quick ligase reaction buffer (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs quick ligase reaction buffer
Quick Ligase Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 33839 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quick+ligase+buffer/T4+DNA+Ligase/pm41673041-76-15-19
Average 99 stars, based on 33839 article reviews

quick ligase reaction buffer - by Bioz Stars, 2026-11

99/100 stars

Images

Chromatin Immunoprecipitation:

Article Title: Structural remodeling and activation of the hdeAB and proVWX operons in response to pH and salt stress.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies ChIP-grade anti-FLAG antibody Digenodes Cat# C15200209; RRID: AB_3756920 Bacterial and virus strains Escherichia coli K-12 N/A N/A MG1655 ΔendA Rashid et al.28 N/A MG1655 ΔendA stpA::kanRccdB Rashid et al.28 N/A MG1655 ΔendA hns::kanRccdB this paper N/A ΔendA; rpoS::camR this paper N/A ΔendA; ΔstpAFRT ; ΔhnsKan-KEIO this paper N/A ΔendA; ΔrpoSFRT ; ΔstpAFRT; ΔhnsKan-KEIO this paper N/A ΔendA; hns::hns-3XFLAG this paper N/A ΔendA; stpA::stpA-3XFLAG this paper N/A ΔendA;hns::hns-3XFLAG; stpA::kanRccdB this paper N/A ΔendA; stpA::stpA-3XFLAG; hns::kanRccdB this paper N/A Chemicals, peptides, and recombinant proteins T4 DNA ligase New England Biolabs Cat# M0202M T4 DNA ligase buffer New England Biolabs Cat# B0202S MluCI enzyme New England Biolabs Cat# R0538L NlaIII enzyme New England Biolabs Cat# R0125L proteinase K Thermo Fisher scientific Cat# EO0492 Glycogen Thermo Fisher scientific Cat# AM9510 Critical commercial assays PureLink RNA Mini Kit Thermo Fisher scientific Cat# 12183020 PrimeTimeTM Gene Expression Master Mix Kit Integrated DNA Technologies Cat# 10557710 iDeal ChIP-qPCR kit Diagenode Cat# C01010180 Luna Universal qPCR Master Mix New England Biolabs Cat# M3003E Qubit dsDNA HS Assay Kit ThermoFisher Scientific Cat# Q32854 Oligonucleotides TaqMan probe_hdeAB (6-FAM/TGAGGTTATAACC TGGTTTTCT/ZEN/GTATATGTCATGTTGATGG/IBFQ) Integrated DNA Technologies N/A TaqMan probe_proVWX (6-FAM/CATGCAATA/ZEN/ GAAAGATTCCTTTATTTGTCTATGTCGAT/IBFQ ) Integrated DNA Technologies N/A Deposited data Raw data of Micro-C Gavrilov et al.9 GEO: GSE272161 Generated data in this study this paper 4TU. .. ResearchData: https://doi.org/10.4121/ f75943dc-4404-4784-8445-ceee37f141ad Software and algorithms NanoDrop 2000/2000c (version 1.6) Thermo Fisher scientific N/A MO.

Virus:

Recombinant:

Gene Expression:

ChIP-qPCR:

Real-time Polymerase Chain Reaction:

Qubit:

Generated:

Over Expression:

Article Title: ACSF2 Functions as a regulatory switch for PARP inhibitor sensitivity in platinum-sensitive and homologous recombination-proficient high-grade serous ovarian cancer.
Article Snippet: .. Construction of ACSF2 overexpression vector The ACSF2 coding sequence (CDS; CCDS ID: 11567.1, length: 1848 nt; synthesized by Sangon Biotech) was cloned into the pLenti-CMV-GFP plasmid using BmtI (R3658; NEB, Ipswich, MA, USA) and PspOMI (R0653; NEB) double digestion and T4 DNA ligase (M0202V; NEB). .. The constructed plasmid (pLenti-CMV-GFPACSF2 CDS) was transformed into DH5α competent cells (C2987H; NEB), and positive clones were selected on Amp+ LB solid medium (L2010; Solarbio, Beijing, China).

Plasmid Preparation:

Article Title: Staphylococcus aureus wall teichoic acid structure dictates virulence potential and resistance to host defenses.
Article Snippet: .. The digested plasmid and PCR product were ligated using T4 DNA ligase (NEB, ref. M020S) according to the manufacturer’s recommendations. ..

Sequencing:

Synthesized:

Clone Assay:

Polymerase Chain Reaction:

Ligation:

Article Title: TriLock-FISH enables in situ discrimination of influenza cRNA and mRNA for single-cell analysis of viral replication and transcription.
Article Snippet: .. Ligation: samples were incubated in ligation buffer (1× SplintR ligase buffer, 1 U/μL SplintR ligase [NEB, M0375], 1.6 U/μL T4 DNA ligase [NEB, M0202], 0.1 mM ATP [NEB, P0756], 0.2 μg/μL BSA, and 0.1 U/μL RNase inhibitor) for 2 h at 16°C and then 2 h at 25°C, followed by three 5-min washes with DEPC-PBSTR. .. Rolling circle amplification (RCA): samples were incubated in RCA buffer (1× Phi29 DNA polymerase buffer, 1 U/μL Phi29 DNA polymerase [Vazyme, N106-01], 1 mM dNTPs, 0.2 μg/μL BSA, and 5% glycerol) for 6–8 h at 30°C, followed by three 5-min washes with DEPC-PBST.

Article Title: In vivo Gene Writing with engineered retrotransposons.
Article Snippet: Samples were spiked with DNA Control Sample (DCS), end-repaired and A-tailed using NEBNext End Prep Master Mix (New England Biolabs), and purified by 0.6× SPRIselect bead cleanup. .. Nanopore adaptor ligation was performed with Quick T4 DNA Ligase (New England Biolabs, Cat# E6057A). .. After a 0.4× SPRIselect bead cleanup, the ligated samples were sequenced on an R10.4.1 flow cell (Oxford Nanopore, Cat# FLO-MIN114) on the GridION Mk1 (firmware 1.2.1; Oxford Nanopore) running MinKNOW (ver 23.01.12).

Incubation:

Cloning:

Article Title: Engineering sticky microbes: A framework for appraisal of microbial cell-cell adhesion.
Article Snippet: Where indicated, DNA sequences of interest were amplified with the Jo ur na l P r -p ro of high-fidelity Q5 Polymerase from NEB, while colony PCR reactions were performed using DreamTaq polymerase (Thermo Fisher Scientific). .. Restriction enzymes and the T4 ligase from New England Biolabs were used for traditional cloning. .. Plasmids were prepared using the QIAprep Spin Miniprep kit (Qiagen, Inc., Valencia, CA).

Review