Review




Structured Review

SourceForge net primer3 core c program version 2.3.4
(A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by <t>Primer3</t> with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.
Primer3 Core C Program Version 2.3.4, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer3_core+program/primer3/pmc04749234-63-5-27
Average 90 stars, based on 1 article reviews
primer3 core c program version 2.3.4 - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays"

Article Title: Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

Journal: PLoS ONE

doi: 10.1371/journal.pone.0146950

(A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by Primer3 with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.
Figure Legend Snippet: (A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by Primer3 with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.

Techniques Used: Mutagenesis, Virus

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Role Analysis of the scarb1 Gene in the Pigmentation of Neocaridina denticulata sinensis .
Article Snippet: .. Primers (Table 1) for qPCR were designed using Primer3 online software (https://sourceforge.net/projects/primer3/, accessed on 17 March 2025) and synthesized by TsingKe Biotechnology Co., Ltd. (Beijing, China). ..

Article Title: Role Analysis of the scarb1 Gene in the Pigmentation of Neocaridina denticulata sinensis
Article Snippet: .. Primers ( ) for qPCR were designed using Primer3 online software ( https://sourceforge.net/projects/primer3/ , accessed on 17 March 2025) and synthesized by TsingKe Biotechnology Co., Ltd. (Beijing, China). ..

Software:

Article Title: Role Analysis of the scarb1 Gene in the Pigmentation of Neocaridina denticulata sinensis .
Article Snippet: .. Primers (Table 1) for qPCR were designed using Primer3 online software (https://sourceforge.net/projects/primer3/, accessed on 17 March 2025) and synthesized by TsingKe Biotechnology Co., Ltd. (Beijing, China). ..

Article Title: Role Analysis of the scarb1 Gene in the Pigmentation of Neocaridina denticulata sinensis
Article Snippet: .. Primers ( ) for qPCR were designed using Primer3 online software ( https://sourceforge.net/projects/primer3/ , accessed on 17 March 2025) and synthesized by TsingKe Biotechnology Co., Ltd. (Beijing, China). ..

Article Title: Development of KASP markers, SNP fingerprinting and population genetic analysis of Cymbidium ensifolium (L.) Sw. germplasm resources in China
Article Snippet: .. For each selected SNP marker, primer design was conducted using Primer3 software (version: 2.4.0, https://sourceforge.net/projects/primer3/files/latest/download ). ..

Synthesized:

Article Title: Role Analysis of the scarb1 Gene in the Pigmentation of Neocaridina denticulata sinensis .
Article Snippet: .. Primers (Table 1) for qPCR were designed using Primer3 online software (https://sourceforge.net/projects/primer3/, accessed on 17 March 2025) and synthesized by TsingKe Biotechnology Co., Ltd. (Beijing, China). ..

Article Title: Role Analysis of the scarb1 Gene in the Pigmentation of Neocaridina denticulata sinensis
Article Snippet: .. Primers ( ) for qPCR were designed using Primer3 online software ( https://sourceforge.net/projects/primer3/ , accessed on 17 March 2025) and synthesized by TsingKe Biotechnology Co., Ltd. (Beijing, China). ..

Polymerase Chain Reaction:

Article Title: Detecting mutations and ploidy in chromosomal segments
Article Snippet: .. For each candidate locus, one or more PCR primer pairs were designed using the Primer3 program (the worldwide web at primer3.sourceforge.net; libprimer3 release 2.2.3, which is hereby incorporated by reference in its entirety). ..

Article Title: Detecting mutations and ploidy in chromosomal segments
Article Snippet: .. In one embodiment, the PCR primers may be designed using the Primer3 program (the worldwide web at primer3.sourceforge.net; libprimer3 release 2.2.3, which is hereby incorporated by reference in its entirety). ..

Marker:

Article Title: Development of KASP markers, SNP fingerprinting and population genetic analysis of Cymbidium ensifolium (L.) Sw. germplasm resources in China
Article Snippet: .. For each selected SNP marker, primer design was conducted using Primer3 software (version: 2.4.0, https://sourceforge.net/projects/primer3/files/latest/download ). ..

other:

Article Title: Allium sativum and Allium cepa offer excellent potential for introgression and production of allicin and high total soluble solids into closely related wild Alliums
Article Snippet: High total soluble solids (HTSS) and high sulfur-containing compounds like allicin are highly demanded by industry due to their variety of pharmaceuticals, and ecologically friendly alternatives to synthetic preservation agents.. Compared to wild Alliums, cultivated Alliums are a rich source of HTSS and allicin.. For introgression of HTSS trait-related genes in wild Alliums and identification of HTSS containing Allium cepa genotypes, we mined 1178 AcSSR markers and evaluated 200 AcSSR in ten Alliums for polymorphism and cross-transferability.

Article Title: Detecting mutations and ploidy in chromosomal segments
Article Snippet: In some embodiments, the Tm is calculated using the Primer3 program (libprimer3 release 2.2.3) using the built-in SantaLucia parameters (the world wide web at primer3.sourceforge.net).

Sequencing:

Article Title: Development of KASP markers, SNP fingerprinting and population genetic analysis of Cymbidium ensifolium (L.) Sw. germplasm resources in China
Article Snippet: .. For successfully validated sites, KASP primers were redesigned using the real first-generation sequencing results with Primer3 (version: 2.4.0, https://sourceforge.net/projects/primer3/files/latest/download ). .. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., with FAM- or VIC-tails (FAM-tail: 5′-GAAGGTGACCAAGTTCATGCT-3′; VIC-tail: 5′- GAAGGTCGGAGTCAACGGATT -3′) ( ).



Similar Products

90
PrimerDesign Inc primer3 core program
Primer3 Core Program, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer3_core+program/primer3/pm39987466-127-8-1
Average 90 stars, based on 1 article reviews
primer3 core program - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SourceForge net primer3 core c program version 2.3.4
(A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by <t>Primer3</t> with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.
Primer3 Core C Program Version 2.3.4, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer3_core+program/primer3/pmc04749234-63-5-27
Average 90 stars, based on 1 article reviews
primer3 core c program version 2.3.4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc primer3 core c program version 2.3.4
(A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by <t>Primer3</t> with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.
Primer3 Core C Program Version 2.3.4, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer3_core+program/primer3/pmc04749234-90-10-10
Average 90 stars, based on 1 article reviews
primer3 core c program version 2.3.4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


(A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by Primer3 with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.

Journal: PLoS ONE

Article Title: Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

doi: 10.1371/journal.pone.0146950

Figure Lengend Snippet: (A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by Primer3 with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.

Article Snippet: Edesign is based on the Primer3 software (Primer3 core C program version 2.3.4 and Primer3 web interface version 3.0.0), for which the source code was downloaded at http://sourceforge.net/projects/primer3/files/primer3/ , and for the web interface at http://sourceforge.net/projects/primer3/files/primer3-web/ .

Techniques: Mutagenesis, Virus

(A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by Primer3 with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.

Journal: PLoS ONE

Article Title: Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

doi: 10.1371/journal.pone.0146950

Figure Lengend Snippet: (A-D) Evaluation for mutation detection using pandemic 2009 H1N1 influenza virus genome segment 6 (neuraminidase) H275Y mutation; (E-H) Evaluation for low copy DNA detection using influenza B virus genome segment 7 (matrix protein) as a template. Upper panels (A, C, E, G) show results obtained by using Eprobes and primers designed by Primer3 with updated tables for T M calculation of ECHOs. Lower panels (B, D, F, H) show results obtained by using Eprobes and primers designed by Edesign. Details on primers and Eprobes used are provided in and Figs.

Article Snippet: Our new design tool, Edesign, was developed using the established primer design software Primer3 (Primer3 core C program version 2.3.4 and Primer3 web interface version 3.0.0).

Techniques: Mutagenesis, Virus