Review



quickchange method  (AH Diagnostics)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    AH Diagnostics quickchange method
    Quickchange Method, supplied by AH Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/quickchange+method/pm15670165-105-12-15
    Average 90 stars, based on 1 article reviews
    quickchange method - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Lid L11 of the glutamine amidotransferase domain of CTP synthase mediates allosteric GTP activation of glutaminase activity.
    Article Snippet: .. Site-directed mutagenesis of the L. lactis pyrG gene was performed using the QuickChange method (Stratagene, AH Diagnostics, Aarhus, Denmark) and the complementary deoxy-oligonucleotides LL5-R359M; GGCTTTG GTCAAATGGGAACAGAAGGT, LL3-R359M; ACCTTC TGTTCCCATTTGACCAAAGCC, LL5-R359P; GGCTTT GGTCAACCGGGAACAGAAGGT, LL3-R359P; ACCTT CTGTTCCCGGTTGACCAAAGCC, LL5-G360A; TTTGG TCAACGTGCAACAGAAGGTAAG, LL3-G360A; CTTA CCTTCTGTTGCACGTTGACCAAA, LL5-G360P; TTTGG TCAACGTCCAACAGAAGGTAAG, LL3-G360P; CTTAC CTTCTGTTGGACGTTGACCAAA, LL5-E362Q; CAACG TGGAACACAAGGTAAGATTGCA and LL3-E362Q; TGCAATCTTACCTTGTGTTCCACGTTG for construction of the alleles encoding the R359M, R359P, G360A, G360P and E362Q enzymes, respectively. ..



    Similar Products

    quickchange site directed mutagenesis kit  (Genechem)
    86
    Genechem quickchange site directed mutagenesis kit
    Quickchange Site Directed Mutagenesis Kit, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/directed+kit+mutagenesis+quickchange+site/pm42243619-123-13-17
    Average 86 stars, based on 1 article reviews
    quickchange site directed mutagenesis kit - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    quickchange  (New England Biolabs)
    99
    New England Biolabs quickchange
    Quickchange, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/Q5+Site-Directed+Mutagenesis+Kit/pm41680142-391-15-7
    Average 99 stars, based on 1 article reviews
    quickchange - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    quickchange mutagenesis  (New England Biolabs)
    99
    New England Biolabs quickchange mutagenesis
    Quickchange Mutagenesis, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/DpnI/pm41535472-537-3-19
    Average 99 stars, based on 1 article reviews
    quickchange mutagenesis - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    quickchange site-directed mutagenesis kit  (Thermo Fisher)
    90
    Thermo Fisher quickchange site-directed mutagenesis kit
    Quickchange Site Directed Mutagenesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/phusion+site+directed+mutagenesis+kit/pmc09479617__jci___132___159527___s057-118-10-14
    Average 90 stars, based on 1 article reviews
    quickchange site-directed mutagenesis kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    quickchange kit  (Qiagen)
    90
    Qiagen quickchange kit
    Quickchange Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/quickchange+kit/pmc12205366-60-26-28
    Average 90 stars, based on 1 article reviews
    quickchange kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    quickchange site directed mutagenesis kit  (Qiagen)
    90
    Qiagen quickchange site directed mutagenesis kit
    Quickchange Site Directed Mutagenesis Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/quikchange+site+directed+mutagenesis+kit/pmc12273560-151-11-16
    Average 90 stars, based on 1 article reviews
    quickchange site directed mutagenesis kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    quickchange kit  (GenScript corporation)
    90
    GenScript corporation quickchange kit
    Quickchange Kit, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/quickchange+kit/pm40532787-51-10-12
    Average 90 stars, based on 1 article reviews
    quickchange kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    quickchange site-directed mutagenesis kit  (Transgene Biotek)
    90
    Transgene Biotek quickchange site-directed mutagenesis kit
    Quickchange Site Directed Mutagenesis Kit, supplied by Transgene Biotek, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/quickchange/quickchange+site+directed+mutagenesis+kit/pm40505938-112-8-12
    Average 90 stars, based on 1 article reviews
    quickchange site-directed mutagenesis kit - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results