Review




Structured Review

Meridian Bioscience hexanucleotide random primers
Hexanucleotide Random Primers, supplied by Meridian Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/hexanucleotide+random+primers/pmc03667997-49-22-26
Average 90 stars, based on 1 article reviews
hexanucleotide random primers - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Isolation:

Article Title: Abundance of Flt3 and its ligand in astrocytic tumors
Article Snippet: The identity of the cell lines was confirmed using the AmpFSTR kit and GeneMapper ID version 3.2 software from Applied Biosystems (Foster City, CA, USA), which automatically determines the alleles of polymorphic DNA markers on various chromosomes and the alleles of the sex marker, amelogenin. real-time polymerase chain reaction A total of 31 tumors (6 × A, 11 × AA, 14 × GBM) derived from patients of both genders and the cell lines were examined. .. Total RNA was isolated with Trizol reagent (Life Technologies, Darmstadt, Germany), and 1 μg of total RNA was reverse-transcribed into cDNA using hexanucleotide random primers from Bioline (Luckenwalde, Germany). .. Quantitative real-time polymerase chain reaction (PCR) was performed using an ABI Prism 7000-SDS machine (Applied Biosystems) with 1 μL of cDNA, ABI SYBR Green PCR Master Mix (Applied Biosystems), and the following primers at an annealing temperature of 55°C: AATGATGATGCCCAATTTACC (forward) and GTAACACTTCTTCCAGGTCC (reverse) for Flt3, AGACTGTCGCTGGGTCCAAG (forward) and GCTCGGAGGTCTCCTGCAG (reverse) for Flt3L, CCAGCAGAGAATGGAAAGTC ( forward) and GATGCTGCTTACATGTCTCG (reverse) for b2 microglobulin, which was used as a reference for normalization of C t values.

Article Title: Abundance of Flt3 and its ligand in astrocytic tumors
Article Snippet: .. Total RNA was isolated with Trizol reagent (Life Technologies, Darmstadt, Germany), and 1 μg of total RNA was reverse-transcribed into cDNA using hexanucleotide random primers from Bioline (Luckenwalde, Germany). .. Quantitative real-time polymerase chain reaction (PCR) was performed using an ABI Prism 7000-SDS machine (Applied Biosystems) with 1 μL of cDNA, ABI SYBR Green PCR Master Mix (Applied Biosystems), and the following primers at an annealing temperature of 55°C: AATGATGATGCCCAATTTACC (forward) and GTAACACTTCTTCCAGGTCC (reverse) for Flt3, AGACTGTCGCTGGGTCCAAG (forward) and GCTCGGAGGTCTCCTGCAG (reverse) for Flt3L, CCAGCAGAGAATGGAAAGTC (forward) and GATGCTGCTTACATGTCTCG (reverse) for b2 microglobulin, which was used as a reference for normalization of C t values.

Reverse Transcription:

Article Title: Abundance of Flt3 and its ligand in astrocytic tumors
Article Snippet: The identity of the cell lines was confirmed using the AmpFSTR kit and GeneMapper ID version 3.2 software from Applied Biosystems (Foster City, CA, USA), which automatically determines the alleles of polymorphic DNA markers on various chromosomes and the alleles of the sex marker, amelogenin. real-time polymerase chain reaction A total of 31 tumors (6 × A, 11 × AA, 14 × GBM) derived from patients of both genders and the cell lines were examined. .. Total RNA was isolated with Trizol reagent (Life Technologies, Darmstadt, Germany), and 1 μg of total RNA was reverse-transcribed into cDNA using hexanucleotide random primers from Bioline (Luckenwalde, Germany). .. Quantitative real-time polymerase chain reaction (PCR) was performed using an ABI Prism 7000-SDS machine (Applied Biosystems) with 1 μL of cDNA, ABI SYBR Green PCR Master Mix (Applied Biosystems), and the following primers at an annealing temperature of 55°C: AATGATGATGCCCAATTTACC (forward) and GTAACACTTCTTCCAGGTCC (reverse) for Flt3, AGACTGTCGCTGGGTCCAAG (forward) and GCTCGGAGGTCTCCTGCAG (reverse) for Flt3L, CCAGCAGAGAATGGAAAGTC ( forward) and GATGCTGCTTACATGTCTCG (reverse) for b2 microglobulin, which was used as a reference for normalization of C t values.

Article Title: Abundance of Flt3 and its ligand in astrocytic tumors
Article Snippet: .. Total RNA was isolated with Trizol reagent (Life Technologies, Darmstadt, Germany), and 1 μg of total RNA was reverse-transcribed into cDNA using hexanucleotide random primers from Bioline (Luckenwalde, Germany). .. Quantitative real-time polymerase chain reaction (PCR) was performed using an ABI Prism 7000-SDS machine (Applied Biosystems) with 1 μL of cDNA, ABI SYBR Green PCR Master Mix (Applied Biosystems), and the following primers at an annealing temperature of 55°C: AATGATGATGCCCAATTTACC (forward) and GTAACACTTCTTCCAGGTCC (reverse) for Flt3, AGACTGTCGCTGGGTCCAAG (forward) and GCTCGGAGGTCTCCTGCAG (reverse) for Flt3L, CCAGCAGAGAATGGAAAGTC (forward) and GATGCTGCTTACATGTCTCG (reverse) for b2 microglobulin, which was used as a reference for normalization of C t values.



Similar Products

96
TaKaRa hexanucleotide random primers
Hexanucleotide Random Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/Random+Primer/pmc11061733-52-24-27
Average 96 stars, based on 1 article reviews
hexanucleotide random primers - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Sileks GmbH hexanucleotides 6-random random hexa primer d0300
Hexanucleotides 6 Random Random Hexa Primer D0300, supplied by Sileks GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/hexanucleotides+6+random+random+hexa+primer+d0300/pm39206902-91-0-9
Average 90 stars, based on 1 article reviews
hexanucleotides 6-random random hexa primer d0300 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher random hexanucleotide primer
Random Hexanucleotide Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/random+hexanucleotide+primer/pmc10928104__41419_2024_6576_MOESM3_ESM-90-12-18
Average 90 stars, based on 1 article reviews
random hexanucleotide primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher random primer hexanucleotides
Random Primer Hexanucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/pmc10773078-151-21-26
Average 90 stars, based on 1 article reviews
random primer hexanucleotides - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega random hexanucleotide primers
Random Hexanucleotide Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/random+hexanucleotide+primers/pm38030018-110-33-35
Average 90 stars, based on 1 article reviews
random hexanucleotide primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Biolabmix LLC cdna synthesis with a random hexanucleotide primer and r01 kit
Cdna Synthesis With A Random Hexanucleotide Primer And R01 Kit, supplied by Biolabmix LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/cdna+synthesis+with+a+random+hexanucleotide+primer+and+r01+kit/pm36941814-64-19-21
Average 90 stars, based on 1 article reviews
cdna synthesis with a random hexanucleotide primer and r01 kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Millipore random hexanucleotide primers
Random Hexanucleotide Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/random+hexamer+primers/pm37371461-64-43-46
Average 90 stars, based on 1 article reviews
random hexanucleotide primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Thermo Fisher random hexanucleotide primers
Random Hexanucleotide Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/random+hexanucleotide+primers/pm37240031-344-21-24
Average 90 stars, based on 1 article reviews
random hexanucleotide primers - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results