foxp3 dna methylation (EpigenDx)

EpigenDx is a verified supplier

EpigenDx manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

EpigenDx foxp3 dna methylation

A Naive CD3 + CD4 + CD44 − CD62L + <t>Foxp3</t> − naive T cells were isolated from the spleens of WT Foxp3 GFP and cultured for 72 h in the presence of CD3/CD28 beads, IL-2 and TGF-β. Culture plates were coated with 5 µg/mL PD-L2Fc or control IgG1Fc for 30 min prior culture. B Representative flow cytometry plots of Foxp3 induction in CD3 + CD4 + CD24 + Foxp3 GFP+ iTregs after 72 h of culture. C Absolute numbers of iTregs after 72 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. D Foxp3 mean fluorescence intensity (MFI) of iTregs after 72 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. E IL-10 secretion by iTregs after 72 h of culture, presented as the mean ± SEM. n = 8 biologically independent samples. F Following culture, cells were transferred to PDL-coated HS mini plates and a Mito Stress test was performed to measure oxygen levels in the culture medium. Oxygen consumption rate (OCR) in response to Oligomycin (oligo.), FCCP and Rotenone (Rot/AA) sequential injections. n = 3 biologically independent samples. G Basal respiration in PD-L2Fc or control IgG1Fc groups. H Spare respiratory capacity in PD-L2Fc or control IgG1Fc groups. I ATP production in PD-L2Fc or control IgG1Fc groups. J Schematic of the Foxp3 promoter region, showing the intron 1 TSDR region containing CpG#19, CpG#20, CpG#21, and CpG#22 within the CNS2. K Average methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. L Methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. n = 4 biologically independent samples. Data are representative of 2 independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups.

Foxp3 Dna Methylation, supplied by EpigenDx, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pyrosequencing/Human+FOXP3+Gene+Methylation+Pyrosequencing+Assays/pmc09433378-399-4-13
Average 93 stars, based on 6 article reviews

foxp3 dna methylation - by Bioz Stars, 2026-09

93/100 stars

Images

1) Product Images from "PD-L2 controls peripherally induced regulatory T cells by maintaining metabolic activity and Foxp3 stability"

Article Title: PD-L2 controls peripherally induced regulatory T cells by maintaining metabolic activity and Foxp3 stability

Journal: Nature Communications

doi: 10.1038/s41467-022-32899-5

A Naive CD3 + CD4 + CD44 − CD62L + Foxp3 − naive T cells were isolated from the spleens of WT Foxp3 GFP and cultured for 72 h in the presence of CD3/CD28 beads, IL-2 and TGF-β. Culture plates were coated with 5 µg/mL PD-L2Fc or control IgG1Fc for 30 min prior culture. B Representative flow cytometry plots of Foxp3 induction in CD3 + CD4 + CD24 + Foxp3 GFP+ iTregs after 72 h of culture. C Absolute numbers of iTregs after 72 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. D Foxp3 mean fluorescence intensity (MFI) of iTregs after 72 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. E IL-10 secretion by iTregs after 72 h of culture, presented as the mean ± SEM. n = 8 biologically independent samples. F Following culture, cells were transferred to PDL-coated HS mini plates and a Mito Stress test was performed to measure oxygen levels in the culture medium. Oxygen consumption rate (OCR) in response to Oligomycin (oligo.), FCCP and Rotenone (Rot/AA) sequential injections. n = 3 biologically independent samples. G Basal respiration in PD-L2Fc or control IgG1Fc groups. H Spare respiratory capacity in PD-L2Fc or control IgG1Fc groups. I ATP production in PD-L2Fc or control IgG1Fc groups. J Schematic of the Foxp3 promoter region, showing the intron 1 TSDR region containing CpG#19, CpG#20, CpG#21, and CpG#22 within the CNS2. K Average methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. L Methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. n = 4 biologically independent samples. Data are representative of 2 independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups.

Figure Legend Snippet: A Naive CD3 + CD4 + CD44 − CD62L + Foxp3 − naive T cells were isolated from the spleens of WT Foxp3 GFP and cultured for 72 h in the presence of CD3/CD28 beads, IL-2 and TGF-β. Culture plates were coated with 5 µg/mL PD-L2Fc or control IgG1Fc for 30 min prior culture. B Representative flow cytometry plots of Foxp3 induction in CD3 + CD4 + CD24 + Foxp3 GFP+ iTregs after 72 h of culture. C Absolute numbers of iTregs after 72 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. D Foxp3 mean fluorescence intensity (MFI) of iTregs after 72 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. E IL-10 secretion by iTregs after 72 h of culture, presented as the mean ± SEM. n = 8 biologically independent samples. F Following culture, cells were transferred to PDL-coated HS mini plates and a Mito Stress test was performed to measure oxygen levels in the culture medium. Oxygen consumption rate (OCR) in response to Oligomycin (oligo.), FCCP and Rotenone (Rot/AA) sequential injections. n = 3 biologically independent samples. G Basal respiration in PD-L2Fc or control IgG1Fc groups. H Spare respiratory capacity in PD-L2Fc or control IgG1Fc groups. I ATP production in PD-L2Fc or control IgG1Fc groups. J Schematic of the Foxp3 promoter region, showing the intron 1 TSDR region containing CpG#19, CpG#20, CpG#21, and CpG#22 within the CNS2. K Average methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. L Methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. n = 4 biologically independent samples. Data are representative of 2 independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups.

Techniques Used: Isolation, Cell Culture, Control, Flow Cytometry, Fluorescence, Methylation, Two Tailed Test

A Thymus of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were collected and analyzed by flow cytometry. Representative plots of CD25 + (CD25 + TregP cells) and Foxp3 lo Treg cell progenitors (Foxp3 lo TregP cells) analyzed based on CD25 and Foxp3 GFP expression. B Corresponding quantitation presented as mean ± SEM. n = 3 biologically independent mice. C Spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were collected and analyzed by flow cytometry. Representative plots of CD3 + CD4 + CD25 + Foxp3 GFP+ total Tregs. D Numbers of total Tregs in WT and PD-L2 KO mice presented as mean ± SEM. n = 5 biologically independent mice. E BALB/c (WT) BMDC were differentiated in vitro for 7–10 days, plated and further cultured with or without 50 ng/mL IL-4 for 24 h to measure PD-L2 expression by flow cytometry. F Representative plots of CD11c + BMDC, expression of PD-L2. G Numbers of PD-L2-expressing CD11c + BMDC presented as mean ± SEM. n = 4 biologically independent samples. H PD-L2 low and PD-L2 high BMDCs were intravenously injected or not to WT or PD-L2 KO Foxp3 GFP mice on day 0, and on day 3 the spleens of recipient mice were analyzed for CD3 + CD4 + CD25 + Foxp3 + total Tregs by flow cytometry. I Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ total Tregs per spleen at day 3 following BMDC transfer. n = 3 biologically independent mice. J – M PD-L2 high or PD-L2 null BMDCs were i.v. injected or not to WT or PD-L2 KO Foxp3 GFP mice on day 0, and on day 3 the spleens of recipient mice were analyzed for Tregs by flow cytometry. J Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ total Tregs. K Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − pTregs. L Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 + tTregs. M Thymus of recipient mice were collected and analyzed by flow cytometry, and the frequencies of CD25 + TregP cells and Foxp3 lo TregP cells was analyzed based on CD25 and Foxp3 GFP expression, presented as mean ± SEM. n = 3 biologically independent mice. Data are representative of three independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used. Mouse image provided with permission from Servier Medical Art.

Figure Legend Snippet: A Thymus of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were collected and analyzed by flow cytometry. Representative plots of CD25 + (CD25 + TregP cells) and Foxp3 lo Treg cell progenitors (Foxp3 lo TregP cells) analyzed based on CD25 and Foxp3 GFP expression. B Corresponding quantitation presented as mean ± SEM. n = 3 biologically independent mice. C Spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were collected and analyzed by flow cytometry. Representative plots of CD3 + CD4 + CD25 + Foxp3 GFP+ total Tregs. D Numbers of total Tregs in WT and PD-L2 KO mice presented as mean ± SEM. n = 5 biologically independent mice. E BALB/c (WT) BMDC were differentiated in vitro for 7–10 days, plated and further cultured with or without 50 ng/mL IL-4 for 24 h to measure PD-L2 expression by flow cytometry. F Representative plots of CD11c + BMDC, expression of PD-L2. G Numbers of PD-L2-expressing CD11c + BMDC presented as mean ± SEM. n = 4 biologically independent samples. H PD-L2 low and PD-L2 high BMDCs were intravenously injected or not to WT or PD-L2 KO Foxp3 GFP mice on day 0, and on day 3 the spleens of recipient mice were analyzed for CD3 + CD4 + CD25 + Foxp3 + total Tregs by flow cytometry. I Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ total Tregs per spleen at day 3 following BMDC transfer. n = 3 biologically independent mice. J – M PD-L2 high or PD-L2 null BMDCs were i.v. injected or not to WT or PD-L2 KO Foxp3 GFP mice on day 0, and on day 3 the spleens of recipient mice were analyzed for Tregs by flow cytometry. J Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ total Tregs. K Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − pTregs. L Numbers of CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 + tTregs. M Thymus of recipient mice were collected and analyzed by flow cytometry, and the frequencies of CD25 + TregP cells and Foxp3 lo TregP cells was analyzed based on CD25 and Foxp3 GFP expression, presented as mean ± SEM. n = 3 biologically independent mice. Data are representative of three independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used. Mouse image provided with permission from Servier Medical Art.

Techniques Used: Flow Cytometry, Expressing, Quantitation Assay, In Vitro, Cell Culture, Injection, Two Tailed Test, Comparison

A Spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were collected and analyzed by flow cytometry. Representative plots of CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − pTregs and CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 + tTregs. B Quantitation of pTreg and tTreg numbers in the spleen presented as means ± SEM. n = 5 biologically independent mice. C – D pTregs and tTregs—gated as in ( A )—were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and cultured for 24 h with CD3/CD28 beads, IL-2 and TGF-β. IL-10 was measured by ELISA in the culture supernatants. C Levels of IL-10 in pTreg cultures. n = 3 biologically independent samples. D Levels of IL-10 in tTreg cultures. E CD3 + CD4 + CD44 − CD62L + naive T cells were isolated from the spleens of BALB/c mice and co-cultured with FACS-sorted CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs isolated from Foxp3 GFP or PD-L2 KO Foxp3 GFP mice for 72 h. Cell proliferation was assessed by measuring thymidine incorporation. F 3 H thymidine incorporation after 72 h of culture. n = 4 biologically independent samples. G CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β. Genomic DNA was extracted, followed by bisulfite conversion, purification, cloning, and the degree of methylation of CpG#19, CpG#20, CpG#21, and CpG#22 within the TSDR region was determined by bisulfite sequencing. H Foxp3 GFP expression within WT and PD-L2 KO pTregs. n = 3 biologically independent samples. I Average methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. n = 3 biologically independent samples. J Methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. K 10 6 WT Foxp3 GFP iTregs were adoptively transferred to WT BALB/c or PD-L2 KO hosts on day 0 and on day 3, the frequencies of GFP + Tregs were analyzed in the spleen of recipients. L Representative plots of CD3 + CD4 + CD25 + Foxp3 GFP+ Tregs. M Numbers of transferred Tregs in the spleen presented as mean ± SEM. n = 3 biologically independent mice. Data are representative of two independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used. Mouse image provided with permission from Servier Medical Art.

Figure Legend Snippet: A Spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were collected and analyzed by flow cytometry. Representative plots of CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − pTregs and CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 + tTregs. B Quantitation of pTreg and tTreg numbers in the spleen presented as means ± SEM. n = 5 biologically independent mice. C – D pTregs and tTregs—gated as in ( A )—were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and cultured for 24 h with CD3/CD28 beads, IL-2 and TGF-β. IL-10 was measured by ELISA in the culture supernatants. C Levels of IL-10 in pTreg cultures. n = 3 biologically independent samples. D Levels of IL-10 in tTreg cultures. E CD3 + CD4 + CD44 − CD62L + naive T cells were isolated from the spleens of BALB/c mice and co-cultured with FACS-sorted CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs isolated from Foxp3 GFP or PD-L2 KO Foxp3 GFP mice for 72 h. Cell proliferation was assessed by measuring thymidine incorporation. F 3 H thymidine incorporation after 72 h of culture. n = 4 biologically independent samples. G CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β. Genomic DNA was extracted, followed by bisulfite conversion, purification, cloning, and the degree of methylation of CpG#19, CpG#20, CpG#21, and CpG#22 within the TSDR region was determined by bisulfite sequencing. H Foxp3 GFP expression within WT and PD-L2 KO pTregs. n = 3 biologically independent samples. I Average methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. n = 3 biologically independent samples. J Methylation of CpG#19, CpG#20, CpG#21, and CpG#22 in TSDR region. K 10 6 WT Foxp3 GFP iTregs were adoptively transferred to WT BALB/c or PD-L2 KO hosts on day 0 and on day 3, the frequencies of GFP + Tregs were analyzed in the spleen of recipients. L Representative plots of CD3 + CD4 + CD25 + Foxp3 GFP+ Tregs. M Numbers of transferred Tregs in the spleen presented as mean ± SEM. n = 3 biologically independent mice. Data are representative of two independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used. Mouse image provided with permission from Servier Medical Art.

Techniques Used: Flow Cytometry, Quantitation Assay, Cell Culture, Enzyme-linked Immunosorbent Assay, Isolation, Incubation, Purification, Cloning, Methylation, Methylation Sequencing, Expressing, Two Tailed Test, Comparison

A CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β. Cells were then lysed and mRNA was isolated to perform RNA-sequencing (RNA-seq). Volcano plot representation of differentially regulated genes in WT and PD-L2 KO pTregs. Dotted lines represent 2FC ( x axis) and p < 0.05 ( y axis) cutoffs. B – G Differentially regulated genes in selected pathways. B Treg function pathway. C Fatty acid (FA) degradation pathway. D Amino acid (AA) degradation pathway. E TCA cycle pathway. F Glycolysis pathway. G Pentose Phosphate Pathway (PPP) pathway. All red dots represent genes whose differences are p < 0.05. H – K CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTreg cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β. Following culture, cells were transferred to PDL-coated HS mini plates and a Mito Stress test was performed to measure oxygen levels in the culture medium. H Oxygen consumption rate (OCR) in response to Oligomycin (oligo.), FCCP, and Rotenone (Rot/AA) sequential injections. I Basal respiration in WT and PD-L2 KO pTregs. n = 3 biologically independent samples. J Spare respiratory capacity in WT and PD-L2 KO pTregs. K Respiration-coupled ATP production. L Representative flow cytometry plots of MitoTracker DR expression within WT and PD-L2 KO pTregs after 24 h of culture. M Quantitation of MitoTracker DR expression within WT and PD-L2 KO pTregs after 24 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. N CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β with or without 2 mM methyl pyruvate. O Levels of IL-10 production in the culture supernatants. n = 3 biologically independent samples. H – O Data are representative of two independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used.

Figure Legend Snippet: A CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β. Cells were then lysed and mRNA was isolated to perform RNA-sequencing (RNA-seq). Volcano plot representation of differentially regulated genes in WT and PD-L2 KO pTregs. Dotted lines represent 2FC ( x axis) and p < 0.05 ( y axis) cutoffs. B – G Differentially regulated genes in selected pathways. B Treg function pathway. C Fatty acid (FA) degradation pathway. D Amino acid (AA) degradation pathway. E TCA cycle pathway. F Glycolysis pathway. G Pentose Phosphate Pathway (PPP) pathway. All red dots represent genes whose differences are p < 0.05. H – K CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTreg cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β. Following culture, cells were transferred to PDL-coated HS mini plates and a Mito Stress test was performed to measure oxygen levels in the culture medium. H Oxygen consumption rate (OCR) in response to Oligomycin (oligo.), FCCP, and Rotenone (Rot/AA) sequential injections. I Basal respiration in WT and PD-L2 KO pTregs. n = 3 biologically independent samples. J Spare respiratory capacity in WT and PD-L2 KO pTregs. K Respiration-coupled ATP production. L Representative flow cytometry plots of MitoTracker DR expression within WT and PD-L2 KO pTregs after 24 h of culture. M Quantitation of MitoTracker DR expression within WT and PD-L2 KO pTregs after 24 h of culture, presented as mean ± SEM. n = 3 biologically independent samples. N CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − splenic pTregs cells were FACS-sorted from the spleens of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and incubated for 24 h with CD3/CD28 beads, IL-2 and TGF-β with or without 2 mM methyl pyruvate. O Levels of IL-10 production in the culture supernatants. n = 3 biologically independent samples. H – O Data are representative of two independent experiments and are presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used.

Techniques Used: Incubation, Isolation, RNA Sequencing, Flow Cytometry, Expressing, Quantitation Assay, Two Tailed Test, Comparison

A Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were i.n. challenged on days −10, −9 and −8 with 100 µg ovalbumin (OVA). On day 0, mice were intraperitoneally sensitized with 50 µg OVA emulsified in alum (1:1) and CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − pTreg numbers were analyzed by flow cytometry on day 7. B Representative plots of pTregs in the lungs of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice. C Numbers of pTregs in the lungs of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice presented as mean ± SEM. n = 4 biologically independent mice. D Representative plots of PD-1 expression in lung pTregs from Foxp3 GFP and PD-L2 KO Foxp3 GFP . E Representative plots of Foxp3 expression in lung pTregs from Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and corresponding quantitation presented as mean ± SEM. n = 3 biologically independent mice. F BALB/c (WT) and PD-L2 KO BMDC were differentiated in vitro for 7–10 days and cultured with FACS-sorted CD4 + CD44 − CD62L + KJ1-26 + naive T cells in the presence of IL-2, TGF-β, 100ng/mL OVA peptide and CD3/CD28 stimulation to induce Treg differentiation for 72 h at 1:20 ratio. G Representative plot of Foxp3 expression. H Foxp3 expression in T cells incubated with either WT or PD-L2 KO BMDC, presented as mean ± SEM. n = 3 biologically independent mice. I Levels of IL-10 in the supernatants, presented as mean ± SEM. n = 4 biologically independent samples. J Representative plots of BODIPY 493/503 expression in T cells incubated with either WT or PD-L2 KO BMDC and corresponding quantitation presented as mean ± SEM. n = 3 biologically independent samples. K Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were challenged as in A . On days 7, 8, and 9 mice were further challenged or not with 100 mg/kg ethyl pyruvate intraperitoneally. L Lung resistance in response to 40 mg/mL of methacholine. M Numbers of CD11b + Ly6G + neutrophils (PMN), CD11c − SiglecF + eosinophils (eos.), CD11c + SiglecF + CD64 + macrophages (mac.) and CD3 + T cells in the BAL fluid. n = 3 biologically independent mice. Data are representative of two independent experiments, presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used. Mouse image provided with permission from Servier Medical Art.

Figure Legend Snippet: A Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were i.n. challenged on days −10, −9 and −8 with 100 µg ovalbumin (OVA). On day 0, mice were intraperitoneally sensitized with 50 µg OVA emulsified in alum (1:1) and CD3 + CD4 + CD25 + Foxp3 GFP+ Nrp1 − pTreg numbers were analyzed by flow cytometry on day 7. B Representative plots of pTregs in the lungs of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice. C Numbers of pTregs in the lungs of Foxp3 GFP and PD-L2 KO Foxp3 GFP mice presented as mean ± SEM. n = 4 biologically independent mice. D Representative plots of PD-1 expression in lung pTregs from Foxp3 GFP and PD-L2 KO Foxp3 GFP . E Representative plots of Foxp3 expression in lung pTregs from Foxp3 GFP and PD-L2 KO Foxp3 GFP mice and corresponding quantitation presented as mean ± SEM. n = 3 biologically independent mice. F BALB/c (WT) and PD-L2 KO BMDC were differentiated in vitro for 7–10 days and cultured with FACS-sorted CD4 + CD44 − CD62L + KJ1-26 + naive T cells in the presence of IL-2, TGF-β, 100ng/mL OVA peptide and CD3/CD28 stimulation to induce Treg differentiation for 72 h at 1:20 ratio. G Representative plot of Foxp3 expression. H Foxp3 expression in T cells incubated with either WT or PD-L2 KO BMDC, presented as mean ± SEM. n = 3 biologically independent mice. I Levels of IL-10 in the supernatants, presented as mean ± SEM. n = 4 biologically independent samples. J Representative plots of BODIPY 493/503 expression in T cells incubated with either WT or PD-L2 KO BMDC and corresponding quantitation presented as mean ± SEM. n = 3 biologically independent samples. K Foxp3 GFP and PD-L2 KO Foxp3 GFP mice were challenged as in A . On days 7, 8, and 9 mice were further challenged or not with 100 mg/kg ethyl pyruvate intraperitoneally. L Lung resistance in response to 40 mg/mL of methacholine. M Numbers of CD11b + Ly6G + neutrophils (PMN), CD11c − SiglecF + eosinophils (eos.), CD11c + SiglecF + CD64 + macrophages (mac.) and CD3 + T cells in the BAL fluid. n = 3 biologically independent mice. Data are representative of two independent experiments, presented as means ± SEM. Source data are provided as a Source Data file. A two-tailed Student’s t test for unpaired data was applied for comparisons between two groups, except for multi-group comparisons where Tukey’s multiple comparison one-way ANOVA tests were used. Mouse image provided with permission from Servier Medical Art.

Techniques Used: Flow Cytometry, Expressing, Quantitation Assay, In Vitro, Cell Culture, Incubation, Two Tailed Test, Comparison

Methylation:

Article Title: Self-inactivating lentiviral vector comprising a FOXP3 expression cassette
Article Snippet: Methylation Analysis/Bisulfite Sequencing Genomic DNA was extracted from sorted Treg (CD4+CD25+) and Tconv (CD4+CD25−) subsets using the Purelink Genomic DNA mini kit (Invitrogen). .. CpG dinucleotide methylation analysis of CNS2 of the human FoxP3 gene was performed by EpigenDx and determined by bisulfate treatment of RNase-treated genomic DNA, followed by PCR amplification and pyrosequencing (EpigenDx assay ADS783-FS2). .. A custom assay was performed by EpigenDx for methylation analysis of FoxP3 CNS2 from integrated LV DNA using the following primers which uniquely recognize viral CNS2: FoxP3 CNS2 Viral F: TGGAGTTAGATTGTTTGGGA (SEQ ID NO:11); FoxP3 CNS2 Viral R: CACCTATAAATCCAAATACCCCAC (SEQ ID NO:12).

Article Title: Validation of an epigenetic field of susceptibility to detect significant prostate cancer from non-tumor biopsies
Article Snippet: .. Table S1 R2 linearity values for methylation pyrosequencing assay at each gene locus CG1 CG2 CG3 CG4 CG5 CG6 CG7 CG8 CG9 CG10 CAV1 0.9931 0.9947 0.9924 0.9871 0.9961 0.9738 0.9854 0.9979 0.9968 0.9923 EVX1 0.9956 0.9945 0.9968 0.9892 0.9929 0.992 FGF1 0.9941 0.9922 0.9845 0.9843 0.9862 NCR2 0.9957 0.9941 0.9961 PLA2G16 0.9891 0.9922 0.978 0.9874 0.981 0.9945 SPAG4 0.9946 0.9935 0.997 0.9896 0.9885 Human DNA standards with different percentages of methylation (EpigenDx) were used to test the precision of pyrosequencing. ..

Article Title: PD-L2 controls peripherally induced regulatory T cells by maintaining metabolic activity and Foxp3 stability
Article Snippet: .. For the methylation analysis, Foxp3 DNA methylation was performed by bisulfite pyrosequencing by EpigenDX as described previously . ..

Article Title: PD-L2 controls peripherally induced regulatory T cells by maintaining metabolic activity and Foxp3 stability.
Article Snippet: .. For the methylation analysis, Foxp3 DNA methylation was performed by bisulfite pyrosequencing by EpigenDX as described previously55. ..

Article Title: BCG therapy is associated with long-term, durable induction of Treg signature genes by epigenetic modulation
Article Snippet: All the above methods in our studies were inferior (less quantitative) to flow or to the Human Infinium Methylation EPIC Chip for most DNA sites, so the majority of the data presented in this study only used the Illumina technology. .. Since the Human Infinium Methylation Epic Bead Chip did not contain the DNA for the TSDR region of the Foxp3 gene, both pyrosequencing and NGBS methods were used to assess methylation of this region (EpigenDx, Hopkinton, MA). ..

Review

foxp3 dna methylation (EpigenDx)

Structured Review

Images

1) Product Images from "PD-L2 controls peripherally induced regulatory T cells by maintaining metabolic activity and Foxp3 stability"

Related Articles

Methylation:

Polymerase Chain Reaction:

Amplification:

Pyrosequencing Assay:

DNA Methylation Assay:

Similar Products

Image Search Results