation was performed by adding 1.5 μl of each enzyme-specific adapter to 30 μl of the digested DNA, followed by 3.4 μl of 10× Ligase Buffer (NEB) and 0.6 μl of T4 DNA Ligase (400 U/μl). ..

Review